Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TNFRSF8	943	broad.mit.edu	37	1	12170201	12170201	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12170201T>A	uc001atq.2	+	6	838	c.616T>A	c.(616-618)TCT>ACT	p.S206T	TNFRSF8_uc010obc.1_Missense_Mutation_p.S95T	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,	206	Extracellular (Potential).|TNFR-Cys 4.				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		GGAAGCTGCTTCTAAACTGAC	0.632													8	105	---	---	---	---	capture	Missense_Mutation	SNP	12170201	12170201	TNFRSF8	1	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	16182	123
TAS1R2	80834	broad.mit.edu	37	1	19181287	19181287	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19181287C>T	uc001bba.1	-	3	678	c.677G>A	c.(676-678)CGC>CAC	p.R226H		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	226	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CCGGGCCACGCGCTCGCCAAG	0.642													5	53	---	---	---	---	capture	Missense_Mutation	SNP	19181287	19181287	TAS1R2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15451	123
CNKSR1	10256	broad.mit.edu	37	1	26515154	26515154	+	Silent	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26515154G>A	uc001bln.3	+	19	1735	c.1677G>A	c.(1675-1677)CAG>CAA	p.Q559Q	CNKSR1_uc001blm.3_Silent_p.Q552Q|CNKSR1_uc009vsd.2_Silent_p.Q294Q|CNKSR1_uc009vse.2_Silent_p.Q294Q|CNKSR1_uc001blo.2_Silent_p.Q294Q|CATSPER4_uc010oey.1_5'Flank|CATSPER4_uc010oez.1_5'Flank|CATSPER4_uc009vsf.2_5'Flank	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	559					Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			lung(1)|kidney(1)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCCACACAGCGCAGCCCAC	0.647													50	67	---	---	---	---	capture	Silent	SNP	26515154	26515154	CNKSR1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	3571	123
ZSWIM5	57643	broad.mit.edu	37	1	45553632	45553632	+	Silent	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45553632G>A	uc001cnd.2	-	2	1101	c.873C>T	c.(871-873)CAC>CAT	p.H291H		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	291							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					CTTCAGTGTGGTGTGCCGTGA	0.393													145	155	---	---	---	---	capture	Silent	SNP	45553632	45553632	ZSWIM5	1	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	18120	123
AK5	26289	broad.mit.edu	37	1	78001682	78001682	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78001682C>T	uc001dhn.2	+	13	1836	c.1579C>T	c.(1579-1581)CCC>TCC	p.P527S	AK5_uc001dho.2_Missense_Mutation_p.P501S	NM_174858	NP_777283	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5 isoform 1	527					ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1						AGCGTCCATCCCCGTGATCGC	0.527													33	51	---	---	---	---	capture	Missense_Mutation	SNP	78001682	78001682	AK5	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	443	123
MCOLN3	55283	broad.mit.edu	37	1	85498465	85498465	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85498465C>T	uc001dkp.2	-	6	739	c.646G>A	c.(646-648)GTG>ATG	p.V216M	MCOLN3_uc001dkq.2_Missense_Mutation_p.V160M|MCOLN3_uc001dkr.2_Missense_Mutation_p.V216M|MCOLN3_uc001dks.3_Missense_Mutation_p.V61M	NM_018298	NP_060768	Q8TDD5	MCLN3_HUMAN	mucolipin 3	216						integral to membrane	ion channel activity			skin(1)	1				all cancers(265;0.00957)|Epithelial(280;0.0254)		TGAAGCTCCACTGTTAGGAGT	0.438													186	221	---	---	---	---	capture	Missense_Mutation	SNP	85498465	85498465	MCOLN3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	9310	123
KIAA0907	22889	broad.mit.edu	37	1	155887399	155887399	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155887399T>G	uc001fmi.1	-	11	1355	c.1331A>C	c.(1330-1332)CAG>CCG	p.Q444P	KIAA0907_uc001fmj.1_Missense_Mutation_p.Q444P|KIAA0907_uc009wrk.1_Missense_Mutation_p.Q301P|KIAA0907_uc009wrl.1_RNA	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	hypothetical protein LOC22889	444	Pro-rich.										0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			gggctggggctggggGCCAGC	0.443													15	67	---	---	---	---	capture	Missense_Mutation	SNP	155887399	155887399	KIAA0907	1	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	8121	123
INSRR	3645	broad.mit.edu	37	1	156811514	156811514	+	Missense_Mutation	SNP	C	T	T	rs139192917		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156811514C>T	uc010pht.1	-	20	3724	c.3470G>A	c.(3469-3471)CGC>CAC	p.R1157H	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	1157	Cytoplasmic (Potential).|Protein kinase.				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGCCATCCAGCGCACGGGCAG	0.627													97	116	---	---	---	---	capture	Missense_Mutation	SNP	156811514	156811514	INSRR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7697	123
CD1B	910	broad.mit.edu	37	1	158299678	158299678	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158299678C>T	uc001frx.2	-	3	679	c.571G>A	c.(571-573)GTC>ATC	p.V191I	CD1B_uc001frw.2_Missense_Mutation_p.V84I	NM_001764	NP_001755	P29016	CD1B_HUMAN	CD1B antigen precursor	191	Extracellular (Potential).|Ig-like.				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding			ovary(2)	2	all_hematologic(112;0.0378)					GCATTGAGGACGCCCAAGAGA	0.438													144	192	---	---	---	---	capture	Missense_Mutation	SNP	158299678	158299678	CD1B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2946	123
OR10R2	343406	broad.mit.edu	37	1	158449688	158449688	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158449688C>G	uc010pik.1	+	1	21	c.21C>G	c.(19-21)TTC>TTG	p.F7L	uc001fso.1_Intron	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)					TTCTTATATTCACATACCTGA	0.279													77	150	---	---	---	---	capture	Missense_Mutation	SNP	158449688	158449688	OR10R2	1	C	G	G	G	1	0	0	0	0	1	0	0	0	376	29	4	4	10821	123
LY9	4063	broad.mit.edu	37	1	160786529	160786529	+	Silent	SNP	C	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160786529C>G	uc001fwu.2	+	5	1268	c.1218C>G	c.(1216-1218)TCC>TCG	p.S406S	LY9_uc001fwv.2_Silent_p.S406S|LY9_uc001fww.2_Intron|LY9_uc001fwx.2_Intron|LY9_uc001fwy.1_Intron|LY9_uc001fwz.2_Silent_p.S58S	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	406	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CTGTTGTGTCCCAAGGGGAAT	0.557													10	147	---	---	---	---	capture	Silent	SNP	160786529	160786529	LY9	1	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	9016	123
CR2	1380	broad.mit.edu	37	1	207648560	207648560	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207648560A>C	uc001hfw.2	+	13	2632	c.2538A>C	c.(2536-2538)AAA>AAC	p.K846N	CR2_uc001hfv.2_Missense_Mutation_p.K905N|CR2_uc009xch.2_Missense_Mutation_p.K846N	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	846	Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						GTATCAAAAAAGGTAAGATAC	0.398													5	161	---	---	---	---	capture	Missense_Mutation	SNP	207648560	207648560	CR2	1	A	C	C	C	1	0	0	0	0	1	0	0	0	37	3	4	4	3807	123
ATAD1	84896	broad.mit.edu	37	10	89550116	89550116	+	Silent	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89550116G>A	uc001key.1	-	3	616	c.333C>T	c.(331-333)ATC>ATT	p.I111I	ATAD1_uc010qmr.1_Silent_p.I53I|ATAD1_uc009xth.1_RNA|ATAD1_uc001kez.1_Silent_p.I111I	NM_032810	NP_116199	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	111						peroxisome	ATP binding|nucleoside-triphosphatase activity			large_intestine(1)|ovary(1)	2		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		GTTTCTTTTTGATAGGTAAGA	0.358													66	31	---	---	---	---	capture	Silent	SNP	89550116	89550116	ATAD1	10	G	A	A	A	1	0	0	0	0	0	0	0	1	577	45	2	2	1061	123
MGEA5	10724	broad.mit.edu	37	10	103557792	103557792	+	Nonsense_Mutation	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103557792A>C	uc001ktv.2	-	10	2372	c.1929T>G	c.(1927-1929)TAT>TAG	p.Y643*	MGEA5_uc001ktu.2_RNA|MGEA5_uc010qqe.1_Nonsense_Mutation_p.Y590*|MGEA5_uc009xws.2_Nonsense_Mutation_p.Y590*|MGEA5_uc001ktw.2_Nonsense_Mutation_p.Y643*	NM_012215	NP_036347	O60502	NCOAT_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	643	Histone acetyltransferase activity (By similarity).				glycoprotein catabolic process	cytoplasm|nucleus	histone acetyltransferase activity|hyalurononglucosaminidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TATCCCAAACATAGGAGTACA	0.418													115	23	---	---	---	---	capture	Nonsense_Mutation	SNP	103557792	103557792	MGEA5	10	A	C	C	C	1	0	0	0	0	0	1	0	0	102	8	5	4	9467	123
OR51B6	390058	broad.mit.edu	37	11	5373426	5373426	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5373426G>A	uc010qzb.1	+	1	689	c.689G>A	c.(688-690)GGA>GAA	p.G230E	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004750	NP_001004750	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B,	230	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGTTCTGGAGGAGAAAGGGCC	0.418													129	171	---	---	---	---	capture	Missense_Mutation	SNP	5373426	5373426	OR51B6	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10996	123
MICAL2	9645	broad.mit.edu	37	11	12225971	12225971	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:12225971G>T	uc001mjz.2	+	4	727	c.439G>T	c.(439-441)GGG>TGG	p.G147W	MICAL2_uc010rch.1_Missense_Mutation_p.G147W|MICAL2_uc001mjy.2_Missense_Mutation_p.G147W|MICAL2_uc001mka.2_Missense_Mutation_p.G147W|MICAL2_uc010rci.1_Missense_Mutation_p.G147W|MICAL2_uc001mkb.2_Missense_Mutation_p.G147W|MICAL2_uc001mkc.2_Missense_Mutation_p.G147W	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin	147						cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		GAAGTTCTATGGGAAGTTCTG	0.552													4	226	---	---	---	---	capture	Missense_Mutation	SNP	12225971	12225971	MICAL2	11	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	9482	123
KCNC1	3746	broad.mit.edu	37	11	17757795	17757795	+	Silent	SNP	G	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:17757795G>T	uc001mnk.3	+	1	301	c.246G>T	c.(244-246)GTG>GTT	p.V82V	KCNC1_uc009yhc.1_Silent_p.V82V	NM_004976	NP_004967	P48547	KCNC1_HUMAN	Shaw-related voltage-gated potassium channel	82	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)	1						CAGCCGACGTGTGCGGGCCGC	0.677													10	104	---	---	---	---	capture	Silent	SNP	17757795	17757795	KCNC1	11	G	T	T	T	1	0	0	0	0	0	0	0	1	613	48	4	4	7936	123
UEVLD	55293	broad.mit.edu	37	11	18554017	18554017	+	Silent	SNP	A	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18554017A>G	uc001mot.2	-	12	1346	c.1266T>C	c.(1264-1266)AAT>AAC	p.N422N	UEVLD_uc001mou.2_3'UTR|UEVLD_uc010rde.1_Silent_p.N292N|UEVLD_uc010rdf.1_Silent_p.N400N|UEVLD_uc010rdg.1_Silent_p.N292N|UEVLD_uc001mov.2_3'UTR	NM_001040697	NP_001035787	Q8IX04	UEVLD_HUMAN	ubiquitin-conjugating enzyme E2-like isoform a	422					cellular carbohydrate metabolic process|protein modification process|protein transport		binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor				0						ACACTTCACTATTTATATCAT	0.313													40	51	---	---	---	---	capture	Silent	SNP	18554017	18554017	UEVLD	11	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	16815	123
QSER1	79832	broad.mit.edu	37	11	32955067	32955067	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:32955067C>G	uc001mty.2	+	4	2143	c.1876C>G	c.(1876-1878)CTG>GTG	p.L626V	QSER1_uc001mtz.1_Missense_Mutation_p.L387V|QSER1_uc001mua.2_Missense_Mutation_p.L131V	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	626										ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					TGGGGTTGCTCTGCAAGCATC	0.378													110	121	---	---	---	---	capture	Missense_Mutation	SNP	32955067	32955067	QSER1	11	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	12777	123
OR5A1	219982	broad.mit.edu	37	11	59211078	59211078	+	Missense_Mutation	SNP	G	T	T	rs143071629	byFrequency;by1000genomes	TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59211078G>T	uc001nnx.1	+	1	437	c.437G>T	c.(436-438)CGC>CTC	p.R146L		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	146	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						CTCTGTACACGCATGGTGGTT	0.552													238	321	---	---	---	---	capture	Missense_Mutation	SNP	59211078	59211078	OR5A1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	11043	123
ODZ4	26011	broad.mit.edu	37	11	78380644	78380644	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:78380644C>A	uc001ozl.3	-	32	7209	c.6746G>T	c.(6745-6747)GGT>GTT	p.G2249V	ODZ4_uc001ozk.3_Missense_Mutation_p.G474V|ODZ4_uc009yvb.1_Missense_Mutation_p.G833V	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2249	Extracellular (Potential).|YD 20.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						TTGCACGTCACCCAGCCGAGT	0.562													26	330	---	---	---	---	capture	Missense_Mutation	SNP	78380644	78380644	ODZ4	11	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	10742	123
APOA4	337	broad.mit.edu	37	11	116691955	116691955	+	Silent	SNP	G	A	A	rs146365840	byFrequency	TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:116691955G>A	uc001pps.1	-	3	923	c.819C>T	c.(817-819)GAC>GAT	p.D273D		NM_000482	NP_000473			apolipoprotein A-IV precursor												0	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		TGCCACGCACGTCCTCGGCCA	0.672													74	99	---	---	---	---	capture	Silent	SNP	116691955	116691955	APOA4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	776	123
AICDA	57379	broad.mit.edu	37	12	8757515	8757515	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8757515T>A	uc001qur.2	-	4	510	c.431A>T	c.(430-432)TAT>TTT	p.Y144F	AICDA_uc001qup.1_Intron|AICDA_uc001quq.1_Intron|AICDA_uc009zgd.1_Intron	NM_020661	NP_065712	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	144					B cell differentiation|DNA demethylation|mRNA processing|negative regulation of methylation-dependent chromatin silencing	cytoplasm	cytidine deaminase activity|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung SC(5;0.184)					GCAGTAAAAATAATCTTCAAA	0.428									Immune_Deficiency_with_Hyper-IgM				20	98	---	---	---	---	capture	Missense_Mutation	SNP	8757515	8757515	AICDA	12	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	422	123
ZBTB39	9880	broad.mit.edu	37	12	57398062	57398062	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57398062T>G	uc001sml.1	-	2	726	c.640A>C	c.(640-642)ACC>CCC	p.T214P	RDH16_uc010sqx.1_5'Flank	NM_014830	NP_055645	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	214					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						GGAGCAGGGGTGTCATGGTCT	0.572													9	239	---	---	---	---	capture	Missense_Mutation	SNP	57398062	57398062	ZBTB39	12	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	17420	123
LRRIQ1	84125	broad.mit.edu	37	12	85450302	85450302	+	Silent	SNP	T	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85450302T>C	uc001tac.2	+	8	1842	c.1731T>C	c.(1729-1731)GAT>GAC	p.D577D	LRRIQ1_uc001tab.1_Silent_p.D577D|LRRIQ1_uc001taa.1_Silent_p.D552D	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	577										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		TAATCAAAGATAATCAGCAGA	0.289													33	47	---	---	---	---	capture	Silent	SNP	85450302	85450302	LRRIQ1	12	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	8944	123
ATP8A2	51761	broad.mit.edu	37	13	26411335	26411335	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:26411335T>A	uc001uqk.2	+	29	2931	c.2789T>A	c.(2788-2790)ATC>AAC	p.I930N	ATP8A2_uc010tdi.1_Missense_Mutation_p.I865N|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.I480N	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	890	Helical; (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ACTCTGGGAATCTTTGAGAGG	0.502													88	123	---	---	---	---	capture	Missense_Mutation	SNP	26411335	26411335	ATP8A2	13	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	1184	123
FLT1	2321	broad.mit.edu	37	13	28880897	28880897	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28880897C>T	uc001usb.3	-	29	4018	c.3733G>A	c.(3733-3735)GAC>AAC	p.D1245N	FLT1_uc010aap.2_Missense_Mutation_p.D250N|FLT1_uc010aaq.2_Missense_Mutation_p.D370N|FLT1_uc001usa.3_Missense_Mutation_p.D463N	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	1245	Cytoplasmic (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	GTGCTGCTGTCGCCCTGGTAG	0.552													59	75	---	---	---	---	capture	Missense_Mutation	SNP	28880897	28880897	FLT1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5885	123
FLT1	2321	broad.mit.edu	37	13	29004213	29004213	+	Silent	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:29004213C>T	uc001usb.3	-	8	1365	c.1080G>A	c.(1078-1080)AAG>AAA	p.K360K	FLT1_uc010aar.1_Silent_p.K360K|FLT1_uc001usc.3_Silent_p.K360K|FLT1_uc010tdp.1_Silent_p.K360K	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	360	Ig-like C2-type 4.|Extracellular (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	AGGGAAATGCCTTCACTTTCA	0.443													115	145	---	---	---	---	capture	Silent	SNP	29004213	29004213	FLT1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	5885	123
DOCK9	23348	broad.mit.edu	37	13	99549805	99549805	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:99549805T>A	uc001vnt.2	-	15	1704	c.1649A>T	c.(1648-1650)TAC>TTC	p.Y550F	DOCK9_uc001vnw.2_Missense_Mutation_p.Y549F|DOCK9_uc001vnv.1_RNA|DOCK9_uc010tir.1_Missense_Mutation_p.Y550F|DOCK9_uc010tis.1_Missense_Mutation_p.Y549F|DOCK9_uc010tit.1_Missense_Mutation_p.Y550F|DOCK9_uc010afu.1_Missense_Mutation_p.Y365F	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a	550					blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GTCTTGCCTGTAGATGGCAGA	0.383													6	426	---	---	---	---	capture	Missense_Mutation	SNP	99549805	99549805	DOCK9	13	T	A	A	A	1	0	0	0	0	1	0	0	0	741	57	4	4	4650	123
COL4A2	1284	broad.mit.edu	37	13	111132630	111132630	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111132630G>T	uc001vqx.2	+	31	2940	c.2651G>T	c.(2650-2652)GGT>GTT	p.G884V		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	884	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGCATGAAAGGTCTCTCTGGT	0.582													115	149	---	---	---	---	capture	Missense_Mutation	SNP	111132630	111132630	COL4A2	13	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	3655	123
ZFYVE26	23503	broad.mit.edu	37	14	68247033	68247033	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:68247033C>T	uc001xka.2	-	23	4738	c.4599G>A	c.(4597-4599)TGG>TGA	p.W1533*	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Nonsense_Mutation_p.W1533*	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1533					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCCAGTCACACCACACTGGGG	0.502													29	6	---	---	---	---	capture	Nonsense_Mutation	SNP	68247033	68247033	ZFYVE26	14	C	T	T	T	1	0	0	0	0	0	1	0	0	234	18	5	2	17548	123
NDUFB1	4707	broad.mit.edu	37	14	92588104	92588104	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:92588104G>C	uc001yaf.2	-	1	50	c.18C>G	c.(16-18)CAC>CAG	p.H6Q	NDUFB1_uc001yag.1_RNA|CPSF2_uc001yah.1_5'Flank	NM_004545	NP_004536	O75438	NDUB1_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	14	Helical; (Potential).				mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.205)	NADH(DB00157)	GAGCAGAGGGGTGACGCCAGC	0.517													77	28	---	---	---	---	capture	Missense_Mutation	SNP	92588104	92588104	NDUFB1	14	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	10185	123
SERPINA1	5265	broad.mit.edu	37	14	94849084	94849084	+	Nonsense_Mutation	SNP	G	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94849084G>T	uc001ycx.3	-	2	752	c.491C>A	c.(490-492)TCA>TAA	p.S164*	SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Nonsense_Mutation_p.S164*|SERPINA1_uc010aux.2_Nonsense_Mutation_p.S164*|SERPINA1_uc001ycy.3_Nonsense_Mutation_p.S164*|SERPINA1_uc010auy.2_Nonsense_Mutation_p.S164*|SERPINA1_uc001ycz.3_Nonsense_Mutation_p.S164*|SERPINA1_uc010auz.2_Nonsense_Mutation_p.S164*|SERPINA1_uc010ava.2_Nonsense_Mutation_p.S164*|SERPINA1_uc001ydb.3_Nonsense_Mutation_p.S164*|SERPINA1_uc010avb.2_Nonsense_Mutation_p.S164*|SERPINA1_uc001ydc.3_Nonsense_Mutation_p.S164*|SERPINA1_uc001yda.1_Nonsense_Mutation_p.S164*	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	164					acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)	GAAGGCTTCTGAGTGGTACAA	0.502									Alpha-1-Antitrypsin_Deficiency				15	134	---	---	---	---	capture	Nonsense_Mutation	SNP	94849084	94849084	SERPINA1	14	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	13979	123
UNC13C	440279	broad.mit.edu	37	15	54624283	54624283	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:54624283T>A	uc002ack.2	+	13	4468	c.4468T>A	c.(4468-4470)TTG>ATG	p.L1490M	UNC13C_uc002acl.2_Missense_Mutation_p.L320M	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1490					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ACATAACTCTTTGAGGATTGA	0.313													10	4	---	---	---	---	capture	Missense_Mutation	SNP	54624283	54624283	UNC13C	15	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	16868	123
MCTP2	55784	broad.mit.edu	37	15	94899492	94899492	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:94899492G>T	uc002btj.2	+	8	1197	c.1132G>T	c.(1132-1134)GTC>TTC	p.V378F	MCTP2_uc010urg.1_Missense_Mutation_p.V378F|MCTP2_uc002bti.2_Missense_Mutation_p.V378F|MCTP2_uc010boj.2_Missense_Mutation_p.V107F|MCTP2_uc010bok.2_Missense_Mutation_p.V378F|MCTP2_uc002btk.3_5'UTR|MCTP2_uc002btl.2_5'UTR	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1	378	C2 2.				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			AGAGATGTTTGTCCAGTTAAA	0.348													68	85	---	---	---	---	capture	Missense_Mutation	SNP	94899492	94899492	MCTP2	15	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	9314	123
CLEC16A	23274	broad.mit.edu	37	16	11118694	11118694	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:11118694G>C	uc002dao.2	+	13	1683	c.1453G>C	c.(1453-1455)GTG>CTG	p.V485L	CLEC16A_uc002dan.3_Missense_Mutation_p.V467L	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A	485								p.0?(1)		ovary(1)|central_nervous_system(1)	2						CCTGGATATGGTGTACCACGC	0.547													3	31	---	---	---	---	capture	Missense_Mutation	SNP	11118694	11118694	CLEC16A	16	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	3465	123
CHST4	10164	broad.mit.edu	37	16	71570968	71570968	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71570968C>T	uc002fan.2	+	2	569	c.388C>T	c.(388-390)CGG>TGG	p.R130W	CHST4_uc002fao.2_Missense_Mutation_p.R130W	NM_005769	NP_005760	Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	130	Lumenal (Potential).				cell-cell signaling|immune response|inflammatory response|N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity				0						GGAGAACAGCCGGGCCCTGTG	0.572													82	112	---	---	---	---	capture	Missense_Mutation	SNP	71570968	71570968	CHST4	16	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	3371	123
ZCCHC14	23174	broad.mit.edu	37	16	87448975	87448975	+	Splice_Site	SNP	T	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:87448975T>G	uc002fjz.1	-	9	1000	c.973_splice	c.e9-1	p.F325_splice	ZCCHC14_uc002fka.1_Splice_Site|ZCCHC14_uc002fkb.2_Splice_Site_p.F101_splice	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14						cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GCTCAAAAACTTTCACAGAAA	0.398													54	107	---	---	---	---	capture	Splice_Site	SNP	87448975	87448975	ZCCHC14	16	T	G	G	G	1	0	0	0	0	0	0	1	0	728	56	5	4	17463	123
ALOX15	246	broad.mit.edu	37	17	4542381	4542381	+	Silent	SNP	C	G	G	rs146477215		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4542381C>G	uc002fyh.2	-	3	398	c.384G>C	c.(382-384)CGG>CGC	p.R128R	ALOX15_uc010vsd.1_Silent_p.R89R|ALOX15_uc010vse.1_Silent_p.R150R	NM_001140	NP_001131	P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	128	Lipoxygenase.				inflammatory response|leukotriene biosynthetic process	nucleus	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity	p.R128R(1)		skin(3)|ovary(1)|lung(1)	5				READ - Rectum adenocarcinoma(115;0.0327)	Ciclopirox(DB01188)|Masoprocol(DB00179)|Zileuton(DB00744)	GCTCTTCTTCCCGGTGTTTCT	0.577													162	274	---	---	---	---	capture	Silent	SNP	4542381	4542381	ALOX15	17	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	538	123
ARRB2	409	broad.mit.edu	37	17	4619828	4619828	+	Silent	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4619828A>C	uc002fyj.2	+	5	510	c.282A>C	c.(280-282)CCA>CCC	p.P94P	ARRB2_uc002fyk.2_Silent_p.P79P|ARRB2_uc002fyl.2_Silent_p.P94P|ARRB2_uc010vsg.1_Silent_p.P94P|ARRB2_uc002fym.2_Silent_p.P79P|ARRB2_uc002fyn.2_5'UTR|ARRB2_uc010ckq.2_5'UTR|ARRB2_uc002fyo.2_5'Flank	NM_004313	NP_004304	P32121	ARRB2_HUMAN	arrestin, beta 2 isoform 1	94					cell chemotaxis|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|G-protein coupled receptor internalization|negative regulation of natural killer cell mediated cytotoxicity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|transcription from RNA polymerase II promoter|transforming growth factor beta receptor signaling pathway	coated pit|cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	angiotensin receptor binding|ubiquitin protein ligase binding				0						TGCCCAACCCACCCCGGCCCC	0.667													8	32	---	---	---	---	capture	Silent	SNP	4619828	4619828	ARRB2	17	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	974	123
DAPK3	1613	broad.mit.edu	37	19	3961153	3961153	+	Silent	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3961153G>A	uc002lzc.1	-	6	729	c.636C>T	c.(634-636)AGC>AGT	p.S212S	DAPK3_uc002lzb.1_5'UTR|DAPK3_uc002lzd.1_Silent_p.S212S	NM_001348	NP_001339	O43293	DAPK3_HUMAN	death-associated protein kinase 3	212	Protein kinase.				apoptosis|chromatin modification|induction of apoptosis|intracellular protein kinase cascade	cytoplasm|PML body	ATP binding|leucine zipper domain binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|ovary(1)|large_intestine(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGATGCACCGCTCAGGCTGC	0.662													4	81	---	---	---	---	capture	Silent	SNP	3961153	3961153	DAPK3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	4196	123
TSPAN16	26526	broad.mit.edu	37	19	11411902	11411902	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11411902C>T	uc002mqv.1	+	4	518	c.368C>T	c.(367-369)ACC>ATC	p.T123I	TSPAN16_uc002mqu.1_RNA|uc002mqw.1_RNA	NM_012466	NP_036598	Q9UKR8	TSN16_HUMAN	transmembrane 4 superfamily member 16	123	Cytoplasmic (Potential).					integral to membrane				skin(1)	1						TTGGAACACACCTTCGTGACC	0.498													59	95	---	---	---	---	capture	Missense_Mutation	SNP	11411902	11411902	TSPAN16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	16523	123
CYP4F12	66002	broad.mit.edu	37	19	15791069	15791069	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15791069A>G	uc002nbl.2	+	4	420	c.359A>G	c.(358-360)AAG>AGG	p.K120R	CYP4F12_uc010xoo.1_Missense_Mutation_p.K120R|CYP4F12_uc010xop.1_Missense_Mutation_p.K120R	NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					ATTGCACCCAAGGATAATCTC	0.562													8	400	---	---	---	---	capture	Missense_Mutation	SNP	15791069	15791069	CYP4F12	19	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	4147	123
NDUFA13	51079	broad.mit.edu	37	19	19638108	19638108	+	Silent	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19638108C>T	uc010xqy.1	+	3	700	c.441C>T	c.(439-441)GAC>GAT	p.D147D	NDUFA13_uc002nms.2_Silent_p.D147D|NDUFA13_uc010xqx.1_Silent_p.D147D|YJEFN3_uc002nmt.1_5'Flank|YJEFN3_uc010ecf.1_5'Flank|YJEFN3_uc002nmu.1_5'Flank	NM_015965	NP_057049	Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	64					apoptotic nuclear change|induction of apoptosis by extracellular signals|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|negative regulation of translation|protein import into nucleus|reactive oxygen species metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex I|nucleoplasm	ATP binding|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	AAATCGAGGACTTCGAGGCTC	0.592													8	174	---	---	---	---	capture	Silent	SNP	19638108	19638108	NDUFA13	19	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	10170	123
ZNF536	9745	broad.mit.edu	37	19	30934639	30934639	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:30934639A>G	uc002nsu.1	+	2	308	c.170A>G	c.(169-171)GAG>GGG	p.E57G	ZNF536_uc010edd.1_Missense_Mutation_p.E57G	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	57					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CCCAACCCCGAGGAGAAGCCC	0.677													69	144	---	---	---	---	capture	Missense_Mutation	SNP	30934639	30934639	ZNF536	19	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	17853	123
HNRNPL	3191	broad.mit.edu	37	19	39330868	39330868	+	Silent	SNP	T	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39330868T>G	uc010xul.1	-	8	1112	c.1101A>C	c.(1099-1101)CCA>CCC	p.P367P	HNRNPL_uc010ege.1_Silent_p.P23P|HNRNPL_uc002ojj.1_Silent_p.P23P|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_Silent_p.P23P|HNRNPL_uc002ojl.2_Silent_p.P23P|HNRNPL_uc010xum.1_Silent_p.P234P|HNRNPL_uc002ojp.1_Silent_p.P23P|HNRNPL_uc010xun.1_Missense_Mutation_p.H75P	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	367	Pro-rich.				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GGGGAGGGGGTGGGGGGTGCC	0.642													9	18	---	---	---	---	capture	Silent	SNP	39330868	39330868	HNRNPL	19	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	7195	123
POU2F2	5452	broad.mit.edu	37	19	42596347	42596347	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42596347G>C	uc002osp.2	-	13	1341	c.1274C>G	c.(1273-1275)GCT>GGT	p.A425G	POU2F2_uc002osn.2_Missense_Mutation_p.A409G|POU2F2_uc002oso.2_Missense_Mutation_p.A198G|POU2F2_uc002osq.2_Intron|POU2F2_uc002osr.1_Missense_Mutation_p.A425G	NM_002698	NP_002689	P09086	PO2F2_HUMAN	POU domain, class 2, transcription factor 2	425					humoral immune response|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2		Prostate(69;0.059)				ggggggcgcagccccgccccc	0.532													5	15	---	---	---	---	capture	Missense_Mutation	SNP	42596347	42596347	POU2F2	19	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	12173	123
GPR4	2828	broad.mit.edu	37	19	46094672	46094672	+	Silent	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46094672C>T	uc002pcm.2	-	2	1398	c.453G>A	c.(451-453)GCG>GCA	p.A151A	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	151	Helical; Name=4; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		GGAACAGGGGCGCCGAGTTGG	0.657													130	196	---	---	---	---	capture	Silent	SNP	46094672	46094672	GPR4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6628	123
MYPOP	339344	broad.mit.edu	37	19	46393971	46393971	+	Silent	SNP	T	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46393971T>G	uc002pdt.2	-	3	1197	c.1110A>C	c.(1108-1110)CCA>CCC	p.P370P		NM_001012643	NP_001012661	Q86VE0	MYPOP_HUMAN	Myb protein P42POP	370	Pro-rich.					nucleus	DNA binding				0						GGAGCGGGGCTGGGGGGGGCC	0.657													6	32	---	---	---	---	capture	Silent	SNP	46393971	46393971	MYPOP	19	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	10009	123
ZNF814	730051	broad.mit.edu	37	19	58385050	58385050	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385050G>A	uc002qqo.2	-	3	1980	c.1708C>T	c.(1708-1710)CAC>TAC	p.H570Y	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	570	C2H2-type 13.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						TCTCTAGGGTGAACTCGCTGA	0.468													10	61	---	---	---	---	capture	Missense_Mutation	SNP	58385050	58385050	ZNF814	19	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	18052	123
DCTN1	1639	broad.mit.edu	37	2	74592698	74592698	+	Silent	SNP	G	A	A	rs140969689	by1000genomes	TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74592698G>A	uc002skx.2	-	25	3284	c.2973C>T	c.(2971-2973)ATC>ATT	p.I991I	SLC4A5_uc002skl.2_5'Flank|DCTN1_uc002skt.1_5'Flank|DCTN1_uc002skv.2_Silent_p.I857I|DCTN1_uc002sku.2_Silent_p.I857I|DCTN1_uc002skw.1_Silent_p.I967I|DCTN1_uc010ffd.2_Silent_p.I971I|DCTN1_uc002sky.2_Silent_p.I954I	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	991	Potential.				cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						GGACTTTCTCGATGCGCTCAT	0.577													81	77	---	---	---	---	capture	Silent	SNP	74592698	74592698	DCTN1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	4265	123
PSD4	23550	broad.mit.edu	37	2	113940791	113940791	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113940791C>T	uc002tjc.2	+	2	941	c.758C>T	c.(757-759)GCG>GTG	p.A253V	PSD4_uc002tjd.2_5'UTR|PSD4_uc002tje.2_Missense_Mutation_p.A252V|PSD4_uc002tjf.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	253					regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						CTCTTCCTGGCGAGTCCTTGC	0.602													81	103	---	---	---	---	capture	Missense_Mutation	SNP	113940791	113940791	PSD4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12544	123
SCN9A	6335	broad.mit.edu	37	2	167056293	167056293	+	Missense_Mutation	SNP	C	T	T	rs142201175		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167056293C>T	uc010fpl.2	-	27	5164	c.4823G>A	c.(4822-4824)CGA>CAA	p.R1608Q	uc002udp.2_RNA	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1619	Helical; Voltage-sensor; Name=S4 of repeat IV; (Potential).|IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity	p.R1608Q(1)		ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	ACGTAGGATTCGGCCAATCCT	0.483													148	190	---	---	---	---	capture	Missense_Mutation	SNP	167056293	167056293	SCN9A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13818	123
FRZB	2487	broad.mit.edu	37	2	183703198	183703198	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:183703198G>A	uc002upa.1	-	4	954	c.736C>T	c.(736-738)CCT>TCT	p.P246S		NM_001463	NP_001454	Q92765	SFRP3_HUMAN	frizzled-related protein precursor	246	NTR.				brain development|cochlea morphogenesis|gonad development|mammary gland involution|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of hepatocyte differentiation|positive regulation of apoptosis|positive regulation of fat cell differentiation|skeletal system development|vasculature development|Wnt receptor signaling pathway	cytoplasm|extracellular space|membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			TTAAGTGGAGGGCAGAGGCAG	0.438													12	182	---	---	---	---	capture	Missense_Mutation	SNP	183703198	183703198	FRZB	2	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	6008	123
IRS1	3667	broad.mit.edu	37	2	227659846	227659846	+	Silent	SNP	T	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227659846T>G	uc002voh.3	-	1	3661	c.3609A>C	c.(3607-3609)CCA>CCC	p.P1203P		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	1203	Pro-rich.				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGGGTGGGGGTGGGGGAGGCT	0.582													10	69	---	---	---	---	capture	Silent	SNP	227659846	227659846	IRS1	2	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	7763	123
ECEL1	9427	broad.mit.edu	37	2	233346218	233346218	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233346218G>A	uc002vsv.2	-	14	2192	c.1987C>T	c.(1987-1989)CGG>TGG	p.R663W	ECEL1_uc010fya.1_Missense_Mutation_p.R661W|ECEL1_uc010fyb.1_Missense_Mutation_p.R370W	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	663	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GGTCTCACCCGCTGGTTGTAG	0.622													16	19	---	---	---	---	capture	Missense_Mutation	SNP	233346218	233346218	ECEL1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	4846	123
SRMS	6725	broad.mit.edu	37	20	62172863	62172863	+	Missense_Mutation	SNP	C	T	T	rs61740255		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62172863C>T	uc002yfi.1	-	6	1098	c.1057G>A	c.(1057-1059)GCC>ACC	p.A353T		NM_080823	NP_543013	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory	353	Protein kinase.						ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|lung(1)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			ACGTTCCGGGCGGCCAAGTCC	0.706													19	19	---	---	---	---	capture	Missense_Mutation	SNP	62172863	62172863	SRMS	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15044	123
ZNRF3	84133	broad.mit.edu	37	22	29440867	29440867	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29440867C>T	uc003aeg.2	+	5	598	c.433C>T	c.(433-435)CGA>TGA	p.R145*	ZNRF3_uc003aeh.1_Nonsense_Mutation_p.R145*	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	245	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1						GCTGAAGCAGCGACGCAGTCA	0.512													65	17	---	---	---	---	capture	Nonsense_Mutation	SNP	29440867	29440867	ZNRF3	22	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	18089	123
SF3A1	10291	broad.mit.edu	37	22	30736312	30736312	+	Silent	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30736312A>C	uc003ahl.2	-	9	1380	c.1248T>G	c.(1246-1248)ACT>ACG	p.T416T		NM_005877	NP_005868	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa isoform 1	416					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5						TCTTCTCCCCAGTAATGGGGG	0.557													7	97	---	---	---	---	capture	Silent	SNP	30736312	30736312	SF3A1	22	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	14039	123
GCAT	23464	broad.mit.edu	37	22	38211771	38211771	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38211771G>A	uc003atz.2	+	7	936	c.916G>A	c.(916-918)GCC>ACC	p.A306T	GCAT_uc003aua.1_Missense_Mutation_p.A332T	NM_014291	NP_055106	O75600	KBL_HUMAN	glycine C-acetyltransferase precursor	306					biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	CGTTGGCTGCGCCTCCAAGGC	0.657													5	316	---	---	---	---	capture	Missense_Mutation	SNP	38211771	38211771	GCAT	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6224	123
OXSR1	9943	broad.mit.edu	37	3	38278405	38278405	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38278405T>C	uc003chy.2	+	11	1369	c.1027T>C	c.(1027-1029)TTT>CTT	p.F343L	OXSR1_uc010hhb.2_Missense_Mutation_p.F277L	NM_005109	NP_005100	O95747	OXSR1_HUMAN	oxidative-stress responsive 1	343					intracellular protein kinase cascade|response to oxidative stress		ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TGATGATGAATTTGATGAAGA	0.423													118	136	---	---	---	---	capture	Missense_Mutation	SNP	38278405	38278405	OXSR1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	11240	123
PRSS50	29122	broad.mit.edu	37	3	46759087	46759087	+	Silent	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46759087A>C	uc003cqe.1	-	2	206	c.147T>G	c.(145-147)ACT>ACG	p.T49T	PRSS50_uc003cqf.1_Intron	NM_013270	NP_037402	Q9UI38	TSP50_HUMAN	testes-specific protease 50 precursor	49					proteolysis	endoplasmic reticulum	serine-type endopeptidase activity|threonine-type endopeptidase activity				0						CGGGATCAGCAGTGGACAGCG	0.706													37	49	---	---	---	---	capture	Silent	SNP	46759087	46759087	PRSS50	3	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	12526	123
CNTN3	5067	broad.mit.edu	37	3	74420493	74420493	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:74420493C>T	uc003dpm.1	-	5	592	c.512G>A	c.(511-513)CGG>CAG	p.R171Q		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	171	Ig-like C2-type 2.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		GACAAATCTCCGACTATCTTC	0.403													66	76	---	---	---	---	capture	Missense_Mutation	SNP	74420493	74420493	CNTN3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3607	123
OR5H6	79295	broad.mit.edu	37	3	97983841	97983841	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97983841T>C	uc003dsi.1	+	1	713	c.713T>C	c.(712-714)CTC>CCC	p.L238P		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	238	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						ACAATTATCCTCTTTACAATC	0.353													6	81	---	---	---	---	capture	Missense_Mutation	SNP	97983841	97983841	OR5H6	3	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	11067	123
CCDC54	84692	broad.mit.edu	37	3	107096949	107096949	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:107096949A>C	uc003dwi.1	+	1	762	c.515A>C	c.(514-516)AAA>ACA	p.K172T		NM_032600	NP_115989	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	172											0						CTGCTTTACAAACTCATACAA	0.433													75	102	---	---	---	---	capture	Missense_Mutation	SNP	107096949	107096949	CCDC54	3	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	2798	123
ATR	545	broad.mit.edu	37	3	142234329	142234329	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142234329A>G	uc003eux.3	-	25	4533	c.4411T>C	c.(4411-4413)TGG>CGG	p.W1471R		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1471					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						ACTCCAGACCAATCGGTTGAC	0.318								Other_conserved_DNA_damage_response_genes					58	65	---	---	---	---	capture	Missense_Mutation	SNP	142234329	142234329	ATR	3	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	1195	123
LEKR1	389170	broad.mit.edu	37	3	156710933	156710933	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:156710933G>A	uc003fba.1	+	10	1399	c.64G>A	c.(64-66)GAA>AAA	p.E22K		NM_001004316	NP_001004316	Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	42											0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AGCATTACAGGAAGAGCTGAC	0.348													6	137	---	---	---	---	capture	Missense_Mutation	SNP	156710933	156710933	LEKR1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	8637	123
PIK3CA	5290	broad.mit.edu	37	3	178916614	178916614	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916614A>G	uc003fjk.2	+	2	158	c.1A>G	c.(1-3)ATG>GTG	p.M1V		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AATCAGAACAATGCCTCCACG	0.378		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			96	15	---	---	---	---	capture	Missense_Mutation	SNP	178916614	178916614	PIK3CA	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11816	123
CHRD	8646	broad.mit.edu	37	3	184104344	184104344	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184104344T>G	uc003fov.2	+	16	2243	c.1997T>G	c.(1996-1998)GTG>GGG	p.V666G	CHRD_uc003fow.2_Missense_Mutation_p.V296G|CHRD_uc003fox.2_Missense_Mutation_p.V666G|CHRD_uc003foy.2_Missense_Mutation_p.V296G|CHRD_uc010hyc.2_Missense_Mutation_p.V256G|CHRD_uc011brr.1_Intron	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	666					BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCCGAGGGGGTGCGGGCGCTG	0.726													11	26	---	---	---	---	capture	Missense_Mutation	SNP	184104344	184104344	CHRD	3	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	3337	123
FGFRL1	53834	broad.mit.edu	37	4	1018839	1018839	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1018839A>C	uc003gce.2	+	7	1380	c.1219A>C	c.(1219-1221)ACC>CCC	p.T407P	FGFRL1_uc003gcf.2_Missense_Mutation_p.T407P|FGFRL1_uc003gcg.2_Missense_Mutation_p.T407P|FGFRL1_uc010ibo.2_Missense_Mutation_p.T407P	NM_021923	NP_068742	Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	407	Cytoplasmic (Potential).				regulation of cell growth	integral to membrane|plasma membrane	fibroblast growth factor receptor activity|heparin binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GAAGCCGTGCACCCCCGCGCC	0.731													6	76	---	---	---	---	capture	Missense_Mutation	SNP	1018839	1018839	FGFRL1	4	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	5815	123
DRD5	1816	broad.mit.edu	37	4	9784657	9784657	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9784657G>T	uc003gmb.3	+	1	1400	c.1004G>T	c.(1003-1005)TGC>TTC	p.C335F		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	335	Extracellular (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	GGCTTCCCCTGCGTCAGTGAG	0.587													116	203	---	---	---	---	capture	Missense_Mutation	SNP	9784657	9784657	DRD5	4	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	4715	123
NKX3-2	579	broad.mit.edu	37	4	13543971	13543971	+	Silent	SNP	C	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13543971C>G	uc003gmx.2	-	2	724	c.648G>C	c.(646-648)GCG>GCC	p.A216A		NM_001189	NP_001180	P78367	NKX32_HUMAN	NK3 homeobox 2	216	Homeobox.				negative regulation of chondrocyte differentiation|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CGAAGACCTGCGCGTGGGAGA	0.502													13	10	---	---	---	---	capture	Silent	SNP	13543971	13543971	NKX3-2	4	C	G	G	G	1	0	0	0	0	0	0	0	1	340	27	4	4	10363	123
NKX3-2	579	broad.mit.edu	37	4	13543978	13543978	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13543978G>A	uc003gmx.2	-	2	717	c.641C>T	c.(640-642)TCC>TTC	p.S214F		NM_001189	NP_001180	P78367	NKX32_HUMAN	NK3 homeobox 2	214	Homeobox.				negative regulation of chondrocyte differentiation|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CTGCGCGTGGGAGAAAGCGGC	0.478													12	8	---	---	---	---	capture	Missense_Mutation	SNP	13543978	13543978	NKX3-2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10363	123
KLF3	51274	broad.mit.edu	37	4	38698729	38698729	+	Nonsense_Mutation	SNP	G	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38698729G>T	uc003gth.3	+	6	1215	c.883G>T	c.(883-885)GAA>TAA	p.E295*		NM_016531	NP_057615	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	295	C2H2-type 2.				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						ATGTACATGGGAAGGGTGCAC	0.403													80	122	---	---	---	---	capture	Nonsense_Mutation	SNP	38698729	38698729	KLF3	4	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	8267	123
TLL1	7092	broad.mit.edu	37	4	166978363	166978363	+	Missense_Mutation	SNP	G	A	A	rs141877254		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:166978363G>A	uc003irh.1	+	14	2395	c.1748G>A	c.(1747-1749)CGT>CAT	p.R583H	TLL1_uc011cjn.1_Missense_Mutation_p.R606H|TLL1_uc011cjo.1_Missense_Mutation_p.R407H	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	583	EGF-like 1; calcium-binding (Potential).				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		AAACCTGACCGTGGAGGCTGT	0.438													124	180	---	---	---	---	capture	Missense_Mutation	SNP	166978363	166978363	TLL1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15830	123
GPR98	84059	broad.mit.edu	37	5	89910651	89910651	+	Splice_Site	SNP	G	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89910651G>T	uc003kju.2	+	2	119	c.23_splice	c.e2-1	p.G8_splice	GPR98_uc003kjt.2_Splice_Site	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTTTGTTTTAGGGATGCCCTC	0.274													13	31	---	---	---	---	capture	Splice_Site	SNP	89910651	89910651	GPR98	5	G	T	T	T	1	0	0	0	0	0	0	1	0	455	35	5	4	6654	123
SLCO6A1	133482	broad.mit.edu	37	5	101724473	101724473	+	Missense_Mutation	SNP	G	A	A	rs140805258	byFrequency	TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101724473G>A	uc003knn.2	-	12	2108	c.1936C>T	c.(1936-1938)CGG>TGG	p.R646W	SLCO6A1_uc003kno.2_Missense_Mutation_p.R393W|SLCO6A1_uc003knp.2_Missense_Mutation_p.R646W|SLCO6A1_uc003knq.2_Missense_Mutation_p.R584W	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	646	Extracellular (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TTAACATCCCGTAAAATACAA	0.313													50	57	---	---	---	---	capture	Missense_Mutation	SNP	101724473	101724473	SLCO6A1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	14624	123
CD14	929	broad.mit.edu	37	5	140011717	140011717	+	Silent	SNP	C	T	T	rs150900616		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140011717C>T	uc003lgi.1	-	2	1206	c.852G>A	c.(850-852)TCG>TCA	p.S284S	CD14_uc003lgj.1_Silent_p.S284S	NM_000591	NP_000582	P08571	CD14_HUMAN	CD14 antigen precursor	284	LRR 9.				apoptosis|cellular response to lipopolysaccharide|cellular response to lipoteichoic acid|inflammatory response|innate immune response|phagocytosis|positive regulation of tumor necrosis factor production|Toll signaling pathway	anchored to membrane|plasma membrane	lipopolysaccharide binding|lipoteichoic acid binding|opsonin receptor activity|peptidoglycan receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCAGCGAACGACAGATTGA	0.617													51	149	---	---	---	---	capture	Silent	SNP	140011717	140011717	CD14	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2935	123
WWC1	23286	broad.mit.edu	37	5	167880985	167880985	+	Silent	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167880985G>A	uc003lzu.2	+	18	2631	c.2538G>A	c.(2536-2538)GAG>GAA	p.E846E	WWC1_uc003lzv.2_Silent_p.E846E|WWC1_uc011den.1_Silent_p.E846E|WWC1_uc003lzw.2_Silent_p.E645E|WWC1_uc010jjf.1_Silent_p.E118E	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3	846	Glu-rich.|Interaction with histone H3.				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		GGTATGAGGAGACCAGTGAGA	0.403													35	67	---	---	---	---	capture	Silent	SNP	167880985	167880985	WWC1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	17292	123
LGSN	51557	broad.mit.edu	37	6	63990164	63990164	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:63990164A>C	uc003peh.2	-	4	1326	c.1292T>G	c.(1291-1293)CTT>CGT	p.L431R	LGSN_uc003pei.2_3'UTR	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	431					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	ACTGCTATGAAGTCCATCTAA	0.478													4	184	---	---	---	---	capture	Missense_Mutation	SNP	63990164	63990164	LGSN	6	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	8679	123
FILIP1	27145	broad.mit.edu	37	6	76024397	76024397	+	Missense_Mutation	SNP	C	T	T	rs147080592		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76024397C>T	uc003pia.2	-	5	1524	c.1151G>A	c.(1150-1152)CGA>CAA	p.R384Q	FILIP1_uc003phy.1_Missense_Mutation_p.R384Q|FILIP1_uc003phz.2_Missense_Mutation_p.R285Q|FILIP1_uc010kbe.2_Missense_Mutation_p.R387Q|FILIP1_uc003pib.1_Missense_Mutation_p.R136Q	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	384	Potential.							p.R384Q(1)		skin(3)|ovary(1)	4						CACACGCTTTCGAAGATTTTC	0.418													155	226	---	---	---	---	capture	Missense_Mutation	SNP	76024397	76024397	FILIP1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5839	123
CASP8AP2	9994	broad.mit.edu	37	6	90577200	90577200	+	Silent	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90577200G>A	uc003pnr.2	+	8	4387	c.4191G>A	c.(4189-4191)CCG>CCA	p.P1397P	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Silent_p.P1397P|CASP8AP2_uc011dzz.1_Silent_p.P1397P	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	1397					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TTTCATTGCCGGTTCATCCTG	0.393													90	122	---	---	---	---	capture	Silent	SNP	90577200	90577200	CASP8AP2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2654	123
SYNE1	23345	broad.mit.edu	37	6	152461140	152461140	+	Missense_Mutation	SNP	C	T	T	rs143049227		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152461140C>T	uc010kiw.2	-	140	26005	c.25403G>A	c.(25402-25404)CGT>CAT	p.R8468H	SYNE1_uc010kiv.2_Missense_Mutation_p.R2992H|SYNE1_uc003qos.3_Missense_Mutation_p.R2992H|SYNE1_uc003qot.3_Missense_Mutation_p.R8420H|SYNE1_uc003qou.3_Missense_Mutation_p.R8468H|SYNE1_uc003qop.3_Missense_Mutation_p.R653H|SYNE1_uc011eez.1_Missense_Mutation_p.R670H|SYNE1_uc003qoq.3_Missense_Mutation_p.R670H|SYNE1_uc003qor.3_Missense_Mutation_p.R1391H	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8468	Cytoplasmic (Potential).|Spectrin 31.		R -> H (in a colorectal cancer sample; somatic mutation).		cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	p.R8468H(1)		central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGTTCCAGACGCTGGAGCTG	0.557										HNSCC(10;0.0054)			78	122	---	---	---	---	capture	Missense_Mutation	SNP	152461140	152461140	SYNE1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15333	123
FNDC1	84624	broad.mit.edu	37	6	159653439	159653439	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159653439G>A	uc010kjv.2	+	11	2095	c.1895G>A	c.(1894-1896)CGT>CAT	p.R632H	FNDC1_uc010kjw.1_Missense_Mutation_p.R517H	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	632						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		ACCTCTCATCGTCCTTCCCTG	0.682													72	66	---	---	---	---	capture	Missense_Mutation	SNP	159653439	159653439	FNDC1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5912	123
GPNMB	10457	broad.mit.edu	37	7	23309680	23309680	+	Silent	SNP	C	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23309680C>T	uc003swc.2	+	9	1512	c.1351C>T	c.(1351-1353)CTG>TTG	p.L451L	GPNMB_uc003swb.2_Silent_p.L439L|GPNMB_uc011jyy.1_Silent_p.L393L|GPNMB_uc011jyz.1_Silent_p.L340L	NM_001005340	NP_001005340	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb isoform a	451	Extracellular (Potential).				negative regulation of cell proliferation	melanosome				ovary(3)|breast(2)	5			GBM - Glioblastoma multiforme(13;0.154)			TGAGATGTGTCTGCTGACTGT	0.557													111	225	---	---	---	---	capture	Silent	SNP	23309680	23309680	GPNMB	7	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	6554	123
FAM188B	84182	broad.mit.edu	37	7	30890151	30890151	+	Silent	SNP	A	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30890151A>G	uc003tbt.2	+	10	1604	c.1527A>G	c.(1525-1527)CGA>CGG	p.R509R	FAM188B_uc010kwe.2_Silent_p.R480R|AQP1_uc011kac.1_5'Flank	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	509											0						CAGGGGGCCGAGAGAGAGCCG	0.622													22	54	---	---	---	---	capture	Silent	SNP	30890151	30890151	FAM188B	7	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	5467	123
HECW1	23072	broad.mit.edu	37	7	43360338	43360338	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43360338G>C	uc003tid.1	+	5	1062	c.457G>C	c.(457-459)GAA>CAA	p.E153Q	HECW1_uc011kbi.1_Missense_Mutation_p.E153Q|HECW1_uc003tie.1_Missense_Mutation_p.E185Q	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	153					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GTACTTTGTGGAACGTGAGTA	0.458													3	131	---	---	---	---	capture	Missense_Mutation	SNP	43360338	43360338	HECW1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	6968	123
MUC17	140453	broad.mit.edu	37	7	100687031	100687031	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100687031G>A	uc003uxp.1	+	3	12387	c.12334G>A	c.(12334-12336)GCT>ACT	p.A4112T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4112	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GACCACCACCGCTGTCCCCAC	0.498													90	206	---	---	---	---	capture	Missense_Mutation	SNP	100687031	100687031	MUC17	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9884	123
PPP1R3A	5506	broad.mit.edu	37	7	113558442	113558442	+	Nonsense_Mutation	SNP	T	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113558442T>A	uc010ljy.1	-	1	641	c.610A>T	c.(610-612)AAA>TAA	p.K204*		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	204	CBM21.				glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						AACTCAACTTTACTGCCATCT	0.318													84	199	---	---	---	---	capture	Nonsense_Mutation	SNP	113558442	113558442	PPP1R3A	7	T	A	A	A	1	0	0	0	0	0	1	0	0	793	61	5	4	12272	123
BRAF	673	broad.mit.edu	37	7	140453141	140453141	+	Silent	SNP	A	T	T			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140453141A>T	uc003vwc.3	-	15	1855	c.1794T>A	c.(1792-1794)GCT>GCA	p.A598A		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	598	Protein kinase.				activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.A598_T599insV(6)|p.A598V(3)|p.D594_T599del(1)|p.A598T(1)	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	ATTTCACTGTAGCTAGACCAA	0.368		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				71	151	---	---	---	---	capture	Silent	SNP	140453141	140453141	BRAF	7	A	T	T	T	1	0	0	0	0	0	0	0	1	184	15	4	4	1484	123
CSMD1	64478	broad.mit.edu	37	8	2832079	2832079	+	Silent	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:2832079G>A	uc011kwk.1	-	56	9027	c.8637C>T	c.(8635-8637)GGC>GGT	p.G2879G	CSMD1_uc011kwj.1_Silent_p.G2208G|CSMD1_uc010lrg.2_Silent_p.G889G	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2879	Sushi 21.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCACGACGGCGCCATAGGTAA	0.557													26	35	---	---	---	---	capture	Silent	SNP	2832079	2832079	CSMD1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3909	123
USP17L2	377630	broad.mit.edu	37	8	11995987	11995987	+	Silent	SNP	G	A	A	rs3988861		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11995987G>A	uc003wvc.1	-	1	283	c.283C>T	c.(283-285)CTG>TTG	p.L95L	FAM66D_uc011kxp.1_Intron|FAM66D_uc011kxo.1_Intron	NM_201402	NP_958804	Q6R6M4	U17L2_HUMAN	deubiquitinating enzyme 3	95					apoptosis|cell cycle|G2/M transition checkpoint|mitotic cell cycle G1/S transition checkpoint|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity	p.L95L(1)		skin(2)|upper_aerodigestive_tract(1)	3						AGGCACTGCAGGGAAGCGTTC	0.567													5	98	---	---	---	---	capture	Silent	SNP	11995987	11995987	USP17L2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	16930	123
SLC7A2	6542	broad.mit.edu	37	8	17422587	17422587	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:17422587G>A	uc011kyc.1	+	12	2078	c.1909G>A	c.(1909-1911)GCA>ACA	p.A637T	SLC7A2_uc011kyd.1_Missense_Mutation_p.A676T|SLC7A2_uc011kye.1_Missense_Mutation_p.A677T|SLC7A2_uc011kyf.1_Missense_Mutation_p.A637T	NM_001008539	NP_001008539	P52569	CTR2_HUMAN	solute carrier family 7, member 2 isoform 2	637	Cytoplasmic (Potential).				cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	TGCCATTCAAGCAAATGACCA	0.423													37	59	---	---	---	---	capture	Missense_Mutation	SNP	17422587	17422587	SLC7A2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	14589	123
DOK2	9046	broad.mit.edu	37	8	21771096	21771096	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:21771096A>C	uc003wzy.1	-	1	110	c.17T>G	c.(16-18)GTG>GGG	p.V6G	DOK2_uc003wzx.1_Missense_Mutation_p.V6G|DOK2_uc003wzz.1_5'UTR|DOK2_uc010lth.1_5'UTR	NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2	6	PH.				blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		GCCTTGTTTCACTGCCCCGTC	0.582													8	252	---	---	---	---	capture	Missense_Mutation	SNP	21771096	21771096	DOK2	8	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	4653	123
ELP3	55140	broad.mit.edu	37	8	27954764	27954764	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:27954764G>A	uc003xgo.3	+	2	196	c.48G>A	c.(46-48)ATG>ATA	p.M16I	ELP3_uc003xgn.3_Missense_Mutation_p.M1I|ELP3_uc011laq.1_Intron|ELP3_uc011lar.1_5'UTR|ELP3_uc011las.1_Intron|ELP3_uc011lat.1_5'UTR	NM_018091	NP_060561	Q9H9T3	ELP3_HUMAN	elongation protein 3 homolog	16					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	histone acetyltransferase activity|iron-sulfur cluster binding|metal ion binding|phosphorylase kinase regulator activity|protein binding				0		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		AGCTGATGATGCTGACTATAG	0.368													5	286	---	---	---	---	capture	Missense_Mutation	SNP	27954764	27954764	ELP3	8	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	5036	123
PCMTD1	115294	broad.mit.edu	37	8	52733124	52733124	+	Silent	SNP	A	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52733124A>C	uc003xqx.3	-	6	1202	c.861T>G	c.(859-861)ACT>ACG	p.T287T	PCMTD1_uc011ldm.1_Silent_p.T157T|PCMTD1_uc003xqw.3_Silent_p.T287T|PCMTD1_uc011ldn.1_Silent_p.T99T|PCMTD1_uc010lya.2_Silent_p.T211T	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	287						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				CAAATACGTAAGTGTTAATTC	0.303													13	338	---	---	---	---	capture	Silent	SNP	52733124	52733124	PCMTD1	8	A	C	C	C	1	0	0	0	0	0	0	0	1	28	3	4	4	11489	123
ANGPT1	284	broad.mit.edu	37	8	108276567	108276567	+	Silent	SNP	T	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:108276567T>C	uc003ymn.2	-	8	1686	c.1218A>G	c.(1216-1218)AAA>AAG	p.K406K	ANGPT1_uc011lhv.1_Silent_p.K206K|ANGPT1_uc003ymo.2_Silent_p.K405K	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor	406	Fibrinogen C-terminal.				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			CAGTGTGACCTTTTAAATACA	0.393													69	88	---	---	---	---	capture	Silent	SNP	108276567	108276567	ANGPT1	8	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	607	123
MAMDC2	256691	broad.mit.edu	37	9	72755159	72755159	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:72755159G>A	uc004ahm.2	+	8	1710	c.1093G>A	c.(1093-1095)GTA>ATA	p.V365I	MAMDC2_uc004ahn.2_RNA	NM_153267	NP_694999	Q7Z304	MAMC2_HUMAN	MAM domain containing 2 precursor	365	MAM 3.					endoplasmic reticulum|membrane				central_nervous_system(1)|pancreas(1)	2						CCGAGTGAAAGTAAAACCAAA	0.458													5	177	---	---	---	---	capture	Missense_Mutation	SNP	72755159	72755159	MAMDC2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	9117	123
NXF3	56000	broad.mit.edu	37	X	102339283	102339283	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:102339283C>G	uc004eju.2	-	3	409	c.338G>C	c.(337-339)TGG>TCG	p.W113S	NXF3_uc010noi.1_5'Flank|NXF3_uc011mrw.1_Missense_Mutation_p.W113S|NXF3_uc011mrx.1_Missense_Mutation_p.W24S	NM_022052	NP_071335	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	113	RRM.					cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3						GATCTTGAACCAGCTCCCTAA	0.463													24	166	---	---	---	---	capture	Missense_Mutation	SNP	102339283	102339283	NXF3	23	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	10690	123
WDR44	54521	broad.mit.edu	37	X	117527112	117527112	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117527112G>A	uc004eqn.2	+	4	1129	c.704G>A	c.(703-705)CGC>CAC	p.R235H	WDR44_uc004eqo.2_Missense_Mutation_p.R235H|WDR44_uc011mtr.1_Missense_Mutation_p.R210H|WDR44_uc010nqi.2_5'UTR	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN	WD repeat domain 44 protein	235	Pro-rich.					cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						GTTCCAGCACGCCCACCTCCT	0.522													207	19	---	---	---	---	capture	Missense_Mutation	SNP	117527112	117527112	WDR44	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17177	123
STAG2	10735	broad.mit.edu	37	X	123176497	123176497	+	Splice_Site	SNP	T	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123176497T>C	uc004etz.3	+	6	801	c.462_splice	c.e6+2	p.E154_splice	STAG2_uc004eua.2_Splice_Site_p.E154_splice|STAG2_uc004eub.2_Splice_Site_p.E154_splice|STAG2_uc004euc.2_Splice_Site_p.E154_splice|STAG2_uc004eud.2_Splice_Site_p.E154_splice|STAG2_uc004eue.2_Splice_Site_p.E154_splice	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TTCGATGAGGTAACTTACTAC	0.274													54	11	---	---	---	---	capture	Splice_Site	SNP	123176497	123176497	STAG2	23	T	C	C	C	1	0	0	0	0	0	0	1	0	741	57	5	3	15133	123
GPC4	2239	broad.mit.edu	37	X	132458560	132458560	+	Silent	SNP	G	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:132458560G>A	uc004exc.1	-	3	536	c.324C>T	c.(322-324)TTC>TTT	p.F108F	GPC4_uc011mvg.1_Silent_p.F38F	NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4 precursor	108					anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)					GTTCTTTGAAGAATTCTGAAA	0.284													13	287	---	---	---	---	capture	Silent	SNP	132458560	132458560	GPC4	23	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	6534	123
SF3B2	10992	broad.mit.edu	37	11	65836145	65836146	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65836145_65836146insA	uc001ogy.1	+	22	2657_2658	c.2617_2618insA	c.(2617-2619)CAAfs	p.Q873fs	PACS1_uc001ogz.1_5'Flank|PACS1_uc001oha.1_5'Flank	NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2	873					interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						CCCTATACAGCAAAAAAAACGG	0.515											OREG0021094	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	281	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	65836145	65836146	SF3B2	11	-	A	A	A	1	0	1	1	0	0	0	0	0	325	25	5	5	14044	123
TWF1	5756	broad.mit.edu	37	12	44200088	44200100	+	Frame_Shift_Del	DEL	GCCAGCGGCCCCG	-	-			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:44200088_44200100delGCCAGCGGCCCCG	uc001rob.2	-	1	79_91	c.51_63delCGGGGCCGCTGGC	c.(49-63)GCCGGGGCCGCTGGCfs	p.A17fs	TWF1_uc001rnz.2_5'Flank|TWF1_uc001roa.2_Frame_Shift_Del_p.A17fs|TWF1_uc001roc.2_5'UTR	NM_002822	NP_002813	Q12792	TWF1_HUMAN	twinfilin 1	Error:Variant_position_missing_in_Q12792_after_alignment						actin cytoskeleton|cytoplasm	actin binding|protein tyrosine kinase activity			stomach(1)	1	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)		GCTGAGTGCAGCCAgcggccccggccggcggcc	0.540													7	15	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	44200088	44200100	TWF1	12	GCCAGCGGCCCCG	-	-	-	1	0	1	0	1	0	0	0	0	431	34	5	5	16663	123
WSB2	55884	broad.mit.edu	37	12	118490112	118490113	+	Splice_Site	INS	-	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118490112_118490113insA	uc001twr.2	-	2	280	c.182_splice	c.e2+1	p.F61_splice	WSB2_uc010sza.1_Intron|WSB2_uc010szb.1_Splice_Site|WSB2_uc009zws.1_Splice_Site_p.F61_splice	NM_018639	NP_061109	Q9NYS7	WSB2_HUMAN	WD SOCS-box protein 2						intracellular signal transduction					ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGAGAATACTTACAACTGCTCC	0.550													68	125	---	---	---	---	capture_indel	Splice_Site	INS	118490112	118490113	WSB2	12	-	A	A	A	1	0	1	1	0	0	0	1	0	781	61	5	5	17286	123
WASF3	10810	broad.mit.edu	37	13	27256966	27256967	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:27256966_27256967insC	uc001uqv.2	+	9	1431_1432	c.1206_1207insC	c.(1204-1209)CCTCCCfs	p.P402fs	WASF3_uc001uqw.2_Frame_Shift_Ins_p.P399fs	NM_006646	NP_006637	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	402_403	Poly-Pro.				actin filament polymerization	cytoplasm|cytoskeleton	actin binding			pancreas(1)	1	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		GCCCACCACCTCCCCCGCCAGG	0.708													8	205	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	27256966	27256967	WASF3	13	-	C	C	C	1	0	1	1	0	0	0	0	0	691	54	5	5	17136	123
LCMT2	9836	broad.mit.edu	37	15	43622424	43622425	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43622424_43622425delGA	uc001zrg.2	-	1	467_468	c.263_264delTC	c.(262-264)CTCfs	p.L88fs	LCMT2_uc010udn.1_Intron|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	NM_014793	NP_055608	O60294	LCMT2_HUMAN	leucine carboxyl methyltransferase 2	88					tRNA processing		methyltransferase activity|protein binding				0		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	AGCCAGCGCCGAGAGACAAGAT	0.668													10	111	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	43622424	43622425	LCMT2	15	GA	-	-	-	1	0	1	0	1	0	0	0	0	470	37	5	5	8599	123
CD300A	11314	broad.mit.edu	37	17	72469708	72469709	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72469708_72469709insG	uc002jkv.2	+	2	395_396	c.74_75insG	c.(73-75)GCGfs	p.A25fs	CD300A_uc002jkw.2_Intron|CD300A_uc010dfr.2_Intron|CD300A_uc010dfs.2_Intron	NM_007261	NP_009192	Q9UGN4	CLM8_HUMAN	leukocyte membrane antigen	25	Extracellular (Potential).|Ig-like V-type.				cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2						AGGACCGTGGCGGGCCCCGTGG	0.569													7	458	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	72469708	72469709	CD300A	17	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	2967	123
COL5A2	1290	broad.mit.edu	37	2	189927922	189927923	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189927922_189927923insC	uc002uqk.2	-	27	2119_2120	c.1844_1845insG	c.(1843-1845)GGCfs	p.G615fs	COL5A2_uc010frx.2_Frame_Shift_Ins_p.G191fs	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	615					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GGCCTGGAAGGCCCATGCTCCC	0.520													9	580	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	189927922	189927923	COL5A2	2	-	C	C	C	1	0	1	1	0	0	0	0	0	535	42	5	5	3662	123
SLC23A2	9962	broad.mit.edu	37	20	4850569	4850569	+	Frame_Shift_Del	DEL	G	-	-	rs138961929		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:4850569delG	uc002wlg.1	-	12	1608	c.1233delC	c.(1231-1233)CCCfs	p.P411fs	SLC23A2_uc010zqr.1_Frame_Shift_Del_p.P296fs|SLC23A2_uc002wlh.1_Frame_Shift_Del_p.P411fs|SLC23A2_uc002wli.2_Frame_Shift_Del_p.P410fs	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase	411					L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						TTGCGTGGATGGGGGGGGGTG	0.527													7	277	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	4850569	4850569	SLC23A2	20	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	14355	123
TNK2	10188	broad.mit.edu	37	3	195595228	195595229	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195595228_195595229insG	uc003fvu.1	-	12	2438_2439	c.1895_1896insC	c.(1894-1896)CCGfs	p.P632fs	TNK2_uc003fvq.1_Frame_Shift_Ins_p.P39fs|TNK2_uc003fvr.1_Frame_Shift_Ins_p.P157fs|TNK2_uc003fvs.1_Frame_Shift_Ins_p.P664fs|TNK2_uc003fvt.1_Frame_Shift_Ins_p.P710fs|TNK2_uc010hzw.1_RNA|TNK2_uc003fvv.1_3'UTR	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1	632	Required for interaction with SRC.|Required for interaction with NEDD4 (By similarity).|Pro-rich.			Missing (in Ref. 4; AAH08884).	positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CATAGGCGGGCGGGGGGGGCAG	0.728													10	229	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	195595228	195595229	TNK2	3	-	G	G	G	1	0	1	1	0	0	0	0	0	340	27	5	5	16201	123
MCC	4163	broad.mit.edu	37	5	112824048	112824049	+	In_Frame_Ins	INS	-	GCC	GCC			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:112824048_112824049insGCC	uc003kql.3	-	1	479_480	c.63_64insGGC	c.(61-66)insGGC	p.21_22insG		NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ctgctgccgctgccgccgccgc	0.391													35	28	---	---	---	---	capture_indel	In_Frame_Ins	INS	112824048	112824049	MCC	5	-	GCC	GCC	GCC	1	0	1	1	0	0	0	0	0	715	55	5	5	9286	123
FLOT1	10211	broad.mit.edu	37	6	30697825	30697826	+	Frame_Shift_Del	DEL	TT	-	-	rs113030936		TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30697825_30697826delTT	uc003nrm.2	-	12	1391_1392	c.1227_1228delAA	c.(1225-1230)GAAAGAfs	p.E409fs	FLOT1_uc011dmr.1_Frame_Shift_Del_p.E361fs	NM_005803	NP_005794	O75955	FLOT1_HUMAN	flotillin 1	409_410						centriolar satellite|endosome|integral to membrane|melanosome|membrane fraction					0						CCTGTGAGTCTTTCCACACTCT	0.530													18	230	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	30697825	30697826	FLOT1	6	TT	-	-	-	1	0	1	0	1	0	0	0	0	726	56	5	5	5880	123
STK19	8859	broad.mit.edu	37	6	31939829	31939830	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31939829_31939830insA	uc003nyv.2	+	1	184_185	c.56_57insA	c.(55-57)GCAfs	p.A19fs	DOM3Z_uc003nyo.1_5'UTR|DOM3Z_uc003nyp.1_5'UTR|DOM3Z_uc003nyq.1_5'UTR|DOM3Z_uc003nyr.1_5'UTR|DOM3Z_uc003nys.1_5'Flank|DOM3Z_uc010jtl.1_5'UTR|STK19_uc003nyt.2_5'UTR|DOM3Z_uc003nyu.1_5'UTR|STK19_uc011dow.1_Frame_Shift_Ins_p.A19fs|STK19_uc011dox.1_5'UTR|STK19_uc003nyw.2_Frame_Shift_Ins_p.A19fs|STK19_uc010jtn.1_5'Flank	NM_032454	NP_115830	P49842	STK19_HUMAN	serine/threonine kinase 19 isoform 2	19						nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			skin(4)	4						CAGTGGCGGGCAAACCCCTCCC	0.634													7	329	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	31939829	31939830	STK19	6	-	A	A	A	1	0	1	1	0	0	0	0	0	325	25	5	5	15182	123
CDHR3	222256	broad.mit.edu	37	7	105660912	105660912	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:105660912delA	uc003vdl.3	+	13	1855	c.1747delA	c.(1747-1749)ACAfs	p.T583fs	CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Frame_Shift_Del_p.T570fs|CDHR3_uc011klt.1_Frame_Shift_Del_p.T495fs|CDHR3_uc003vdn.2_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	583	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GAAAGTTGGCACAAATATTCA	0.428													9	310	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	105660912	105660912	CDHR3	7	A	-	-	-	1	0	1	0	1	0	0	0	0	78	6	5	5	3091	123
SPANXC	64663	broad.mit.edu	37	X	140335819	140335820	+	Frame_Shift_Ins	INS	-	T	T	rs57835830	byFrequency	TCGA-12-0821-01	TCGA-12-0821-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140335819_140335820insT	uc004fbk.2	-	2	180_181	c.124_125insA	c.(124-126)ATGfs	p.M42fs	SPANXC_uc004fbl.2_RNA	NM_022661	NP_073152	Q9NY87	SPNXC_HUMAN	sperm protein associated with the nucleus, X	42	Nuclear localization signal (Potential).					cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)					AGATGTTTTCATTTTTTTAGGA	0.500													54	298	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	140335819	140335820	SPANXC	23	-	T	T	T	1	0	1	1	0	0	0	0	0	104	8	5	5	14879	123
