Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PADI6	353238	broad.mit.edu	37	1	17699701	17699701	+	Silent	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17699701G>A	uc001bak.1	+	2	267	c.267G>A	c.(265-267)TCG>TCA	p.S89S		NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6	81					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AGATGACATCGCCCAGCCCTT	0.602													35	52	---	---	---	---	capture	Silent	SNP	17699701	17699701	PADI6	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11285	121
HRNR	388697	broad.mit.edu	37	1	152193158	152193158	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152193158G>A	uc001ezt.1	-	3	1023	c.947C>T	c.(946-948)TCG>TTG	p.S316L		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	316	3.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAGTGCCCCGAACCGGACCC	0.607													6	98	---	---	---	---	capture	Missense_Mutation	SNP	152193158	152193158	HRNR	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7284	121
IVL	3713	broad.mit.edu	37	1	152883944	152883944	+	Silent	SNP	A	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152883944A>C	uc001fau.2	+	2	1717	c.1671A>C	c.(1669-1671)CCA>CCC	p.P557P		NM_005547	NP_005538	P07476	INVO_HUMAN	involucrin	557					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity			ovary(3)	3	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACATTCAACCAGCCCTGCCCA	0.398													38	69	---	---	---	---	capture	Silent	SNP	152883944	152883944	IVL	1	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	7852	121
OR14I1	401994	broad.mit.edu	37	1	248845184	248845184	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248845184T>C	uc001ieu.1	-	1	422	c.422A>G	c.(421-423)CAG>CGG	p.Q141R		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	141	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GACTGCCATCTGATAGCACCC	0.542													27	47	---	---	---	---	capture	Missense_Mutation	SNP	248845184	248845184	OR14I1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	10851	121
MS4A3	932	broad.mit.edu	37	11	59828736	59828736	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59828736C>A	uc001nom.2	+	2	231	c.103C>A	c.(103-105)CAG>AAG	p.Q35K	MS4A3_uc001non.2_Missense_Mutation_p.Q35K|MS4A3_uc001noo.2_Intron	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	35	Cytoplasmic (Potential).			Q -> H (in Ref. 1; AAA62319).		endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				TTCTGTCTACCAGCCCATAGA	0.473													52	78	---	---	---	---	capture	Missense_Mutation	SNP	59828736	59828736	MS4A3	11	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	9771	121
SLC22A6	9356	broad.mit.edu	37	11	62749352	62749352	+	Silent	SNP	C	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62749352C>A	uc001nwk.2	-	4	1066	c.759G>T	c.(757-759)CTG>CTT	p.L253L	SLC22A6_uc001nwl.2_Silent_p.L253L|SLC22A6_uc001nwj.2_Silent_p.L253L|SLC22A6_uc001nwm.2_Silent_p.L253L	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a	253	Helical; (Potential).				alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0						GCGCAGAGACCAGTAGCTGCA	0.617													3	37	---	---	---	---	capture	Silent	SNP	62749352	62749352	SLC22A6	11	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	14350	121
MAP3K11	4296	broad.mit.edu	37	11	65381159	65381159	+	Silent	SNP	A	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65381159A>C	uc001oew.2	-	1	562	c.69T>G	c.(67-69)GGT>GGG	p.G23G	MAP3K11_uc010rol.1_5'Flank|PCNXL3_uc001oey.2_5'Flank	NM_002419	NP_002410	Q16584	M3K11_HUMAN	mitogen-activated protein kinase kinase kinase	23	Gly-rich.|Poly-Gly.				activation of JUN kinase activity|cell proliferation|G1 phase of mitotic cell cycle|microtubule-based process|positive regulation of JNK cascade|protein autophosphorylation	centrosome|microtubule	ATP binding|JUN kinase kinase kinase activity|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity			breast(3)|lung(1)|central_nervous_system(1)|skin(1)	6						CGCCCCCACCACCCCCGCTGC	0.667													4	15	---	---	---	---	capture	Silent	SNP	65381159	65381159	MAP3K11	11	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	9159	121
MMP13	4322	broad.mit.edu	37	11	102825250	102825250	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102825250G>A	uc001phl.2	-	3	476	c.448C>T	c.(448-450)CCT>TCT	p.P150S		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	150					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		AAATTCAGAGGAGTTACATCG	0.343													41	57	---	---	---	---	capture	Missense_Mutation	SNP	102825250	102825250	MMP13	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	9564	121
GPRC5A	9052	broad.mit.edu	37	12	13061399	13061399	+	Silent	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:13061399C>T	uc001rba.2	+	2	866	c.216C>T	c.(214-216)CTC>CTT	p.L72L	GPRC5A_uc001raz.2_Silent_p.L72L	NM_003979	NP_003970	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, family C, group 5,	72	Helical; Name=2; (Potential).					cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	TTCTCTTCCTCCTGGGTGTGT	0.557													122	176	---	---	---	---	capture	Silent	SNP	13061399	13061399	GPRC5A	12	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	6657	121
ATF7IP	55729	broad.mit.edu	37	12	14599967	14599967	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14599967G>T	uc001rbw.2	+	6	2133	c.1975G>T	c.(1975-1977)GAT>TAT	p.D659Y	ATF7IP_uc010shs.1_Missense_Mutation_p.D658Y|ATF7IP_uc001rbu.2_Missense_Mutation_p.D659Y|ATF7IP_uc001rbv.1_Missense_Mutation_p.D658Y|ATF7IP_uc001rbx.2_Missense_Mutation_p.D658Y|ATF7IP_uc010sht.1_Missense_Mutation_p.D659Y|ATF7IP_uc001rby.3_Missense_Mutation_p.D659Y|ATF7IP_uc001rca.2_Missense_Mutation_p.D659Y	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	659	Interaction with SETDB1.|Potential.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						AGCCAAAGAAGATCTTAAGAA	0.308													23	38	---	---	---	---	capture	Missense_Mutation	SNP	14599967	14599967	ATF7IP	12	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	1078	121
BTBD11	121551	broad.mit.edu	37	12	108012040	108012040	+	Silent	SNP	G	A	A	rs150221761	byFrequency	TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108012040G>A	uc001tmk.1	+	10	2858	c.2337G>A	c.(2335-2337)CCG>CCA	p.P779P	BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Silent_p.P779P|BTBD11_uc001tml.1_Silent_p.P316P	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	779						integral to membrane	DNA binding			skin(2)|ovary(1)	3						AGACAGCCCCGCCCCCCTTGT	0.612													30	32	---	---	---	---	capture	Silent	SNP	108012040	108012040	BTBD11	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1527	121
SYNE2	23224	broad.mit.edu	37	14	64634098	64634098	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64634098C>T	uc001xgm.2	+	91	16983	c.16753C>T	c.(16753-16755)CGC>TGC	p.R5585C	SYNE2_uc001xgl.2_Missense_Mutation_p.R5585C|SYNE2_uc010apy.2_Missense_Mutation_p.R1970C|SYNE2_uc001xgn.2_Missense_Mutation_p.R547C|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_5'UTR|SYNE2_uc001xgq.2_5'Flank	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5585	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGCACTGGAGCGCTGCAGGTT	0.478													45	69	---	---	---	---	capture	Missense_Mutation	SNP	64634098	64634098	SYNE2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15334	121
WDR72	256764	broad.mit.edu	37	15	53889439	53889439	+	Silent	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:53889439C>T	uc002acj.2	-	18	3027	c.2985G>A	c.(2983-2985)GCG>GCA	p.A995A		NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	995										lung(1)|skin(1)	2				all cancers(107;0.0511)		GTTGAACTTCCGCCAAGAGAA	0.378													107	175	---	---	---	---	capture	Silent	SNP	53889439	53889439	WDR72	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17203	121
FAM65A	79567	broad.mit.edu	37	16	67572596	67572596	+	Silent	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67572596G>A	uc010vjp.1	+	3	282	c.186G>A	c.(184-186)CCG>CCA	p.P62P	FAM65A_uc010cei.1_5'UTR|FAM65A_uc002eth.2_Silent_p.P42P|FAM65A_uc010cej.2_Silent_p.P45P|FAM65A_uc002eti.1_Intron|FAM65A_uc010vjq.1_Silent_p.P56P|FAM65A_uc002etj.1_Silent_p.P41P|FAM65A_uc002etk.2_Silent_p.P41P	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	46						cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TCTTCAGCCCGCCGGGGCCCC	0.682													4	153	---	---	---	---	capture	Silent	SNP	67572596	67572596	FAM65A	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5547	121
LRRC37B	114659	broad.mit.edu	37	17	30348508	30348508	+	Silent	SNP	T	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:30348508T>C	uc002hgu.2	+	1	354	c.343T>C	c.(343-345)TTG>CTG	p.L115L	LRRC37B_uc010wbx.1_Silent_p.L33L|LRRC37B_uc010csu.2_Silent_p.L115L	NM_052888	NP_443120	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B precursor	115	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				AGAGCCGTTCTTGGCTGCACA	0.547													4	264	---	---	---	---	capture	Silent	SNP	30348508	30348508	LRRC37B	17	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	8909	121
G6PC3	92579	broad.mit.edu	37	17	42152338	42152338	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42152338C>A	uc002iex.2	+	4	634	c.418C>A	c.(418-420)CGC>AGC	p.R140S	G6PC3_uc002iey.2_Missense_Mutation_p.R15S|G6PC3_uc010czo.2_5'UTR|G6PC3_uc002iez.2_Missense_Mutation_p.R15S|G6PC3_uc002ifb.2_Missense_Mutation_p.R15S|G6PC3_uc002ifc.2_Intron	NM_138387	NP_612396	Q9BUM1	G6PC3_HUMAN	glucose-6-phosphatase catalytic subunit 3	140	Cytoplasmic (Potential).				gluconeogenesis|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphatase activity			skin(1)	1		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TCTTTCTAGCCGCTGGGTAAG	0.542													28	335	---	---	---	---	capture	Missense_Mutation	SNP	42152338	42152338	G6PC3	17	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	6087	121
RALBP1	10928	broad.mit.edu	37	18	9516893	9516893	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:9516893A>G	uc002kob.2	+	3	518	c.295A>G	c.(295-297)AGT>GGT	p.S99G	RALBP1_uc002koc.2_Missense_Mutation_p.S99G	NM_006788	NP_006779	Q15311	RBP1_HUMAN	ralA binding protein 1	99					chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding			central_nervous_system(1)	1						TGAGGCAGAAAGTCCTTCTAA	0.323													50	72	---	---	---	---	capture	Missense_Mutation	SNP	9516893	9516893	RALBP1	18	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	12907	121
GATA6	2627	broad.mit.edu	37	18	19762971	19762971	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19762971T>A	uc002ktt.1	+	6	1852	c.1587T>A	c.(1585-1587)AAT>AAA	p.N529K	GATA6_uc002ktu.1_Missense_Mutation_p.N529K	NM_005257	NP_005248	Q92908	GATA6_HUMAN	GATA binding protein 6	529					blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(3)	3	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			GCAGCAAAAATACTTCCCCCA	0.373													28	47	---	---	---	---	capture	Missense_Mutation	SNP	19762971	19762971	GATA6	18	T	A	A	A	1	0	0	0	0	1	0	0	0	634	49	4	4	6198	121
CDH2	1000	broad.mit.edu	37	18	25591942	25591942	+	Silent	SNP	A	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:25591942A>C	uc002kwg.2	-	4	873	c.414T>G	c.(412-414)GTT>GTG	p.V138V	CDH2_uc010xbn.1_Silent_p.V107V	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	138					adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						CTATTTCTTCAACTTCTGCTG	0.388													70	100	---	---	---	---	capture	Silent	SNP	25591942	25591942	CDH2	18	A	C	C	C	1	0	0	0	0	0	0	0	1	54	5	4	4	3076	121
SBNO2	22904	broad.mit.edu	37	19	1113547	1113547	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1113547T>C	uc002lrk.3	-	19	2472	c.2234A>G	c.(2233-2235)CAG>CGG	p.Q745R	SBNO2_uc002lrj.3_Missense_Mutation_p.Q688R|SBNO2_uc010dse.2_Missense_Mutation_p.Q728R|SBNO2_uc010xgj.1_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1	745					macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCACCCGCTGGGGGCCGCC	0.697													10	17	---	---	---	---	capture	Missense_Mutation	SNP	1113547	1113547	SBNO2	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	13755	121
ZNF554	115196	broad.mit.edu	37	19	2833912	2833912	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2833912A>T	uc002lwm.2	+	5	877	c.679A>T	c.(679-681)AAT>TAT	p.N227Y	ZNF554_uc002lwl.2_Missense_Mutation_p.N176Y	NM_001102651	NP_001096121	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	227					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAAATGGTAATCTGAGCCC	0.502													72	163	---	---	---	---	capture	Missense_Mutation	SNP	2833912	2833912	ZNF554	19	A	T	T	T	1	0	0	0	0	1	0	0	0	169	13	4	4	17864	121
MCOLN1	57192	broad.mit.edu	37	19	7591685	7591685	+	Silent	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7591685G>A	uc002mgo.2	+	4	569	c.444G>A	c.(442-444)GCG>GCA	p.A148A	MCOLN1_uc002mgp.2_Missense_Mutation_p.R35H	NM_020533	NP_065394	Q9GZU1	MCLN1_HUMAN	mucolipin 1	148					calcium ion transport|cellular iron ion homeostasis|transferrin transport	integral to plasma membrane|late endosome membrane|lysosomal membrane	cation channel activity|iron ion transmembrane transporter activity			breast(1)	1						GCCGGTATGCGTATGTCCGTG	0.537													40	118	---	---	---	---	capture	Silent	SNP	7591685	7591685	MCOLN1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	9308	121
CLEC4M	10332	broad.mit.edu	37	19	7832494	7832494	+	Silent	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7832494C>T	uc002mih.2	+	7	1078	c.960C>T	c.(958-960)GAC>GAT	p.D320D	CLEC4M_uc002mhy.2_3'UTR|CLEC4M_uc010xjw.1_Silent_p.D276D|CLEC4M_uc010dvt.2_Silent_p.D297D|CLEC4M_uc010dvs.2_Silent_p.D319D|CLEC4M_uc010xjx.1_Silent_p.D292D|CLEC4M_uc002mhz.2_Intron|CLEC4M_uc002mic.2_Intron|CLEC4M_uc002mia.2_Silent_p.D207D	NM_001144910	NP_001138382	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M isoform	343	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding			pancreas(1)	1						AATGGGTGGACGGCTCACCTC	0.562													41	146	---	---	---	---	capture	Silent	SNP	7832494	7832494	CLEC4M	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3483	121
CYP4F12	66002	broad.mit.edu	37	19	15795890	15795890	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15795890C>T	uc002nbl.2	+	9	1059	c.998C>T	c.(997-999)ACG>ATG	p.T333M		NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					CATGACACCACGGCCAGTGGC	0.627													12	47	---	---	---	---	capture	Missense_Mutation	SNP	15795890	15795890	CYP4F12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4147	121
SBSN	374897	broad.mit.edu	37	19	36019170	36019170	+	Missense_Mutation	SNP	C	T	T	rs138249808		TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36019170C>T	uc002oae.1	-	1	84	c.14G>A	c.(13-15)CGT>CAT	p.R5H	SBSN_uc002oad.1_Missense_Mutation_p.R5H	NM_198538	NP_940940	Q6UWP8	SBSN_HUMAN	suprabasin isoform 2 precursor	5						extracellular region				ovary(1)	1	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCCGACCAGACGTGCAAGATG	0.587													6	81	---	---	---	---	capture	Missense_Mutation	SNP	36019170	36019170	SBSN	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13756	121
FCGBP	8857	broad.mit.edu	37	19	40380305	40380305	+	Silent	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40380305G>A	uc002omp.3	-	23	11018	c.11010C>T	c.(11008-11010)TTC>TTT	p.F3670F		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	3670	VWFD 9.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCATGAAGTCGAAGCGGTGGC	0.672													45	175	---	---	---	---	capture	Silent	SNP	40380305	40380305	FCGBP	19	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	5724	121
PRX	57716	broad.mit.edu	37	19	40902798	40902798	+	Silent	SNP	C	T	T	rs140474860		TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40902798C>T	uc002onr.2	-	7	1730	c.1461G>A	c.(1459-1461)CCG>CCA	p.P487P	PRX_uc002onq.2_Silent_p.P348P|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	487	9.|55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCCGCACCTCCGGCACAGCCA	0.597													9	353	---	---	---	---	capture	Silent	SNP	40902798	40902798	PRX	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12537	121
ZNF816A	125893	broad.mit.edu	37	19	53453300	53453300	+	Silent	SNP	T	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53453300T>C	uc002qal.1	-	5	2029	c.1728A>G	c.(1726-1728)CAA>CAG	p.Q576Q	ZNF321_uc010eqj.2_Intron|ZNF321_uc002qak.1_Intron|ZNF816A_uc002qam.1_Silent_p.Q560Q	NM_001031665	NP_001026835	Q0VGE8	ZN816_HUMAN	zinc finger protein 816A	576	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0313)		GGATTCCTTTTTGATTAAAAA	0.388													62	151	---	---	---	---	capture	Silent	SNP	53453300	53453300	ZNF816A	19	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	18053	121
VRK2	7444	broad.mit.edu	37	2	58373508	58373508	+	Missense_Mutation	SNP	G	A	A	rs139700760		TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:58373508G>A	uc002rzo.2	+	15	1826	c.1081G>A	c.(1081-1083)GAA>AAA	p.E361K	VRK2_uc010fcb.2_Missense_Mutation_p.E361K|VRK2_uc002rzs.2_Missense_Mutation_p.E361K|VRK2_uc002rzr.2_Missense_Mutation_p.E361K|VRK2_uc010fcc.2_Missense_Mutation_p.E243K|VRK2_uc002rzv.2_Missense_Mutation_p.E361K|VRK2_uc010fcd.2_Missense_Mutation_p.E338K|VRK2_uc002rzp.2_Missense_Mutation_p.E361K|VRK2_uc010ypg.1_Missense_Mutation_p.E361K|VRK2_uc002rzq.2_Missense_Mutation_p.E361K|VRK2_uc002rzu.2_Missense_Mutation_p.E361K|VRK2_uc002rzt.2_Missense_Mutation_p.E243K	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2	361						integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TAGGTTAATCGAAAAAAAAGT	0.383													21	41	---	---	---	---	capture	Missense_Mutation	SNP	58373508	58373508	VRK2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17102	121
RPN2	6185	broad.mit.edu	37	20	35835810	35835810	+	Silent	SNP	T	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35835810T>C	uc002xgp.2	+	7	1129	c.825T>C	c.(823-825)CCT>CCC	p.P275P	RPN2_uc002xgo.3_Silent_p.P275P|RPN2_uc010gfw.2_Silent_p.P118P|RPN2_uc002xgq.2_Silent_p.P243P	NM_002951	NP_002942	P04844	RPN2_HUMAN	ribophorin II isoform 1 precursor	275	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TGGTTGTGCCTGAGGGCTCTG	0.537													82	264	---	---	---	---	capture	Silent	SNP	35835810	35835810	RPN2	20	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	13500	121
SLC13A3	64849	broad.mit.edu	37	20	45194937	45194937	+	Silent	SNP	G	A	A	rs147641404		TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:45194937G>A	uc002xsf.1	-	11	1463	c.1425C>T	c.(1423-1425)ATC>ATT	p.I475I	SLC13A3_uc010ghn.1_Silent_p.I444I|SLC13A3_uc010zxw.1_Silent_p.I425I|SLC13A3_uc002xsg.1_Silent_p.I428I|SLC13A3_uc010gho.1_Silent_p.I393I|SLC13A3_uc010zxx.1_Silent_p.I377I|SLC13A3_uc002xse.1_5'Flank|SLC13A3_uc010ghm.1_Silent_p.I62I|SLC13A3_uc010zxv.1_Silent_p.I60I	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a	475	Helical; (Potential).					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	TGAAGAAGGCGATGACCACAG	0.617													93	227	---	---	---	---	capture	Silent	SNP	45194937	45194937	SLC13A3	20	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	14286	121
KCNG1	3755	broad.mit.edu	37	20	49626233	49626233	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49626233C>G	uc002xwa.3	-	2	938	c.643G>C	c.(643-645)GAC>CAC	p.D215H	KCNG1_uc002xwb.2_Missense_Mutation_p.D215H	NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G,	215	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2						TCCACCATGTCGCGCAGTCGC	0.726													8	43	---	---	---	---	capture	Missense_Mutation	SNP	49626233	49626233	KCNG1	20	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	7949	121
COL6A2	1292	broad.mit.edu	37	21	47532419	47532419	+	Silent	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47532419C>T	uc002zia.1	+	3	724	c.642C>T	c.(640-642)AAC>AAT	p.N214N	COL6A2_uc002zhy.1_Silent_p.N214N|COL6A2_uc002zhz.1_Silent_p.N214N|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	214	VWFA 1.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TCTACCGCAACGACTACGCCA	0.667													19	37	---	---	---	---	capture	Silent	SNP	47532419	47532419	COL6A2	21	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3665	121
CBLB	868	broad.mit.edu	37	3	105400636	105400636	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:105400636A>G	uc003dwc.2	-	15	2550	c.2228T>C	c.(2227-2229)CTG>CCG	p.L743P	CBLB_uc003dwa.2_Missense_Mutation_p.L2P|CBLB_uc011bhi.1_Missense_Mutation_p.L765P|CBLB_uc003dwd.1_Missense_Mutation_p.L743P|CBLB_uc003dwe.1_Missense_Mutation_p.L743P	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	743	Pro-rich.				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						TGTTCCATTCAGCATACAGTG	0.343			Mis S		AML								43	90	---	---	---	---	capture	Missense_Mutation	SNP	105400636	105400636	CBLB	3	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	2677	121
PHLDB2	90102	broad.mit.edu	37	3	111632481	111632481	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111632481C>T	uc010hqa.2	+	3	2062	c.1651C>T	c.(1651-1653)CCT>TCT	p.P551S	PHLDB2_uc003dyc.2_Missense_Mutation_p.P578S|PHLDB2_uc003dyd.2_Missense_Mutation_p.P551S|PHLDB2_uc003dyg.2_Missense_Mutation_p.P551S|PHLDB2_uc003dyh.2_Missense_Mutation_p.P551S|PHLDB2_uc003dyi.2_Missense_Mutation_p.P137S|PHLDB2_uc003dyf.3_Missense_Mutation_p.P551S	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	551						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						CACCCGGACTCCTCCACCACC	0.512													115	206	---	---	---	---	capture	Missense_Mutation	SNP	111632481	111632481	PHLDB2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	11755	121
CCDC48	79825	broad.mit.edu	37	3	128757682	128757682	+	Silent	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:128757682G>A	uc011bkt.1	+	7	1599	c.1599G>A	c.(1597-1599)TCG>TCA	p.S533S		NM_024768	NP_079044	Q9HA90	CCD48_HUMAN	coiled-coil domain containing 48	533	Potential.										0						AGAACATATCGAAAAGAGCCC	0.552													64	127	---	---	---	---	capture	Silent	SNP	128757682	128757682	CCDC48	3	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	2793	121
LRRC33	375387	broad.mit.edu	37	3	196388089	196388089	+	Silent	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196388089C>T	uc003fwv.2	+	3	1679	c.1575C>T	c.(1573-1575)TCC>TCT	p.S525S		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	525	Extracellular (Potential).|LRR 18.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		GCCTCCACTCCAGCTTTATGG	0.567													123	181	---	---	---	---	capture	Silent	SNP	196388089	196388089	LRRC33	3	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	8904	121
FGFBP2	83888	broad.mit.edu	37	4	15964315	15964315	+	Silent	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15964315C>T	uc003gon.2	-	1	545	c.438G>A	c.(436-438)GGG>GGA	p.G146G		NM_031950	NP_114156	Q9BYJ0	FGFP2_HUMAN	killer-specific secretory protein of 37 kDa	146						extracellular space	growth factor binding				0						GAGATGGCGTCCCAGCCTCAG	0.617													71	142	---	---	---	---	capture	Silent	SNP	15964315	15964315	FGFBP2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	5807	121
STAP1	26228	broad.mit.edu	37	4	68449405	68449405	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:68449405T>C	uc003hde.3	+	6	726	c.644T>C	c.(643-645)ATT>ACT	p.I215T	STAP1_uc003hdf.2_Missense_Mutation_p.I215T	NM_012108	NP_036240	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1	215	SH2.				cellular membrane fusion|intracellular protein transport	cytoplasm					0						TCCATCACTATTCGGCAGGAG	0.408													8	60	---	---	---	---	capture	Missense_Mutation	SNP	68449405	68449405	STAP1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	15142	121
PDHA2	5161	broad.mit.edu	37	4	96761326	96761326	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96761326G>A	uc003htr.3	+	1	88	c.25G>A	c.(25-27)GTG>ATG	p.V9M		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	9					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	CATCTCCCGCGTGTTGAGGCG	0.557													28	30	---	---	---	---	capture	Missense_Mutation	SNP	96761326	96761326	PDHA2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11568	121
EGF	1950	broad.mit.edu	37	4	110908980	110908980	+	Silent	SNP	T	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110908980T>C	uc003hzy.3	+	17	3024	c.2572T>C	c.(2572-2574)TTG>CTG	p.L858L	EGF_uc011cfu.1_Silent_p.L816L|EGF_uc011cfv.1_Silent_p.L858L|EGF_uc010imk.2_Intron	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	858	EGF-like 6.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	ATGTCAGTGTTTGAAAGGATT	0.423													61	93	---	---	---	---	capture	Silent	SNP	110908980	110908980	EGF	4	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	4917	121
SLC6A19	340024	broad.mit.edu	37	5	1217004	1217004	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1217004G>A	uc003jbw.3	+	8	1173	c.1117G>A	c.(1117-1119)GCG>ACG	p.A373T		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	373	Extracellular (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CTCCGACCCCGCGGCCTACGC	0.622													141	228	---	---	---	---	capture	Missense_Mutation	SNP	1217004	1217004	SLC6A19	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14574	121
PIK3R1	5295	broad.mit.edu	37	5	67591086	67591086	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591086A>G	uc003jva.2	+	13	2239	c.1679A>G	c.(1678-1680)GAC>GGC	p.D560G	PIK3R1_uc003jvb.2_Missense_Mutation_p.D560G|PIK3R1_uc003jvc.2_Missense_Mutation_p.D260G|PIK3R1_uc003jvd.2_Missense_Mutation_p.D290G|PIK3R1_uc003jve.2_Missense_Mutation_p.D239G|PIK3R1_uc011crb.1_Missense_Mutation_p.D230G	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	560					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.D560_S565del(1)|p.R557_K561>Q(1)|p.D560Y(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CGAGAAATTGACAAACGTATG	0.358			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			51	84	---	---	---	---	capture	Missense_Mutation	SNP	67591086	67591086	PIK3R1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	11821	121
GRIA1	2890	broad.mit.edu	37	5	153065877	153065877	+	Silent	SNP	C	T	T	rs140876127		TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:153065877C>T	uc003lva.3	+	8	1487	c.1122C>T	c.(1120-1122)GAC>GAT	p.D374D	GRIA1_uc003luy.3_Silent_p.D374D|GRIA1_uc003luz.3_Silent_p.D279D|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Silent_p.D294D|GRIA1_uc011dcx.1_Silent_p.D305D|GRIA1_uc011dcy.1_Silent_p.D384D|GRIA1_uc011dcz.1_Silent_p.D384D|GRIA1_uc010jia.1_Silent_p.D354D	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	374	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TGAAACATGACGGCATCCGAA	0.502													27	58	---	---	---	---	capture	Silent	SNP	153065877	153065877	GRIA1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6700	121
FLT4	2324	broad.mit.edu	37	5	180048603	180048603	+	Silent	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180048603G>A	uc003mma.3	-	13	2038	c.1959C>T	c.(1957-1959)TGC>TGT	p.C653C	FLT4_uc003mlz.3_Silent_p.C653C|FLT4_uc003mmb.1_Silent_p.C186C|FLT4_uc011dgy.1_Silent_p.C653C	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	653	Ig-like C2-type 6.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CTTGCACTTCGCACACATAGT	0.697									Congenital_Hereditary_Lymphedema				34	31	---	---	---	---	capture	Silent	SNP	180048603	180048603	FLT4	5	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	5888	121
IRF4	3662	broad.mit.edu	37	6	397159	397159	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:397159G>A	uc003msz.3	+	5	657	c.544G>A	c.(544-546)GTC>ATC	p.V182I	IRF4_uc010jne.1_Missense_Mutation_p.V182I|IRF4_uc003mta.3_RNA|IRF4_uc003mtb.3_Missense_Mutation_p.V181I|IRF4_uc003mtc.1_Missense_Mutation_p.V12I	NM_002460	NP_002451	Q15306	IRF4_HUMAN	interferon regulatory factor 4	182					interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GAGGGACTACGTCCCGGATCA	0.567			T	IGH@	MM 								77	113	---	---	---	---	capture	Missense_Mutation	SNP	397159	397159	IRF4	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7755	121
OR10C1	442194	broad.mit.edu	37	6	29407979	29407979	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29407979C>T	uc011dlp.1	+	1	187	c.187C>T	c.(187-189)CGC>TGC	p.R63C	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	63	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTTCTTCCTGCGCACCCTCTC	0.572													74	114	---	---	---	---	capture	Missense_Mutation	SNP	29407979	29407979	OR10C1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10802	121
C6orf126	389383	broad.mit.edu	37	6	35747188	35747188	+	Silent	SNP	C	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35747188C>A	uc010jvz.1	+	3	268	c.264C>A	c.(262-264)TCC>TCA	p.S88S	C6orf126_uc003olc.1_Missense_Mutation_p.Q115K|C6orf127_uc003old.3_5'Flank	NM_207409	NP_997292	Q6UWE3	CF126_HUMAN	hypothetical protein LOC389383 precursor	88					digestion|lipid catabolic process	extracellular region	enzyme activator activity				0						CGTGCATATCCAAGGACTTGA	0.567													4	4	---	---	---	---	capture	Silent	SNP	35747188	35747188	C6orf126	6	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	2303	121
NFKBIE	4794	broad.mit.edu	37	6	44229489	44229489	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44229489C>T	uc003oxe.1	-	3	1007	c.982G>A	c.(982-984)GAC>AAC	p.D328N		NM_004556	NP_004547	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene	328	ANK 3.				cytoplasmic sequestering of transcription factor		protein binding			breast(2)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGGGCTGTGTCACCATGCCGG	0.652													24	39	---	---	---	---	capture	Missense_Mutation	SNP	44229489	44229489	NFKBIE	6	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	10287	121
FAM83B	222584	broad.mit.edu	37	6	54806091	54806091	+	Silent	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:54806091G>A	uc003pck.2	+	5	2438	c.2322G>A	c.(2320-2322)AAG>AAA	p.K774K		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	774										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					GGTCTCAGAAGTTAAGGTCAT	0.363													40	54	---	---	---	---	capture	Silent	SNP	54806091	54806091	FAM83B	6	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	5580	121
C6orf186	728464	broad.mit.edu	37	6	110567207	110567207	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:110567207T>G	uc010kdu.1	-	5	1043	c.1043A>C	c.(1042-1044)GAC>GCC	p.D348A	C6orf186_uc003pub.2_Missense_Mutation_p.D151A	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor	348						extracellular region					0						ATTGAAAATGTCTTTCTTCAA	0.373													95	142	---	---	---	---	capture	Missense_Mutation	SNP	110567207	110567207	C6orf186	6	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	2324	121
LPA	4018	broad.mit.edu	37	6	161006177	161006177	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161006177C>T	uc003qtl.2	-	27	4310	c.4190G>A	c.(4189-4191)CGA>CAA	p.R1397Q		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3905	Kringle 35.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GAGTGTGCCTCGATAACTCTG	0.468													107	195	---	---	---	---	capture	Missense_Mutation	SNP	161006177	161006177	LPA	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8819	121
C7orf27	221927	broad.mit.edu	37	7	2580983	2580983	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2580983G>A	uc003smi.2	-	9	1312	c.1270C>T	c.(1270-1272)CGG>TGG	p.R424W	C7orf27_uc003smh.3_5'UTR	NM_152743	NP_689956	Q6PJG6	BRAT1_HUMAN	hypothetical protein LOC221927 precursor	424					response to ionizing radiation	nucleus	protein binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)		CGCTGGACCCGGACGCAGCCC	0.682													11	24	---	---	---	---	capture	Missense_Mutation	SNP	2580983	2580983	C7orf27	7	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	2359	121
SP4	6671	broad.mit.edu	37	7	21550871	21550871	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21550871A>G	uc003sva.2	+	6	2520	c.2339A>G	c.(2338-2340)AAC>AGC	p.N780S	SP4_uc003svb.2_Missense_Mutation_p.N467S	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	780					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5						GTTTCAACCAACATGGAAGAA	0.423													30	89	---	---	---	---	capture	Missense_Mutation	SNP	21550871	21550871	SP4	7	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	14858	121
PDE1C	5137	broad.mit.edu	37	7	32091191	32091191	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:32091191T>C	uc003tcm.1	-	2	572	c.103A>G	c.(103-105)AGG>GGG	p.R35G	PDE1C_uc003tcn.1_Missense_Mutation_p.R35G|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Missense_Mutation_p.R35G|PDE1C_uc003tcs.2_Missense_Mutation_p.R35G	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	35					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TTATATTTCCTCCTGTAAGAA	0.468													20	69	---	---	---	---	capture	Missense_Mutation	SNP	32091191	32091191	PDE1C	7	T	C	C	C	1	0	0	0	0	1	0	0	0	700	54	3	3	11538	121
ASL	435	broad.mit.edu	37	7	65554649	65554649	+	Silent	SNP	C	G	G	rs140532520	byFrequency	TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:65554649C>G	uc003tuo.2	+	14	1140	c.1029C>G	c.(1027-1029)CTC>CTG	p.L343L	ASL_uc003tup.2_Silent_p.L343L|ASL_uc003tur.2_Silent_p.L317L|ASL_uc003tuq.2_Silent_p.L323L	NM_000048	NP_000039	P04424	ARLY_HUMAN	argininosuccinate lyase isoform 1	343					arginine biosynthetic process via ornithine|arginine catabolic process|urea cycle	cytosol	argininosuccinate lyase activity			breast(2)	2					L-Arginine(DB00125)	GTGCCGTGCTCCAGGTGGCCA	0.637													29	69	---	---	---	---	capture	Silent	SNP	65554649	65554649	ASL	7	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	1035	121
CNTNAP2	26047	broad.mit.edu	37	7	148112574	148112574	+	Missense_Mutation	SNP	C	T	T	rs138661307		TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148112574C>T	uc003weu.1	+	24	4378	c.3862C>T	c.(3862-3864)CGC>TGC	p.R1288C	CNTNAP2_uc003wev.1_Missense_Mutation_p.R65C	NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	1288	Cytoplasmic (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	p.R1288C(1)		ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTACATGTTCCGCCACAAGGG	0.567										HNSCC(39;0.1)			26	83	---	---	---	---	capture	Missense_Mutation	SNP	148112574	148112574	CNTNAP2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3612	121
PXDNL	137902	broad.mit.edu	37	8	52321474	52321474	+	Nonsense_Mutation	SNP	C	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52321474C>A	uc003xqu.3	-	17	2811	c.2710G>T	c.(2710-2712)GAG>TAG	p.E904*	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	904					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GATTCCCGCTCCGAGCTCCCG	0.592													25	60	---	---	---	---	capture	Nonsense_Mutation	SNP	52321474	52321474	PXDNL	8	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	12743	121
DCAF13	25879	broad.mit.edu	37	8	104452461	104452461	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104452461C>T	uc003yln.2	+	9	1781	c.1504C>T	c.(1504-1506)CGC>TGC	p.R502C	DCAF13_uc003ylm.1_Missense_Mutation_p.R235C|DCAF13_uc003ylo.2_Missense_Mutation_p.R213C	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	350	WD 7.				rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1						AATGAACATTCGCCTGTGGAA	0.328													4	134	---	---	---	---	capture	Missense_Mutation	SNP	104452461	104452461	DCAF13	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4225	121
TM7SF4	81501	broad.mit.edu	37	8	105360771	105360771	+	Translation_Start_Site	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105360771C>T	uc003ylx.1	+	2	40	c.-9C>T	c.(-11--7)GACGC>GATGC			NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein						osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATTTTCAGGACGCAGGGAGCA	0.393													42	76	---	---	---	---	capture	Translation_Start_Site	SNP	105360771	105360771	TM7SF4	8	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	15861	121
TIGD5	84948	broad.mit.edu	37	8	144681263	144681263	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144681263G>A	uc003yyx.1	+	1	1043	c.1043G>A	c.(1042-1044)GGC>GAC	p.G348D	EEF1D_uc011lki.1_5'Flank|EEF1D_uc011lkj.1_5'Flank|EEF1D_uc003yyr.2_5'Flank|EEF1D_uc003yyt.2_5'Flank|EEF1D_uc011lkk.1_5'Flank|EEF1D_uc003yys.2_5'Flank|EEF1D_uc003yyv.2_5'Flank|EEF1D_uc003yyu.2_5'Flank|EEF1D_uc011lkl.1_5'Flank	NM_032862	NP_116251	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	397					regulation of transcription, DNA-dependent	chromosome, centromeric region	DNA binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			ACACCGGATGGCGCTGTGCGG	0.692													3	14	---	---	---	---	capture	Missense_Mutation	SNP	144681263	144681263	TIGD5	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15784	121
FAM83H	286077	broad.mit.edu	37	8	144808805	144808805	+	Silent	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144808805G>A	uc003yzk.2	-	5	2895	c.2826C>T	c.(2824-2826)TCC>TCT	p.S942S	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	942					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGGACTCCCCGGAGATGGTAA	0.736													11	21	---	---	---	---	capture	Silent	SNP	144808805	144808805	FAM83H	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5586	121
FAM75A3	727830	broad.mit.edu	37	9	40702725	40702725	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:40702725G>A	uc010mmj.2	+	4	411	c.382G>A	c.(382-384)GAA>AAA	p.E128K		NM_001083124	NP_001076593	Q5VYP0	F75A3_HUMAN	hypothetical protein LOC727830	128	Pro-rich.					integral to membrane				ovary(2)|skin(1)	3				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGAGGTGGGCGAAAGAGCACC	0.602													40	58	---	---	---	---	capture	Missense_Mutation	SNP	40702725	40702725	FAM75A3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5567	121
TRPM3	80036	broad.mit.edu	37	9	73399100	73399100	+	Missense_Mutation	SNP	C	T	T	rs141951214	byFrequency	TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:73399100C>T	uc004aid.2	-	7	1313	c.1069G>A	c.(1069-1071)GTG>ATG	p.V357M	TRPM3_uc004ahu.2_Missense_Mutation_p.V187M|TRPM3_uc004ahv.2_Missense_Mutation_p.V187M|TRPM3_uc004ahw.2_Missense_Mutation_p.V229M|TRPM3_uc004ahx.2_Missense_Mutation_p.V204M|TRPM3_uc004ahy.2_Missense_Mutation_p.V229M|TRPM3_uc004ahz.2_Missense_Mutation_p.V204M|TRPM3_uc004aia.2_Missense_Mutation_p.V204M|TRPM3_uc004aib.2_Missense_Mutation_p.V204M|TRPM3_uc004aic.2_Missense_Mutation_p.V357M|TRPM3_uc010mor.2_Missense_Mutation_p.V357M|TRPM3_uc004aie.2_Missense_Mutation_p.V204M|TRPM3_uc004aif.2_Missense_Mutation_p.V229M|TRPM3_uc004aig.2_Missense_Mutation_p.V204M	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	382	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						ACCACTGGCACGGGAGGGGTG	0.547													24	65	---	---	---	---	capture	Missense_Mutation	SNP	73399100	73399100	TRPM3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16470	121
ROR2	4920	broad.mit.edu	37	9	94486082	94486082	+	Silent	SNP	C	T	T	rs141070315		TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:94486082C>T	uc004arj.1	-	9	2893	c.2694G>A	c.(2692-2694)CAG>CAA	p.Q898Q	ROR2_uc004ari.1_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	898	Cytoplasmic (Potential).				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						CTGGGGCGTTCTGTGTGTCAT	0.637													100	157	---	---	---	---	capture	Silent	SNP	94486082	94486082	ROR2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	13419	121
TNC	3371	broad.mit.edu	37	9	117783441	117783441	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117783441C>T	uc004bjj.3	-	28	6963	c.6601G>A	c.(6601-6603)GCA>ACA	p.A2201T	TNC_uc010mvf.2_Missense_Mutation_p.A1928T	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	2201					cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GGAATTTATGCCCGTTTGCGC	0.502													4	72	---	---	---	---	capture	Missense_Mutation	SNP	117783441	117783441	TNC	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16153	121
OR1L1	26737	broad.mit.edu	37	9	125424265	125424265	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125424265A>G	uc011lza.1	+	1	421	c.421A>G	c.(421-423)ACC>GCC	p.T141A		NM_001005236	NP_001005236	Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L,	141	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						AGAGACAAAGACCATCTCTTA	0.433													158	211	---	---	---	---	capture	Missense_Mutation	SNP	125424265	125424265	OR1L1	9	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	10867	121
EXD3	54932	broad.mit.edu	37	9	140201420	140201420	+	Silent	SNP	C	T	T			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140201420C>T	uc004cmp.2	-	22	2809	c.2613G>A	c.(2611-2613)CCG>CCA	p.P871P	C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Silent_p.P509P	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3	871					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						GACTGCTGGCCGGGCTGGGGG	0.652													13	8	---	---	---	---	capture	Silent	SNP	140201420	140201420	EXD3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5254	121
FGF13	2258	broad.mit.edu	37	X	137785220	137785220	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:137785220G>A	uc004fam.2	-	3	990	c.328C>T	c.(328-330)CGA>TGA	p.R110*	FGF13_uc004fan.2_Nonsense_Mutation_p.R57*|FGF13_uc011mwi.1_Nonsense_Mutation_p.R91*|FGF13_uc004faq.2_Nonsense_Mutation_p.R120*|FGF13_uc004far.2_Nonsense_Mutation_p.R91*|FGF13_uc011mwj.1_Nonsense_Mutation_p.R120*|FGF13_uc011mwk.1_Nonsense_Mutation_p.R64*	NM_004114	NP_004105	Q92913	FGF13_HUMAN	fibroblast growth factor 13 isoform 1	110					cell-cell signaling|MAPKKK cascade|nervous system development	cytoplasm|nucleus	growth factor activity|protein kinase activator activity			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GCCACCACTCGCAGACCCACA	0.408													50	21	---	---	---	---	capture	Nonsense_Mutation	SNP	137785220	137785220	FGF13	23	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	5788	121
NOTCH2	4853	broad.mit.edu	37	1	120539904	120539904	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120539904delC	uc001eik.2	-	4	723	c.467delG	c.(466-468)GGAfs	p.G156fs	NOTCH2_uc001eil.2_Frame_Shift_Del_p.G156fs|NOTCH2_uc001eim.3_Frame_Shift_Del_p.G73fs	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	156	Extracellular (Potential).|EGF-like 4.				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGGTACTTCCATTTGCACA	0.488			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				81	143	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	120539904	120539904	NOTCH2	1	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	10455	121
OR2T3	343173	broad.mit.edu	37	1	248636836	248636836	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248636836delC	uc001iel.1	+	1	185	c.185delC	c.(184-186)ACCfs	p.T62fs		NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T,	62	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CGCCTCCACACCCCCATGTAC	0.567													11	57	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	248636836	248636836	OR2T3	1	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	10927	121
OR2T34	127068	broad.mit.edu	37	1	248737870	248737870	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248737870delG	uc001iep.1	-	1	189	c.189delC	c.(187-189)CCCfs	p.P63fs		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	63	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGAAGTACATGGGGGTGTGGA	0.562													13	34	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	248737870	248737870	OR2T34	1	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	10929	121
C16orf53	79447	broad.mit.edu	37	16	29827999	29828009	+	Frame_Shift_Del	DEL	AGGAGGCCGAG	-	-			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29827999_29828009delAGGAGGCCGAG	uc002dug.3	+	1	472_482	c.153_163delAGGAGGCCGAG	c.(151-165)GAAGGAGGCCGAGAGfs	p.E51fs	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron	NM_024516	NP_078792	Q9BTK6	PA1_HUMAN	PTIP-associated 1 protein	51_55	Glu-rich.										0						ACGAGGGGGAAGGAGGCCGAGAGGAGACCGA	0.697											OREG0023722	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	22	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	29827999	29828009	C16orf53	16	AGGAGGCCGAG	-	-	-	1	0	1	0	1	0	0	0	0	37	3	5	5	1804	121
PTPN2	5771	broad.mit.edu	37	18	12794472	12794472	+	Frame_Shift_Del	DEL	T	-	-			TCGA-12-0688-01	TCGA-12-0688-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:12794472delT	uc002krp.2	-	9	1247	c.1053delA	c.(1051-1053)AAAfs	p.K351fs	PTPN2_uc002krl.2_Frame_Shift_Del_p.K351fs|PTPN2_uc002krn.2_Frame_Shift_Del_p.K374fs|PTPN2_uc002kro.2_Frame_Shift_Del_p.K351fs|PTPN2_uc002krm.2_Intron	NM_002828	NP_002819	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type	351					interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway	endoplasmic reticulum|nucleoplasm	protein binding			skin(2)	2		Lung NSC(161;8.94e-06)				CTCGAATACGTTTCCGTAGAG	0.428													49	74	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	12794472	12794472	PTPN2	18	T	-	-	-	1	0	1	0	1	0	0	0	0	777	60	5	5	12680	121
