Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
UBR4	23352	broad.mit.edu	37	1	19484449	19484449	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19484449G>A	uc001bbi.2	-	40	5624	c.5620C>T	c.(5620-5622)CGG>TGG	p.R1874W	UBR4_uc001bbl.1_5'Flank|UBR4_uc001bbm.1_Missense_Mutation_p.R1085W	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1874					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TAATTCATCCGCACATTCTCA	0.537													5	179	---	---	---	---	capture	Missense_Mutation	SNP	19484449	19484449	UBR4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	16786	124
C1orf173	127254	broad.mit.edu	37	1	75038513	75038513	+	Missense_Mutation	SNP	C	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75038513C>G	uc001dgg.2	-	14	3100	c.2881G>C	c.(2881-2883)GAC>CAC	p.D961H		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	961	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						GATGCTGTGTCCTCCATGGGT	0.522													14	137	---	---	---	---	capture	Missense_Mutation	SNP	75038513	75038513	C1orf173	1	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	1996	124
C1orf173	127254	broad.mit.edu	37	1	75055650	75055650	+	Missense_Mutation	SNP	C	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75055650C>A	uc001dgg.2	-	12	2060	c.1841G>T	c.(1840-1842)AGT>ATT	p.S614I	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.S408I	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	614	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CCTTCTGGCACTTTCATCTGT	0.448													52	97	---	---	---	---	capture	Missense_Mutation	SNP	75055650	75055650	C1orf173	1	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	1996	124
NGF	4803	broad.mit.edu	37	1	115828831	115828831	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115828831G>A	uc001efu.1	-	3	755	c.586C>T	c.(586-588)CAC>TAC	p.H196Y		NM_002506	NP_002497	P01138	NGF_HUMAN	nerve growth factor, beta polypeptide precursor	196					activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	GAGTTCCAGTGCTTTGAGTCA	0.517													37	37	---	---	---	---	capture	Missense_Mutation	SNP	115828831	115828831	NGF	1	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	10302	124
SPTA1	6708	broad.mit.edu	37	1	158641934	158641934	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158641934C>T	uc001fst.1	-	11	1602	c.1403G>A	c.(1402-1404)CGT>CAT	p.R468H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	468	Spectrin 5.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTGACGATGACGCTCGTCCCA	0.438													16	73	---	---	---	---	capture	Missense_Mutation	SNP	158641934	158641934	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15008	124
FAM5C	339479	broad.mit.edu	37	1	190067205	190067205	+	Silent	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:190067205C>T	uc001gse.1	-	8	2476	c.2244G>A	c.(2242-2244)GCG>GCA	p.A748A	FAM5C_uc010pot.1_Silent_p.A646A	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	748						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TGGCATTAAACGCCTGCAGAG	0.423													77	126	---	---	---	---	capture	Silent	SNP	190067205	190067205	FAM5C	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5542	124
OBSCN	84033	broad.mit.edu	37	1	228466482	228466482	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228466482G>A	uc009xez.1	+	26	6996	c.6952G>A	c.(6952-6954)GCC>ACC	p.A2318T	OBSCN_uc001hsn.2_Missense_Mutation_p.A2318T|OBSCN_uc001hsp.1_Missense_Mutation_p.A17T|OBSCN_uc001hsq.1_5'Flank	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2318	Ig-like 23.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCGGGCCAGCGCCCAGGTGCG	0.637													24	18	---	---	---	---	capture	Missense_Mutation	SNP	228466482	228466482	OBSCN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10717	124
OR2M4	26245	broad.mit.edu	37	1	248403138	248403138	+	Missense_Mutation	SNP	A	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248403138A>T	uc010pzh.1	+	1	908	c.908A>T	c.(907-909)AAG>ATG	p.K303M		NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCACTACAGAAGGTACTGAAG	0.398													5	57	---	---	---	---	capture	Missense_Mutation	SNP	248403138	248403138	OR2M4	1	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	10916	124
C10orf72	196740	broad.mit.edu	37	10	50285318	50285318	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50285318G>A	uc001jhf.2	-	4	609	c.580C>T	c.(580-582)CTC>TTC	p.L194F		NM_001031746	NP_001026916	Q8IW00	CJ072_HUMAN	hypothetical protein LOC196740 isoform 1	194	Helical; (Potential).					integral to membrane|plasma membrane					0						AGCATGAAGAGCAGAATGCTG	0.532													36	12	---	---	---	---	capture	Missense_Mutation	SNP	50285318	50285318	C10orf72	10	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	1603	124
MRGPRE	116534	broad.mit.edu	37	11	3249597	3249597	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3249597C>T	uc001lxq.3	-	2	740	c.430G>A	c.(430-432)GCC>ACC	p.A144T		NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	144	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(1)|ovary(1)	2		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGGTGAGGGCGCACACACAG	0.711													6	2	---	---	---	---	capture	Missense_Mutation	SNP	3249597	3249597	MRGPRE	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9674	124
OR8K3	219473	broad.mit.edu	37	11	56086025	56086025	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56086025G>A	uc010rjf.1	+	1	243	c.243G>A	c.(241-243)ATG>ATA	p.M81I		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	81	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					GACCCAAAATGTTAGTAAATT	0.353													48	175	---	---	---	---	capture	Missense_Mutation	SNP	56086025	56086025	OR8K3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	11148	124
MAP4K2	5871	broad.mit.edu	37	11	64557670	64557670	+	Silent	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64557670G>A	uc001obh.2	-	29	2330	c.2238C>T	c.(2236-2238)ATC>ATT	p.I746I	MAP4K2_uc001obg.2_RNA|MAP4K2_uc001obi.2_Silent_p.I738I	NM_004579	NP_004570	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase	746	CNH.				activation of JUN kinase activity|immune response|positive regulation of JNK cascade|vesicle targeting	basolateral plasma membrane|Golgi membrane|soluble fraction	ATP binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(1)|pancreas(1)	2						CCACAGTCTCGATGGGGAAAT	0.617													30	51	---	---	---	---	capture	Silent	SNP	64557670	64557670	MAP4K2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	9174	124
FAM55D	54827	broad.mit.edu	37	11	114453106	114453106	+	Missense_Mutation	SNP	C	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:114453106C>A	uc001ppc.2	-	3	915	c.734G>T	c.(733-735)AGG>ATG	p.R245M	FAM55D_uc001ppd.2_Intron	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	245						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)		GTGTTGAGGCCTCACACAGTA	0.438													68	71	---	---	---	---	capture	Missense_Mutation	SNP	114453106	114453106	FAM55D	11	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	5535	124
KRT4	3851	broad.mit.edu	37	12	53207484	53207484	+	Missense_Mutation	SNP	G	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53207484G>T	uc001saz.2	-	1	852	c.581C>A	c.(580-582)ACC>AAC	p.T194N		NM_002272	NP_002263	B4DRS2	B4DRS2_HUMAN	keratin 4	120						keratin filament	structural molecule activity			ovary(4)|skin(2)	6						GTGGAGGGGGGTGAGCAAGCT	0.587													17	133	---	---	---	---	capture	Missense_Mutation	SNP	53207484	53207484	KRT4	12	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	8397	124
OR6C1	390321	broad.mit.edu	37	12	55714593	55714593	+	Silent	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55714593G>A	uc010spi.1	+	1	210	c.210G>A	c.(208-210)TCG>TCA	p.S70S		NM_001005182	NP_001005182	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2						TAGAAATTTCGTTCACAACCG	0.383													50	75	---	---	---	---	capture	Silent	SNP	55714593	55714593	OR6C1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11094	124
PAH	5053	broad.mit.edu	37	12	103246614	103246614	+	Missense_Mutation	SNP	T	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:103246614T>A	uc001tjq.1	-	8	1293	c.821A>T	c.(820-822)AAG>ATG	p.K274M		NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase	274			K -> E.		catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	ATACATGGGCTTGGATCCATG	0.562													40	76	---	---	---	---	capture	Missense_Mutation	SNP	103246614	103246614	PAH	12	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	11298	124
EXOSC8	11340	broad.mit.edu	37	13	37580266	37580266	+	Missense_Mutation	SNP	A	C	C			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:37580266A>C	uc001uwa.2	+	7	624	c.359A>C	c.(358-360)CAG>CCG	p.Q120P	EXOSC8_uc001uvz.2_RNA|EXOSC8_uc001uwb.2_Missense_Mutation_p.Q120P|EXOSC8_uc001uwc.2_RNA	NM_181503	NP_852480	Q96B26	EXOS8_HUMAN	exosome component 8	120					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	AU-rich element binding|identical protein binding			pancreas(1)	1		Lung NSC(96;6.57e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.67e-07)|Epithelial(112;1.31e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00699)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0411)		CAGATAATTCAGAAAGAGGAC	0.318													9	73	---	---	---	---	capture	Missense_Mutation	SNP	37580266	37580266	EXOSC8	13	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	5275	124
FANCM	57697	broad.mit.edu	37	14	45605251	45605251	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:45605251G>A	uc001wwd.3	+	1	116	c.17G>A	c.(16-18)AGA>AAA	p.R6K	FANCM_uc001wwc.2_Missense_Mutation_p.R6K|FANCM_uc010anf.2_Missense_Mutation_p.R6K|FKBP3_uc010tqf.1_5'Flank	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	6					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						GGACGGCAAAGAACGCTTTTT	0.582								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				38	62	---	---	---	---	capture	Missense_Mutation	SNP	45605251	45605251	FANCM	14	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	5617	124
NAA30	122830	broad.mit.edu	37	14	57858239	57858239	+	Silent	SNP	T	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:57858239T>G	uc001xcx.3	+	2	718	c.564T>G	c.(562-564)TCT>TCG	p.S188S	NAA30_uc010trk.1_Intron|NAA30_uc010aow.2_Intron	NM_001011713	NP_001011713	Q147X3	NAA30_HUMAN	N-acetyltransferase 12	188						cytoplasm	peptide alpha-N-acetyltransferase activity			skin(1)	1						GGCTGCTGTCTTCGTCCCTGA	0.657													4	26	---	---	---	---	capture	Silent	SNP	57858239	57858239	NAA30	14	T	G	G	G	1	0	0	0	0	0	0	0	1	717	56	4	4	10032	124
ACOT1	641371	broad.mit.edu	37	14	74004293	74004293	+	Silent	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74004293C>T	uc001xol.1	+	1	366	c.168C>T	c.(166-168)ACC>ACT	p.T56T	HEATR4_uc010tua.1_Intron|ACOT1_uc010tuc.1_Silent_p.T56T	NM_001037161	NP_001032238	Q86TX2	ACOT1_HUMAN	acyl-CoA thioesterase 1	56					acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	cytosol	carboxylesterase activity|palmitoyl-CoA hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(108;1.37e-45)|BRCA - Breast invasive adenocarcinoma(234;0.0033)		GCGCCGACACCCTTGGCGAGC	0.746													5	5	---	---	---	---	capture	Silent	SNP	74004293	74004293	ACOT1	14	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	148	124
TSHR	7253	broad.mit.edu	37	14	81610003	81610003	+	Missense_Mutation	SNP	G	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:81610003G>T	uc001xvd.1	+	10	1757	c.1601G>T	c.(1600-1602)CGC>CTC	p.R534L		NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1	534	Cytoplasmic (Potential).				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	CGGAAGATCCGCCTCAGGCAC	0.562			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						6	85	---	---	---	---	capture	Missense_Mutation	SNP	81610003	81610003	TSHR	14	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	16505	124
IFI27	3429	broad.mit.edu	37	14	94582172	94582172	+	Silent	SNP	C	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94582172C>G	uc010tws.1	+	4	355	c.234C>G	c.(232-234)GGC>GGG	p.G78G	IFI27_uc001ycn.1_RNA|IFI27_uc001yco.2_Missense_Mutation_p.A59G	NM_005532	NP_005523	P40305	IFI27_HUMAN	interferon, alpha-inducible protein 27 isoform	Error:Variant_position_missing_in_P40305_after_alignment					activation of caspase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|type I interferon-mediated signaling pathway	integral to membrane|mitochondrion					0				Epithelial(152;0.112)|all cancers(159;0.187)|COAD - Colon adenocarcinoma(157;0.206)		TTCACTGCGGCGGGAATCGCC	0.642													2	6	---	---	---	---	capture	Silent	SNP	94582172	94582172	IFI27	14	C	G	G	G	1	0	0	0	0	0	0	0	1	351	27	4	4	7437	124
MGA	23269	broad.mit.edu	37	15	42032290	42032290	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42032290C>T	uc010ucy.1	+	14	4655	c.4474C>T	c.(4474-4476)CGT>TGT	p.R1492C	MGA_uc010ucz.1_Missense_Mutation_p.R1492C|MGA_uc010uda.1_Missense_Mutation_p.R108C	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	1492						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		CAGGAAACCACGTACCCTGTT	0.532													16	84	---	---	---	---	capture	Missense_Mutation	SNP	42032290	42032290	MGA	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9452	124
LRRK1	79705	broad.mit.edu	37	15	101592102	101592102	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101592102C>T	uc002bwr.2	+	24	3945	c.3626C>T	c.(3625-3627)CCG>CTG	p.P1209L	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_5'Flank	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1209					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCCAGACACCCGGACCTCCCC	0.617													3	42	---	---	---	---	capture	Missense_Mutation	SNP	101592102	101592102	LRRK1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8947	124
SALL1	6299	broad.mit.edu	37	16	51171034	51171034	+	Missense_Mutation	SNP	C	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:51171034C>G	uc010vgs.1	-	3	3995	c.3964G>C	c.(3964-3966)GTC>CTC	p.V1322L	SALL1_uc010vgr.1_Missense_Mutation_p.V1225L|SALL1_uc010cbv.2_Missense_Mutation_p.V174L	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	1322					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TAACTCGTGACGATCTCCTTG	0.592													18	36	---	---	---	---	capture	Missense_Mutation	SNP	51171034	51171034	SALL1	16	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	13702	124
GNAO1	2775	broad.mit.edu	37	16	56374784	56374784	+	Missense_Mutation	SNP	C	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56374784C>G	uc002eit.3	+	7	1659	c.762C>G	c.(760-762)ATC>ATG	p.I254M	GNAO1_uc002eiu.3_Intron	NM_138736	NP_620073	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha	254					dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)				TTGACAGCATCTGCAACAACA	0.527													197	248	---	---	---	---	capture	Missense_Mutation	SNP	56374784	56374784	GNAO1	16	C	G	G	G	1	0	0	0	0	1	0	0	0	408	32	4	4	6444	124
PMFBP1	83449	broad.mit.edu	37	16	72158703	72158703	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72158703G>A	uc002fcc.3	-	17	2739	c.2567C>T	c.(2566-2568)GCC>GTC	p.A856V	PMFBP1_uc002fcd.2_Missense_Mutation_p.A851V|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.A706V|PMFBP1_uc010cgo.1_Missense_Mutation_p.A147V	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	856	Potential.									ovary(2)	2		Ovarian(137;0.179)				TTTTAAGGCGGCCATCTCCTC	0.572											OREG0023927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	203	---	---	---	---	capture	Missense_Mutation	SNP	72158703	72158703	PMFBP1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12037	124
GAN	8139	broad.mit.edu	37	16	81390535	81390535	+	Missense_Mutation	SNP	A	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81390535A>G	uc002fgo.2	+	4	927	c.779A>G	c.(778-780)GAG>GGG	p.E260G		NM_022041	NP_071324	Q9H2C0	GAN_HUMAN	gigaxonin	260					cell death	cytoplasm|neurofilament	protein binding			ovary(2)	2		Colorectal(91;0.153)				CAGCAAGGGGAGGCGATGCTG	0.493													3	165	---	---	---	---	capture	Missense_Mutation	SNP	81390535	81390535	GAN	16	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	6172	124
FBXO31	79791	broad.mit.edu	37	16	87367838	87367838	+	Missense_Mutation	SNP	G	C	C			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:87367838G>C	uc002fjw.2	-	8	1095	c.1051C>G	c.(1051-1053)CGG>GGG	p.R351G	FBXO31_uc010vot.1_Missense_Mutation_p.R179G|FBXO31_uc002fjv.2_Missense_Mutation_p.R243G	NM_024735	NP_079011	Q5XUX0	FBX31_HUMAN	F-box protein 31	351					cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)		AGCTGGATCCGATGCCTCAGG	0.657													18	87	---	---	---	---	capture	Missense_Mutation	SNP	87367838	87367838	FBXO31	16	G	C	C	C	1	0	0	0	0	1	0	0	0	480	37	4	4	5687	124
BCL6B	255877	broad.mit.edu	37	17	6929925	6929925	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6929925C>T	uc002geg.2	+	6	1096	c.1039C>T	c.(1039-1041)CGT>TGT	p.R347C	BCL6B_uc010clt.1_Missense_Mutation_p.R348C	NM_181844	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B (zinc finger	347	C2H2-type 1.					nucleus	zinc ion binding			skin(1)	1						TGCCAGTCATCGTACAGTGCA	0.582													61	97	---	---	---	---	capture	Missense_Mutation	SNP	6929925	6929925	BCL6B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1366	124
MAP2K3	5606	broad.mit.edu	37	17	21208414	21208414	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21208414G>A	uc002gys.2	+	9	1013	c.748G>A	c.(748-750)GAC>AAC	p.D250N	MAP2K3_uc002gyt.2_Missense_Mutation_p.D221N|MAP2K3_uc002gyu.2_Missense_Mutation_p.D221N	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	250	Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		TGTCAAGTCCGACGTCTGGAG	0.577													6	184	---	---	---	---	capture	Missense_Mutation	SNP	21208414	21208414	MAP2K3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9152	124
LGALS9	3965	broad.mit.edu	37	17	25974373	25974373	+	Missense_Mutation	SNP	G	A	A	rs149003631		TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:25974373G>A	uc002gzp.2	+	10	954	c.836G>A	c.(835-837)CGC>CAC	p.R279H	LGALS9_uc002gzq.2_Missense_Mutation_p.R247H|LGALS9_uc002gzr.2_Missense_Mutation_p.R190H|LGALS9_uc010waa.1_Intron|LGALS9_uc002gzs.2_Intron	NM_009587	NP_033665	O00182	LEG9_HUMAN	galectin-9 isoform long	279	Galectin 2.				positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	galactose binding|signal transducer activity				0	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		GCTGTGGTCCGCAACACCCAG	0.587													3	48	---	---	---	---	capture	Missense_Mutation	SNP	25974373	25974373	LGALS9	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8668	124
SSH2	85464	broad.mit.edu	37	17	27977712	27977712	+	Missense_Mutation	SNP	C	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27977712C>A	uc002heo.1	-	12	1105	c.1105G>T	c.(1105-1107)GCG>TCG	p.A369S	SSH2_uc010wbh.1_Missense_Mutation_p.A396S|SSH2_uc002hep.1_Missense_Mutation_p.A369S	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	369	Tyrosine-protein phosphatase.				actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						TTCCAGTACGCCAGGAGATCC	0.428													18	140	---	---	---	---	capture	Missense_Mutation	SNP	27977712	27977712	SSH2	17	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	15077	124
RNF157	114804	broad.mit.edu	37	17	74157723	74157723	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74157723G>A	uc002jqz.2	-	11	1027	c.958C>T	c.(958-960)CGG>TGG	p.R320W	RNF157_uc002jra.2_Missense_Mutation_p.R320W	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157	320							zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			AGCAGTGCCCGGAAGGCTGTG	0.507													22	55	---	---	---	---	capture	Missense_Mutation	SNP	74157723	74157723	RNF157	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	13346	124
LMAN1	3998	broad.mit.edu	37	18	57022568	57022568	+	Missense_Mutation	SNP	C	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:57022568C>A	uc002lhz.2	-	3	486	c.454G>T	c.(454-456)GAT>TAT	p.D152Y	LMAN1_uc010xek.1_Missense_Mutation_p.D152Y	NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor	152	Lumenal (Potential).|L-type lectin-like.	Calcium.			blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TCAAAAGAATCAAAAAATATT	0.353													4	37	---	---	---	---	capture	Missense_Mutation	SNP	57022568	57022568	LMAN1	18	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	8756	124
LSR	51599	broad.mit.edu	37	19	35741541	35741541	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35741541C>T	uc002nyl.2	+	2	800	c.577C>T	c.(577-579)CGG>TGG	p.R193W	LSR_uc002nym.2_Missense_Mutation_p.R193W|LSR_uc002nyn.2_Missense_Mutation_p.R193W|LSR_uc002nyo.2_Missense_Mutation_p.R193W|LSR_uc010xsr.1_Missense_Mutation_p.R193W|LSR_uc002nyp.2_Missense_Mutation_p.R156W	NM_205834	NP_991403	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	193	Extracellular (Potential).|Ig-like V-type.				embryo development|liver development	chylomicron|integral to membrane|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle	receptor activity				0	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTACCAGGGCCGGAGGATTAC	0.642													3	60	---	---	---	---	capture	Missense_Mutation	SNP	35741541	35741541	LSR	19	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	8979	124
ATP4A	495	broad.mit.edu	37	19	36046636	36046636	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36046636C>T	uc002oal.1	-	13	1977	c.1948G>A	c.(1948-1950)GAG>AAG	p.E650K	ATP4A_uc010eee.1_5'UTR	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	650	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	TCCACTGTCTCGCTGCCTTCC	0.622													91	140	---	---	---	---	capture	Missense_Mutation	SNP	36046636	36046636	ATP4A	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1136	124
MYT1L	23040	broad.mit.edu	37	2	1926184	1926184	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1926184C>T	uc002qxe.2	-	10	2184	c.1357G>A	c.(1357-1359)GCC>ACC	p.A453T	MYT1L_uc002qxd.2_Missense_Mutation_p.A453T|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	453					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCTTCCATGGCCATCTTCTCC	0.537													95	104	---	---	---	---	capture	Missense_Mutation	SNP	1926184	1926184	MYT1L	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10017	124
FAM98A	25940	broad.mit.edu	37	2	33810356	33810356	+	Silent	SNP	G	A	A	rs34080556		TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:33810356G>A	uc002rpa.1	-	8	1118	c.1044C>T	c.(1042-1044)TAC>TAT	p.Y348Y	FAM98A_uc010yne.1_Silent_p.Y153Y|FAM98A_uc010ynd.1_Silent_p.Y179Y|FAM98A_uc002roz.1_Silent_p.Y186Y	NM_015475	NP_056290	Q8NCA5	FA98A_HUMAN	hypothetical protein LOC25940	349	Gly-rich.									ovary(1)	1	all_hematologic(175;0.115)					CTCGTCCTCCGTATGAGGAAT	0.597													24	65	---	---	---	---	capture	Silent	SNP	33810356	33810356	FAM98A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5602	124
SNRNP200	23020	broad.mit.edu	37	2	96957584	96957584	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96957584G>A	uc002svu.2	-	17	2301	c.2215C>T	c.(2215-2217)CGG>TGG	p.R739W	SNRNP200_uc002svw.1_5'Flank	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	739	Helicase C-terminal 1.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	p.R739W(1)		ovary(5)|skin(4)|large_intestine(1)	10						CACATGTCCCGGATGGCCCTG	0.557													16	52	---	---	---	---	capture	Missense_Mutation	SNP	96957584	96957584	SNRNP200	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	14744	124
ST6GAL2	84620	broad.mit.edu	37	2	107460248	107460248	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107460248C>T	uc002tdq.2	-	2	305	c.186G>A	c.(184-186)ATG>ATA	p.M62I	ST6GAL2_uc002tdr.2_Missense_Mutation_p.M62I|ST6GAL2_uc002tds.3_Missense_Mutation_p.M62I	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	62	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						GTGCGGCGCCCATGATGGCCC	0.711													21	21	---	---	---	---	capture	Missense_Mutation	SNP	107460248	107460248	ST6GAL2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	15112	124
TTN	7273	broad.mit.edu	37	2	179454762	179454762	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179454762C>T	uc010zfg.1	-	253	54210	c.53986G>A	c.(53986-53988)GTT>ATT	p.V17996I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V11691I|TTN_uc010zfi.1_Missense_Mutation_p.V11624I|TTN_uc010zfj.1_Missense_Mutation_p.V11499I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18923							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGACGTTAACGATGGCTGAA	0.428													52	88	---	---	---	---	capture	Missense_Mutation	SNP	179454762	179454762	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	124
TTN	7273	broad.mit.edu	37	2	179584862	179584862	+	Missense_Mutation	SNP	A	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179584862A>G	uc010zfg.1	-	78	19999	c.19775T>C	c.(19774-19776)ATC>ACC	p.I6592T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.I3253T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	7519							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCTCTCTGATGACTTCACC	0.448													56	67	---	---	---	---	capture	Missense_Mutation	SNP	179584862	179584862	TTN	2	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	16617	124
ZDBF2	57683	broad.mit.edu	37	2	207173138	207173138	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207173138G>A	uc002vbp.2	+	5	4136	c.3886G>A	c.(3886-3888)GTA>ATA	p.V1296I		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1296							nucleic acid binding|zinc ion binding			ovary(3)	3						CCTTCAGTCCGTAACTAATAA	0.383													5	57	---	---	---	---	capture	Missense_Mutation	SNP	207173138	207173138	ZDBF2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17479	124
SPEG	10290	broad.mit.edu	37	2	220346370	220346370	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220346370G>A	uc010fwg.2	+	28	5533	c.5533G>A	c.(5533-5535)GCA>ACA	p.A1845T		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1845	Protein kinase 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GAGACCTACCGCAGAAGAGAC	0.443													11	49	---	---	---	---	capture	Missense_Mutation	SNP	220346370	220346370	SPEG	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14928	124
DGKD	8527	broad.mit.edu	37	2	234360642	234360642	+	Missense_Mutation	SNP	G	A	A	rs145038453	byFrequency	TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234360642G>A	uc002vui.1	+	18	2212	c.2200G>A	c.(2200-2202)GGT>AGT	p.G734S	DGKD_uc002vuj.1_Missense_Mutation_p.G690S|DGKD_uc010fyh.1_Missense_Mutation_p.G601S|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	734					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TTCCTTACCCGGTGGCTCAGT	0.493													39	54	---	---	---	---	capture	Missense_Mutation	SNP	234360642	234360642	DGKD	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4425	124
GPR35	2859	broad.mit.edu	37	2	241569721	241569721	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241569721G>A	uc002vzs.1	+	1	927	c.352G>A	c.(352-354)GTG>ATG	p.V118M	GPR35_uc010fzh.1_Missense_Mutation_p.V149M|GPR35_uc010fzi.1_Missense_Mutation_p.V149M	NM_005301	NP_005292	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	118	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity			skin(2)|pancreas(1)	3		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		CTATGTGGCCGTGCGGCACCC	0.701													5	27	---	---	---	---	capture	Missense_Mutation	SNP	241569721	241569721	GPR35	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6624	124
PTGIS	5740	broad.mit.edu	37	20	48140704	48140704	+	Missense_Mutation	SNP	C	T	T	rs45571835		TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:48140704C>T	uc002xut.2	-	6	800	c.746G>A	c.(745-747)CGG>CAG	p.R249Q	PTGIS_uc010zyi.1_Missense_Mutation_p.R110Q	NM_000961	NP_000952	Q16647	PTGIS_HUMAN	prostaglandin I2 synthase	249					hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)	CCGGTGGGCCCGCCTGGCCAG	0.627													9	251	---	---	---	---	capture	Missense_Mutation	SNP	48140704	48140704	PTGIS	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12647	124
ATP9A	10079	broad.mit.edu	37	20	50225158	50225158	+	Missense_Mutation	SNP	T	C	C			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50225158T>C	uc002xwg.1	-	25	2644	c.2644A>G	c.(2644-2646)ACA>GCA	p.T882A	ATP9A_uc010gih.1_Missense_Mutation_p.T746A|ATP9A_uc002xwf.1_Missense_Mutation_p.T54A	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	882	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						GTGTAAATTGTGGAGTACCTG	0.488													8	48	---	---	---	---	capture	Missense_Mutation	SNP	50225158	50225158	ATP9A	20	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	1189	124
C20orf20	55257	broad.mit.edu	37	20	61430922	61430922	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61430922G>A	uc002ydi.2	+	5	613	c.542G>A	c.(541-543)CGG>CAG	p.R181Q		NM_018270	NP_060740	Q9NV56	MRGBP_HUMAN	MRG-binding protein	181					chromatin modification|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	H4/H2A histone acetyltransferase complex					0	Breast(26;3.65e-08)					AAGCGCAGCCGGGTCACCGAC	0.582													49	203	---	---	---	---	capture	Missense_Mutation	SNP	61430922	61430922	C20orf20	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2085	124
KRTAP10-8	386681	broad.mit.edu	37	21	46032293	46032293	+	Silent	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46032293C>T	uc002zfo.1	+	1	298	c.276C>T	c.(274-276)GAC>GAT	p.D92D	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198695	NP_941968	P60410	KR108_HUMAN	keratin associated protein 10-8	92	19 X 5 AA repeats of C-C-X(3).					keratin filament				large_intestine(1)|breast(1)	2						GCTGCACCGACTCCTGCACAC	0.662													53	61	---	---	---	---	capture	Silent	SNP	46032293	46032293	KRTAP10-8	21	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	8435	124
IL17RA	23765	broad.mit.edu	37	22	17589233	17589233	+	Missense_Mutation	SNP	T	C	C			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:17589233T>C	uc002zly.2	+	13	1257	c.1124T>C	c.(1123-1125)CTG>CCG	p.L375P	IL17RA_uc010gqt.2_Missense_Mutation_p.L323P	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor	375	Cytoplasmic (Potential).				fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		CCCCCACCGCTGAAGCCCAGG	0.637													3	70	---	---	---	---	capture	Missense_Mutation	SNP	17589233	17589233	IL17RA	22	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	7562	124
APOBEC3A	200315	broad.mit.edu	37	22	39355652	39355652	+	Silent	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39355652G>A	uc003awn.2	+	2	305	c.135G>A	c.(133-135)TCG>TCA	p.S45S	APOBEC3A_uc011aob.1_Silent_p.S27S|APOBEC3A_uc011aoc.1_Silent_p.S45S	NM_145699	NP_663745	P31941	ABC3A_HUMAN	phorbolin 1	45					cellular response to xenobiotic stimulus|defense response to virus|DNA cytosine deamination|DNA demethylation|innate immune response|negative regulation of transposition|negative regulation of viral genome replication	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					ATGGCACCTCGGTCAAGATGG	0.532													29	54	---	---	---	---	capture	Silent	SNP	39355652	39355652	APOBEC3A	22	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	782	124
MCAT	27349	broad.mit.edu	37	22	43538975	43538975	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:43538975G>A	uc003bdl.1	-	1	429	c.380C>T	c.(379-381)GCA>GTA	p.A127V	MCAT_uc003bdm.1_Missense_Mutation_p.A127V	NM_173467	NP_775738	Q8IVS2	FABD_HUMAN	mitochondrial malonyltransferase isoform a	127					fatty acid biosynthetic process	mitochondrion	[acyl-carrier-protein] S-malonyltransferase activity|binding			ovary(1)	1		Ovarian(80;0.0694)				GGCCAGCGATGCCACGAAGAT	0.682													5	13	---	---	---	---	capture	Missense_Mutation	SNP	43538975	43538975	MCAT	22	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9285	124
MST1R	4486	broad.mit.edu	37	3	49940449	49940449	+	Silent	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49940449G>A	uc003cxy.3	-	1	858	c.594C>T	c.(592-594)TAC>TAT	p.Y198Y	MST1R_uc011bdd.1_Silent_p.Y198Y|MST1R_uc011bde.1_Silent_p.Y198Y|MST1R_uc011bdf.1_Silent_p.Y198Y|MST1R_uc011bdg.1_Silent_p.Y198Y	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	198	Extracellular (Potential).|Sema.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		AGGATGCCACGTAGAAATAGG	0.632													19	22	---	---	---	---	capture	Silent	SNP	49940449	49940449	MST1R	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9801	124
FLNB	2317	broad.mit.edu	37	3	58145402	58145402	+	Missense_Mutation	SNP	A	C	C			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58145402A>C	uc003djj.2	+	42	7175	c.7010A>C	c.(7009-7011)GAG>GCG	p.E2337A	FLNB_uc010hne.2_Missense_Mutation_p.E2368A|FLNB_uc003djk.2_Missense_Mutation_p.E2326A|FLNB_uc010hnf.2_Missense_Mutation_p.E2313A|FLNB_uc003djl.2_Missense_Mutation_p.E2157A|FLNB_uc003djm.2_Missense_Mutation_p.E2144A	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	2337	Filamin 22.|Interaction with INPPL1.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CACGTGTCTGAGCTGGAGCCA	0.572													19	27	---	---	---	---	capture	Missense_Mutation	SNP	58145402	58145402	FLNB	3	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	5878	124
OR5H1	26341	broad.mit.edu	37	3	97852262	97852262	+	Missense_Mutation	SNP	T	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97852262T>A	uc011bgt.1	+	1	721	c.721T>A	c.(721-723)TGT>AGT	p.C241S		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						CTTTTCCACCTGTGGAGCCCA	0.408													3	148	---	---	---	---	capture	Missense_Mutation	SNP	97852262	97852262	OR5H1	3	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	11063	124
CPZ	8532	broad.mit.edu	37	4	8605776	8605776	+	Silent	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8605776C>T	uc003glm.2	+	4	696	c.570C>T	c.(568-570)TAC>TAT	p.Y190Y	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Silent_p.Y53Y|CPZ_uc003glo.2_Silent_p.Y179Y|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	190					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						ACCACTCCTACGCCCAGATGG	0.706													12	12	---	---	---	---	capture	Silent	SNP	8605776	8605776	CPZ	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3804	124
HCN1	348980	broad.mit.edu	37	5	45262443	45262443	+	Silent	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45262443C>T	uc003jok.2	-	8	2278	c.2253G>A	c.(2251-2253)CCG>CCA	p.P751P		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	751	Gln-rich.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GCTGCGGGGACGgctgctgtg	0.428													24	25	---	---	---	---	capture	Silent	SNP	45262443	45262443	HCN1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	6922	124
KCNN2	3781	broad.mit.edu	37	5	113740368	113740368	+	Silent	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:113740368C>T	uc003kqo.2	+	3	1273	c.816C>T	c.(814-816)GTC>GTT	p.V272V		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	272	Helical; Name=Segment S4; (Potential).					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TTGCCAGAGTCATGCTTTTAC	0.393													35	159	---	---	---	---	capture	Silent	SNP	113740368	113740368	KCNN2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	8001	124
MAT2B	27430	broad.mit.edu	37	5	162932707	162932707	+	Silent	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:162932707G>A	uc003lzk.2	+	1	123	c.15G>A	c.(13-15)GAG>GAA	p.E5E	MAT2B_uc003lzj.2_Intron|MAT2B_uc003lzl.1_Silent_p.E5E	NM_013283	NP_037415	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta isoform	5					extracellular polysaccharide biosynthetic process|methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol|methionine adenosyltransferase complex|nucleus	dTDP-4-dehydrorhamnose reductase activity|methionine adenosyltransferase regulator activity|protein binding			upper_aerodigestive_tract(1)	1	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TGGGGCGGGAGAAAGAGCTCT	0.706											OREG0017003	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	7	---	---	---	---	capture	Silent	SNP	162932707	162932707	MAT2B	5	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	9244	124
SLC17A1	6568	broad.mit.edu	37	6	25819769	25819769	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25819769G>A	uc003nfh.3	-	5	615	c.499C>T	c.(499-501)CGA>TGA	p.R167*	SLC17A1_uc011djy.1_RNA|SLC17A1_uc010jqb.1_Nonsense_Mutation_p.R165*|SLC17A1_uc010jqc.1_Nonsense_Mutation_p.R165*	NM_005074	NP_005065	Q14916	NPT1_HUMAN	solute carrier family 17 (sodium phosphate),	167					sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(3)|pancreas(1)	4						AGTCGGCCTCGTTCCAGGGGA	0.398													37	85	---	---	---	---	capture	Nonsense_Mutation	SNP	25819769	25819769	SLC17A1	6	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	14309	124
PGBD1	84547	broad.mit.edu	37	6	28269724	28269724	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28269724G>A	uc003nky.2	+	7	2463	c.2093G>A	c.(2092-2094)TGC>TAC	p.C698Y	PGBD1_uc003nkz.2_Missense_Mutation_p.C698Y	NM_032507	NP_115896	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	698					viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity			ovary(4)	4						ATCAGTCTGTGCTCCAATGCT	0.388													79	113	---	---	---	---	capture	Missense_Mutation	SNP	28269724	28269724	PGBD1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	11683	124
TREML2	79865	broad.mit.edu	37	6	41166020	41166020	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41166020G>A	uc010jxm.1	-	2	382	c.203C>T	c.(202-204)GCC>GTC	p.A68V		NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid	68	Ig-like V-type.|Extracellular (Potential).				T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCAGACTCGGGCAAAGCCAGG	0.572													4	201	---	---	---	---	capture	Missense_Mutation	SNP	41166020	41166020	TREML2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16356	124
RPF2	84154	broad.mit.edu	37	6	111329240	111329240	+	Splice_Site	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:111329240G>A	uc003pun.2	+	7	413	c.394_splice	c.e7-1	p.N132_splice	RPF2_uc003puo.2_Splice_Site_p.N69_splice	NM_032194	NP_115570	Q9H7B2	RPF2_HUMAN	brix domain containing 1							nucleolus	protein binding			ovary(2)	2						TTTTTTTTTAGAACAGTAAAT	0.229													7	61	---	---	---	---	capture	Splice_Site	SNP	111329240	111329240	RPF2	6	G	A	A	A	1	0	0	0	0	0	0	1	0	429	33	5	2	13439	124
AKAP9	10142	broad.mit.edu	37	7	91674419	91674419	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:91674419C>T	uc003ulg.2	+	21	5485	c.5260C>T	c.(5260-5262)CTT>TTT	p.L1754F	AKAP9_uc003ulf.2_Missense_Mutation_p.L1754F|AKAP9_uc003uli.2_Missense_Mutation_p.L1379F	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	1766					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCGCCATGTCCTTGGGATTCT	0.423			T	BRAF	papillary thyroid								5	223	---	---	---	---	capture	Missense_Mutation	SNP	91674419	91674419	AKAP9	7	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	459	124
PPP1R3A	5506	broad.mit.edu	37	7	113519263	113519263	+	Silent	SNP	A	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113519263A>G	uc010ljy.1	-	4	1915	c.1884T>C	c.(1882-1884)AAT>AAC	p.N628N		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	628					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						AAAGATAATCATTCCTCAAAA	0.388													68	168	---	---	---	---	capture	Silent	SNP	113519263	113519263	PPP1R3A	7	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	12272	124
TRPV6	55503	broad.mit.edu	37	7	142573411	142573411	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142573411G>A	uc003wbx.1	-	8	1148	c.932C>T	c.(931-933)ACG>ATG	p.T311M	TRPV6_uc003wbw.1_Missense_Mutation_p.T97M|TRPV6_uc010lou.1_Missense_Mutation_p.T182M	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	311	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CTTCACCGGCGTCTGGTCCAG	0.592													44	105	---	---	---	---	capture	Missense_Mutation	SNP	142573411	142573411	TRPV6	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16483	124
OR2F1	26211	broad.mit.edu	37	7	143657660	143657660	+	Silent	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143657660C>T	uc003wds.1	+	1	641	c.597C>T	c.(595-597)ATC>ATT	p.I199I		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	199	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)					AGGTCACCATCATGGTGTCTA	0.478													6	156	---	---	---	---	capture	Silent	SNP	143657660	143657660	OR2F1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	10900	124
CNTNAP2	26047	broad.mit.edu	37	7	146741054	146741054	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:146741054C>T	uc003weu.1	+	4	974	c.458C>T	c.(457-459)CCG>CTG	p.P153L		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	153	F5/8 type C.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTACAGCATCCGATTATTGCC	0.423										HNSCC(39;0.1)			74	173	---	---	---	---	capture	Missense_Mutation	SNP	146741054	146741054	CNTNAP2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3612	124
DLC1	10395	broad.mit.edu	37	8	12946050	12946050	+	Missense_Mutation	SNP	T	C	C			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:12946050T>C	uc003wwm.2	-	16	4682	c.4238A>G	c.(4237-4239)CAG>CGG	p.Q1413R	DLC1_uc003wwk.1_Missense_Mutation_p.Q976R|DLC1_uc003wwl.1_Missense_Mutation_p.Q1010R|DLC1_uc011kxx.1_Missense_Mutation_p.Q902R	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	1413	START.				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						TTGGACATACTGGTAAATTTC	0.423													80	137	---	---	---	---	capture	Missense_Mutation	SNP	12946050	12946050	DLC1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	4508	124
ADAM2	2515	broad.mit.edu	37	8	39607192	39607192	+	Silent	SNP	A	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:39607192A>G	uc003xnj.2	-	17	1944	c.1869T>C	c.(1867-1869)GAT>GAC	p.D623D	ADAM2_uc003xnk.2_Silent_p.D604D|ADAM2_uc011lck.1_Silent_p.D560D|ADAM2_uc003xnl.2_Silent_p.D467D	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	623	Extracellular (Potential).|EGF-like.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TTACACCTCTATCATTGCATT	0.294													38	108	---	---	---	---	capture	Silent	SNP	39607192	39607192	ADAM2	8	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	241	124
TTPA	7274	broad.mit.edu	37	8	63985639	63985639	+	Silent	SNP	T	C	C			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:63985639T>C	uc003xux.1	-	2	245	c.213A>G	c.(211-213)AAA>AAG	p.K71K		NM_000370	NP_000361	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	71					lipid metabolic process		transporter activity|vitamin E binding				0	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	TATAATAGTTTTTTAGTAACT	0.338													5	74	---	---	---	---	capture	Silent	SNP	63985639	63985639	TTPA	8	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	16618	124
RIMS2	9699	broad.mit.edu	37	8	105263256	105263256	+	Silent	SNP	G	A	A	rs143698299	by1000genomes	TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105263256G>A	uc003yls.2	+	27	3991	c.3750G>A	c.(3748-3750)CCG>CCA	p.P1250P	RIMS2_uc003ylp.2_Silent_p.P1232P|RIMS2_uc003ylw.2_Silent_p.P1239P|RIMS2_uc003ylq.2_Silent_p.P1046P|RIMS2_uc003ylr.2_Silent_p.P1071P	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1294	C2 2.				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCCAAGCACCGTATGTAAAAG	0.408										HNSCC(12;0.0054)			7	85	---	---	---	---	capture	Silent	SNP	105263256	105263256	RIMS2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	13260	124
CPSF1	29894	broad.mit.edu	37	8	145624415	145624415	+	Missense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145624415G>A	uc003zcj.2	-	16	1556	c.1481C>T	c.(1480-1482)CCC>CTC	p.P494L		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	494					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GTCCGGCTCGGGGCTGTTCTG	0.488													3	21	---	---	---	---	capture	Missense_Mutation	SNP	145624415	145624415	CPSF1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	3789	124
PGM5	5239	broad.mit.edu	37	9	70999452	70999452	+	Missense_Mutation	SNP	C	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:70999452C>A	uc004agr.2	+	3	792	c.563C>A	c.(562-564)CCA>CAA	p.P188Q		NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5	188					cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2						AAATTCAAACCATTCAGAGGT	0.378													39	52	---	---	---	---	capture	Missense_Mutation	SNP	70999452	70999452	PGM5	9	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	11704	124
WNK2	65268	broad.mit.edu	37	9	96079849	96079849	+	Silent	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96079849G>A	uc004ati.1	+	29	6675	c.6675G>A	c.(6673-6675)GCG>GCA	p.A2225A	WNK2_uc011lud.1_Silent_p.A2188A|WNK2_uc004atj.2_Silent_p.A2188A|WNK2_uc004atk.2_Silent_p.A1713A	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2225					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						TGCCCCCAGCGCCCGGCCCTC	0.647													15	37	---	---	---	---	capture	Silent	SNP	96079849	96079849	WNK2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17259	124
CXorf59	286464	broad.mit.edu	37	X	36103466	36103466	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:36103466C>T	uc004ddk.1	+	5	638	c.452C>T	c.(451-453)TCG>TTG	p.S151L		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	151						integral to membrane				central_nervous_system(1)	1						TCATCAACCTCGCCACCCCAA	0.338													50	71	---	---	---	---	capture	Missense_Mutation	SNP	36103466	36103466	CXorf59	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4075	124
FAM47C	442444	broad.mit.edu	37	X	37028621	37028621	+	Missense_Mutation	SNP	G	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37028621G>T	uc004ddl.1	+	1	2152	c.2138G>T	c.(2137-2139)AGT>ATT	p.S713I		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	713										ovary(3)	3						CGGGTGTCCAGTCTCCACGCG	0.647													37	55	---	---	---	---	capture	Missense_Mutation	SNP	37028621	37028621	FAM47C	23	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	5519	124
DGKK	139189	broad.mit.edu	37	X	50146548	50146548	+	Missense_Mutation	SNP	C	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50146548C>A	uc010njr.1	-	6	1186	c.1126G>T	c.(1126-1128)GAC>TAC	p.D376Y		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	376	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					CACTTGCAGTCTTTGCTTGCT	0.458													13	134	---	---	---	---	capture	Missense_Mutation	SNP	50146548	50146548	DGKK	23	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	4430	124
MED12	9968	broad.mit.edu	37	X	70342412	70342412	+	Missense_Mutation	SNP	G	C	C			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70342412G>C	uc004dyy.2	+	9	1502	c.1303G>C	c.(1303-1305)GTT>CTT	p.V435L	MED12_uc011mpq.1_Missense_Mutation_p.V435L|MED12_uc004dyz.2_Missense_Mutation_p.V435L|MED12_uc004dza.2_Missense_Mutation_p.V282L	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	435					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GGGACAGGCAGTTGAAGTTCG	0.468													46	40	---	---	---	---	capture	Missense_Mutation	SNP	70342412	70342412	MED12	23	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	9341	124
FGF16	8823	broad.mit.edu	37	X	76711875	76711875	+	Silent	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76711875C>T	uc011mqp.1	+	2	486	c.213C>T	c.(211-213)TAC>TAT	p.Y71Y		NM_003868	NP_003859	O43320	FGF16_HUMAN	fibroblast growth factor 16	162					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|metabolic process|organ morphogenesis|response to temperature stimulus	extracellular space	growth factor activity			lung(1)	1						GACAGTATTACGTGGCCCTGA	0.463													30	112	---	---	---	---	capture	Silent	SNP	76711875	76711875	FGF16	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5790	124
ATP7A	538	broad.mit.edu	37	X	77264612	77264612	+	Missense_Mutation	SNP	C	T	T			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77264612C>T	uc004ecx.3	+	7	1881	c.1721C>T	c.(1720-1722)ACG>ATG	p.T574M	ATP7A_uc004ecw.2_Missense_Mutation_p.T574M	NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	574	HMA 6.|Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						AGGGGAATGACGTGTGCCTCC	0.378													190	262	---	---	---	---	capture	Missense_Mutation	SNP	77264612	77264612	ATP7A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1181	124
TAF7L	54457	broad.mit.edu	37	X	100531023	100531023	+	Missense_Mutation	SNP	C	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100531023C>A	uc004ehb.2	-	11	1261	c.1249G>T	c.(1249-1251)GAT>TAT	p.D417Y	TAF7L_uc004eha.2_Missense_Mutation_p.D257Y	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	417	Potential.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						ATGATGAGATCCTTCTGTCTT	0.353													15	127	---	---	---	---	capture	Missense_Mutation	SNP	100531023	100531023	TAF7L	23	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	15421	124
SRPK3	26576	broad.mit.edu	37	X	153050273	153050273	+	Silent	SNP	A	G	G			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153050273A>G	uc004fil.2	+	12	1349	c.1317A>G	c.(1315-1317)GAA>GAG	p.E439E	SRPK3_uc004fik.2_Silent_p.E505E|SRPK3_uc010nul.2_Silent_p.E363E|SRPK3_uc004fin.2_Silent_p.E438E|SRPK3_uc004fim.2_Silent_p.E405E	NM_014370	NP_055185	Q9UPE1	SRPK3_HUMAN	serine arginine rich protein-specific kinase 3	439	Protein kinase.				cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity			pancreas(2)|lung(1)	3	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TCGGCGCCGAATACGGCCCCC	0.692													45	73	---	---	---	---	capture	Silent	SNP	153050273	153050273	SRPK3	23	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	15053	124
MTCP1	4515	broad.mit.edu	37	X	154294043	154294043	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154294043G>A	uc004fmz.2	-	3	753	c.127C>T	c.(127-129)CGA>TGA	p.R43*	MTCP1NB_uc004fmy.2_Intron	NM_001018025	NP_001018025	P56278	MTCP1_HUMAN	mature T-cell proliferation 1	43					cell proliferation					lung(1)	1	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGCTGGACTCGTGCCCTTAGG	0.458			T	TRA@	T cell prolymphocytic leukemia								59	78	---	---	---	---	capture	Nonsense_Mutation	SNP	154294043	154294043	MTCP1	23	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	9825	124
PTEN	5728	broad.mit.edu	37	10	89717704	89717704	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717704delC	uc001kfb.2	+	8	1760	c.729delC	c.(727-729)TTCfs	p.F243fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	243	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.F243fs*9(1)|p.R234fs*9(1)|p.F243S(1)|p.F243fs*13(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ACTTTGAGTTCCCTCAGCCGT	0.423		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			63	27	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89717704	89717704	PTEN	10	C	-	-	-	1	0	1	0	1	0	0	0	0	389	30	5	5	12633	124
BPTF	2186	broad.mit.edu	37	17	65889772	65889775	+	Frame_Shift_Del	DEL	GACT	-	-			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65889772_65889775delGACT	uc002jgf.2	+	6	2403_2406	c.2342_2345delGACT	c.(2341-2346)AGACTGfs	p.R781fs	BPTF_uc002jge.2_Frame_Shift_Del_p.R907fs|BPTF_uc010wqm.1_Frame_Shift_Del_p.R844fs	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	907_908	Interaction with MAZ.				brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCTACTCTGAGACTGACTATCACC	0.412													69	79	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	65889772	65889775	BPTF	17	GACT	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	1483	124
SMAD7	4092	broad.mit.edu	37	18	46447857	46447857	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:46447857delG	uc002ldg.2	-	4	1453	c.1166delC	c.(1165-1167)CCGfs	p.P389fs	SMAD7_uc002ldf.2_Frame_Shift_Del_p.P201fs|SMAD7_uc010xde.1_Frame_Shift_Del_p.P174fs	NM_005904	NP_005895	O15105	SMAD7_HUMAN	SMAD family member 7	389	MH2.				adherens junction assembly|artery morphogenesis|BMP signaling pathway|cellular protein complex localization|negative regulation of BMP signaling pathway|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of peptidyl-serine phosphorylation|negative regulation of peptidyl-threonine phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of ubiquitin-protein ligase activity|pathway-restricted SMAD protein phosphorylation|positive regulation of anti-apoptosis|positive regulation of cell-cell adhesion|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein stabilization|regulation of activin receptor signaling pathway|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	centrosome|cytosol|nucleolus|plasma membrane|transcription factor complex	activin binding|beta-catenin binding|I-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding				0	Colorectal(1;0.0518)					GCCCGTCCACGGCTGCTGCAT	0.582													20	34	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	46447857	46447857	SMAD7	18	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	14655	124
DTYMK	1841	broad.mit.edu	37	2	242617899	242617899	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242617899delG	uc002wbz.1	-	4	525	c.496delC	c.(496-498)CAGfs	p.Q166fs	DTYMK_uc010zpa.1_Frame_Shift_Del_p.Q142fs|DTYMK_uc010zpb.1_RNA|DTYMK_uc002wca.1_RNA|DTYMK_uc002wcb.1_5'Flank	NM_012145	NP_036277	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)	166					cell cycle|cell proliferation|nucleobase, nucleoside and nucleotide interconversion	cytosol	ATP binding|nucleoside phosphate kinase activity|thymidylate kinase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		TTCATGAGCTGGTGGAAACAC	0.582													100	140	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	242617899	242617899	DTYMK	2	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	4753	124
WDR1	9948	broad.mit.edu	37	4	10100717	10100718	+	In_Frame_Ins	INS	-	TGCTCC	TGCTCC			TCGA-12-1597-01	TCGA-12-1597-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:10100717_10100718insTGCTCC	uc003gmf.2	-	4	558_559	c.275_276insGGAGCA	c.(274-276)CAC>CAGGAGCAC	p.91_92insQE	WDR1_uc003gmg.2_Intron	NM_017491	NP_059830	O75083	WDR1_HUMAN	WD repeat-containing protein 1 isoform 1	91_92	WD 1.				platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding			ovary(2)|pancreas(1)	3				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		ACTTCAACAGGTGCTCCTTCTG	0.589													25	75	---	---	---	---	capture_indel	In_Frame_Ins	INS	10100717	10100718	WDR1	4	-	TGCTCC	TGCTCC	TGCTCC	1	0	1	1	0	0	0	0	0	568	44	5	5	17153	124
