Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FOXJ3	22887	broad.mit.edu	37	1	42693556	42693556	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:42693556G>A	uc001che.2	-	7	838	c.526C>T	c.(526-528)CGG>TGG	p.R176W	FOXJ3_uc001chf.2_Missense_Mutation_p.R176W|FOXJ3_uc001chg.2_Missense_Mutation_p.R176W|FOXJ3_uc001chh.1_Missense_Mutation_p.R176W	NM_014947	NP_055762	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	176					embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCCTTTACCCGTTCTACAGAT	0.393													67	90	---	---	---	---	capture	Missense_Mutation	SNP	42693556	42693556	FOXJ3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	5957	126
NSUN4	387338	broad.mit.edu	37	1	46810560	46810560	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46810560C>T	uc001cpr.1	+	2	290	c.181C>T	c.(181-183)CCA>TCA	p.P61S	NSUN4_uc010omc.1_Missense_Mutation_p.P12S|NSUN4_uc009vyf.1_5'UTR|NSUN4_uc009vyg.1_Missense_Mutation_p.P12S|NSUN4_uc001cpt.1_RNA|NSUN4_uc001cps.1_RNA	NM_199044	NP_950245	Q96CB9	NSUN4_HUMAN	NOL1/NOP2/Sun domain family 4 protein	61							methyltransferase activity				0	Acute lymphoblastic leukemia(166;0.155)					AGATCTTTGGCCATCAATCCG	0.488													4	169	---	---	---	---	capture	Missense_Mutation	SNP	46810560	46810560	NSUN4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10587	126
COL11A1	1301	broad.mit.edu	37	1	103487313	103487313	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:103487313C>A	uc001dul.2	-	9	1576	c.1258G>T	c.(1258-1260)GGT>TGT	p.G420C	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.G432C|COL11A1_uc001dun.2_Missense_Mutation_p.G381C|COL11A1_uc009weh.2_Missense_Mutation_p.G304C	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	420	Triple-helical region (interrupted).				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCATATGCACCATGGCCATTT	0.303													36	88	---	---	---	---	capture	Missense_Mutation	SNP	103487313	103487313	COL11A1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	3632	126
HSPA6	3310	broad.mit.edu	37	1	161495457	161495457	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161495457G>A	uc001gap.2	+	2	1669	c.1009G>A	c.(1009-1011)GTC>ATC	p.V337I	HSPA6_uc001gaq.2_Missense_Mutation_p.V337I	NM_002155	NP_002146	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	337					response to unfolded protein		ATP binding			skin(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TCATGACGTCGTCCTGGTGGG	0.597													33	26	---	---	---	---	capture	Missense_Mutation	SNP	161495457	161495457	HSPA6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7340	126
CFHR2	3080	broad.mit.edu	37	1	196927110	196927110	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196927110G>T	uc001gtq.1	+	4	597	c.520G>T	c.(520-522)GTT>TTT	p.V174F	CFHR2_uc001gtr.1_Missense_Mutation_p.V50F	NM_005666	NP_005657	P36980	FHR2_HUMAN	H factor (complement)-like 3 precursor	174	Sushi 3.					extracellular region				skin(2)|ovary(1)	3						AGGTTCATCAGTTGAGTACCA	0.403													70	89	---	---	---	---	capture	Missense_Mutation	SNP	196927110	196927110	CFHR2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	3251	126
YME1L1	10730	broad.mit.edu	37	10	27415646	27415646	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:27415646G>A	uc001iti.2	-	10	1281	c.1099C>T	c.(1099-1101)CTT>TTT	p.L367F	YME1L1_uc001itj.2_Missense_Mutation_p.L310F|YME1L1_uc010qdl.1_Missense_Mutation_p.L277F|YME1L1_uc009xkv.2_RNA	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1	367					protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						TTACCTCCAAGAATAGTAAAT	0.274													10	5	---	---	---	---	capture	Missense_Mutation	SNP	27415646	27415646	YME1L1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	17368	126
DRGX	644168	broad.mit.edu	37	10	50599244	50599244	+	Missense_Mutation	SNP	T	G	G			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50599244T>G	uc010qgq.1	-	2	113	c.113A>C	c.(112-114)CAG>CCG	p.Q38P		NM_001080520	NP_001073989	A6NNA5	DRGX_HUMAN	dorsal root ganglia homeobox	38					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GTTCCGGCGCTGTTTTCTACG	0.507													7	5	---	---	---	---	capture	Missense_Mutation	SNP	50599244	50599244	DRGX	10	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	4718	126
MUC5B	727897	broad.mit.edu	37	11	1274084	1274084	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1274084G>A	uc009ycr.1	+	54	16183	c.16057G>A	c.(16057-16059)GTG>ATG	p.V5353M	MUC5B_uc001ltb.2_Missense_Mutation_p.V5034M	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	5031					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGCCAGGTGCGTGGGTGACAA	0.632													15	17	---	---	---	---	capture	Missense_Mutation	SNP	1274084	1274084	MUC5B	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9889	126
MS4A1	931	broad.mit.edu	37	11	60231772	60231772	+	Silent	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60231772C>T	uc001npp.2	+	5	707	c.291C>T	c.(289-291)TCC>TCT	p.S97S	MS4A1_uc009ymy.1_3'UTR|MS4A1_uc001npq.2_Silent_p.S97S|MS4A1_uc009yna.2_Silent_p.S97S|MS4A1_uc009ymz.2_Silent_p.S97S|MS4A1_uc010rlc.1_Intron	NM_152866	NP_690605	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member	97	Helical; (Potential).				B cell activation|immune response	integral to plasma membrane				ovary(3)|lung(2)	5					Ibritumomab(DB00078)|Rituximab(DB00073)|Tositumomab(DB00081)	ATATTATTTCCGGATCACTCC	0.438													17	29	---	---	---	---	capture	Silent	SNP	60231772	60231772	MS4A1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9764	126
PC	5091	broad.mit.edu	37	11	66637883	66637883	+	Missense_Mutation	SNP	A	C	C			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66637883A>C	uc001ojn.1	-	7	842	c.793T>G	c.(793-795)TGC>GGC	p.C265G	PC_uc001ojo.1_Missense_Mutation_p.C265G|PC_uc001ojp.1_Missense_Mutation_p.C265G	NM_022172	NP_071504	P11498	PYC_HUMAN	pyruvate carboxylase precursor	265	ATP-grasp.|Biotin carboxylation.				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	TGGATGGAGCAGTCTCGCTCG	0.602													23	40	---	---	---	---	capture	Missense_Mutation	SNP	66637883	66637883	PC	11	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	11400	126
IQSEC3	440073	broad.mit.edu	37	12	247990	247990	+	Silent	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:247990C>T	uc001qhw.1	+	1	558	c.552C>T	c.(550-552)GAC>GAT	p.D184D	IQSEC3_uc001qhu.1_Silent_p.D184D|IQSEC3_uc001qht.1_Silent_p.D269D|uc001qhv.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	487					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CTTTCCGGGACGTCACGGTGC	0.577													13	14	---	---	---	---	capture	Silent	SNP	247990	247990	IQSEC3	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7742	126
APOBEC1	339	broad.mit.edu	37	12	7805403	7805403	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7805403C>T	uc001qtb.2	-	3	107	c.73G>A	c.(73-75)GTC>ATC	p.V25I	APOBEC1_uc001qtc.2_5'UTR|APOBEC1_uc010sgf.1_Missense_Mutation_p.V25I	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	25					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						TCATAGAAGACGTCAAACTCC	0.483													29	62	---	---	---	---	capture	Missense_Mutation	SNP	7805403	7805403	APOBEC1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	780	126
PKP2	5318	broad.mit.edu	37	12	33031888	33031888	+	Missense_Mutation	SNP	C	T	T	rs149542398	byFrequency	TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:33031888C>T	uc001rlj.3	-	2	417	c.302G>A	c.(301-303)CGT>CAT	p.R101H	PKP2_uc001rlk.3_Missense_Mutation_p.R101H|PKP2_uc010skj.1_Missense_Mutation_p.R101H	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	101					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AACAGGGGAACGGCCTCCAAC	0.378													51	73	---	---	---	---	capture	Missense_Mutation	SNP	33031888	33031888	PKP2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11888	126
PDZRN4	29951	broad.mit.edu	37	12	41967460	41967460	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:41967460G>A	uc010skn.1	+	10	2350	c.2282G>A	c.(2281-2283)CGT>CAT	p.R761H	PDZRN4_uc001rmq.3_Missense_Mutation_p.R702H|PDZRN4_uc009zjz.2_Missense_Mutation_p.R700H|PDZRN4_uc001rmr.2_Missense_Mutation_p.R587H	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	960	Poly-Arg.						ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CGCCGTCGCCGTGAGTTCATG	0.527													29	42	---	---	---	---	capture	Missense_Mutation	SNP	41967460	41967460	PDZRN4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11613	126
ORAI1	84876	broad.mit.edu	37	12	122079482	122079482	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122079482C>T	uc010szz.1	+	3	1032	c.839C>T	c.(838-840)GCC>GTC	p.A280V		NM_032790	NP_116179	Q96D31	CRCM1_HUMAN	calcium release-activated calcium channel	280	Cytoplasmic (Potential).				platelet activation|positive regulation of calcium ion transport	integral to plasma membrane	protein binding|store-operated calcium channel activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		GCGGAGTTTGCCCGCTTACAG	0.607													4	121	---	---	---	---	capture	Missense_Mutation	SNP	122079482	122079482	ORAI1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11161	126
FOXO1	2308	broad.mit.edu	37	13	41134348	41134348	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:41134348C>A	uc001uxl.3	-	2	1665	c.1280G>T	c.(1279-1281)GGC>GTC	p.G427V	FOXO1_uc010acc.1_Missense_Mutation_p.G242V	NM_002015	NP_002006	Q12778	FOXO1_HUMAN	forkhead box O1	427					anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		GCTGGATTGGCCATATGTATA	0.488													4	150	---	---	---	---	capture	Missense_Mutation	SNP	41134348	41134348	FOXO1	13	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	5967	126
FSCB	84075	broad.mit.edu	37	14	44974303	44974303	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:44974303C>T	uc001wvn.2	-	1	2197	c.1888G>A	c.(1888-1890)GCC>ACC	p.A630T		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	630	Ala-rich.					cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		TCAGCGGGGGCCTCCTCAGCT	0.642													4	30	---	---	---	---	capture	Missense_Mutation	SNP	44974303	44974303	FSCB	14	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6009	126
CSPG4	1464	broad.mit.edu	37	15	75974722	75974722	+	Missense_Mutation	SNP	C	T	T	rs143855050	byFrequency;by1000genomes	TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75974722C>T	uc002baw.2	-	8	4955	c.4862G>A	c.(4861-4863)CGT>CAT	p.R1621H		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	1621	Extracellular (Potential).|Cysteine-containing.|Neurite growth inhibition (By similarity).|CSPG 11.				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						CCGCACCACACGGTAGAGCAG	0.662													45	51	---	---	---	---	capture	Missense_Mutation	SNP	75974722	75974722	CSPG4	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3925	126
CHRNB4	1143	broad.mit.edu	37	15	78921864	78921864	+	Silent	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:78921864G>A	uc002bed.1	-	5	895	c.783C>T	c.(781-783)GGC>GGT	p.G261G	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Silent_p.G79G	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	261	Cytoplasmic (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						TCATCTTCTCGCCGCAGTCGG	0.567													57	57	---	---	---	---	capture	Silent	SNP	78921864	78921864	CHRNB4	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3358	126
CACNG3	10368	broad.mit.edu	37	16	24372858	24372858	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24372858C>T	uc002dmf.2	+	4	1822	c.622C>T	c.(622-624)CGA>TGA	p.R208*		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	208					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		TCAGCAGTTACGAGCCAAATC	0.488													68	102	---	---	---	---	capture	Nonsense_Mutation	SNP	24372858	24372858	CACNG3	16	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	2534	126
ABCC11	85320	broad.mit.edu	37	16	48210869	48210869	+	Silent	SNP	G	A	A	rs143002804		TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:48210869G>A	uc002eff.1	-	24	3854	c.3504C>T	c.(3502-3504)CAC>CAT	p.H1168H	ABCC11_uc002efg.1_Silent_p.H1168H|ABCC11_uc002efh.1_Silent_p.H1168H|ABCC11_uc010cbg.1_RNA	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	1168	ABC transporter 2.|Cytoplasmic (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				CCACCACTTCGTGGCCGCGGA	0.562									Cerumen_Type				9	44	---	---	---	---	capture	Silent	SNP	48210869	48210869	ABCC11	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	51	126
MAPK7	5598	broad.mit.edu	37	17	19284297	19284297	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19284297C>T	uc002gvn.2	+	4	1161	c.775C>T	c.(775-777)CGC>TGC	p.R259C	B9D1_uc010cqm.1_5'Flank|B9D1_uc002gvl.3_5'Flank|MAPK7_uc002gvo.2_Missense_Mutation_p.R120C|MAPK7_uc002gvq.2_Missense_Mutation_p.R259C|MAPK7_uc002gvp.2_Missense_Mutation_p.R259C	NM_139033	NP_620602	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7 isoform 1	259	Necessary for oligomerization (By similarity).|Protein kinase.				cell cycle|cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					GCTGGCCCGGCGCCAGCTCTT	0.567													24	44	---	---	---	---	capture	Missense_Mutation	SNP	19284297	19284297	MAPK7	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9195	126
GAS2L2	246176	broad.mit.edu	37	17	34072485	34072485	+	Silent	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34072485C>T	uc002hjv.1	-	6	2059	c.2031G>A	c.(2029-2031)CCG>CCA	p.P677P		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	677					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGAGCCAGTCGGGGCTGCCT	0.612													115	133	---	---	---	---	capture	Silent	SNP	34072485	34072485	GAS2L2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	6187	126
LHX1	3975	broad.mit.edu	37	17	35297618	35297618	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35297618C>G	uc002hnh.1	+	2	1198	c.202C>G	c.(202-204)CAG>GAG	p.Q68E	LHX1_uc010cux.1_5'UTR	NM_005568	NP_005559	P48742	LHX1_HUMAN	LIM homeobox protein 1	68	LIM zinc-binding 2.				cerebellar Purkinje cell differentiation|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation|cervix development|comma-shaped body morphogenesis|dorsal/ventral pattern formation|ectoderm formation|embryonic pattern specification|embryonic retina morphogenesis in camera-type eye|embryonic viscerocranium morphogenesis|endoderm formation|forebrain regionalization|head development|motor axon guidance|negative regulation of transcription, DNA-dependent|nephric duct morphogenesis|nephron tubule epithelial cell differentiation|neuron migration|oviduct epithelium development|paramesonephric duct development|positive regulation of anterior head development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of embryonic development|positive regulation of gastrulation|positive regulation of transcription, DNA-dependent|post-embryonic development|primitive streak formation|renal vesicle morphogenesis|retina layer formation|S-shaped body morphogenesis|spinal cord association neuron differentiation|transcription from RNA polymerase II promoter|ureteric bud development|uterine epithelium development|vagina development	nucleus|protein complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(25;0.00607)				AGGCTGCGCTCAGGGCATCTC	0.448													2	13	---	---	---	---	capture	Missense_Mutation	SNP	35297618	35297618	LHX1	17	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	8690	126
JUP	3728	broad.mit.edu	37	17	39919367	39919367	+	Silent	SNP	G	A	A	rs77375949	by1000genomes	TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39919367G>A	uc002hxq.2	-	8	1642	c.1365C>T	c.(1363-1365)GCC>GCT	p.A455A	JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Silent_p.A455A|JUP_uc002hxs.2_Silent_p.A455A	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin	455	ARM 6.				adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GAGCGCAGACGGCAGGCTCCG	0.607													39	47	---	---	---	---	capture	Silent	SNP	39919367	39919367	JUP	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7895	126
C17orf46	124783	broad.mit.edu	37	17	43333194	43333194	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43333194G>A	uc002iis.1	-	4	451	c.355C>T	c.(355-357)CCC>TCC	p.P119S	LOC100133991_uc010dah.2_Intron|C17orf46_uc010wjk.1_Missense_Mutation_p.P98S	NM_152343	NP_689556	Q96LK8	CQ046_HUMAN	hypothetical protein LOC124783	119										large_intestine(1)|ovary(1)	2						TGTGGCGTGGGCAGCCCCATG	0.557													4	222	---	---	---	---	capture	Missense_Mutation	SNP	43333194	43333194	C17orf46	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1842	126
HOXB1	3211	broad.mit.edu	37	17	46607745	46607745	+	Silent	SNP	G	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46607745G>T	uc002ink.1	-	1	528	c.522C>A	c.(520-522)ACC>ACA	p.T174T		NM_002144	NP_002135	P14653	HXB1_HUMAN	homeobox B1	174						nucleus	protein domain specific binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GGGCCGTGGGGGTGTTAGGTT	0.592													16	31	---	---	---	---	capture	Silent	SNP	46607745	46607745	HOXB1	17	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	7224	126
CD300C	10871	broad.mit.edu	37	17	72539125	72539125	+	Silent	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72539125G>A	uc002jky.1	-	3	763	c.402C>T	c.(400-402)GCC>GCT	p.A134A		NM_006678	NP_006669	Q08708	CLM6_HUMAN	CD300C antigen precursor	134	Pro-rich.|Extracellular (Potential).				cellular defense response	integral to plasma membrane	transmembrane receptor activity				0						TGGTCGTCCCGGCTGTGGGTG	0.577													41	67	---	---	---	---	capture	Silent	SNP	72539125	72539125	CD300C	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2968	126
C18orf21	83608	broad.mit.edu	37	18	33554930	33554930	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:33554930C>T	uc002kzc.2	+	3	276	c.172C>T	c.(172-174)CGT>TGT	p.R58C	C18orf21_uc002kzd.2_5'UTR	NM_031446	NP_113634	Q32NC0	CR021_HUMAN	chromosome 18 open reading frame 21	58											0						CTCTCGAGTGCGTCTCAAACC	0.373													66	86	---	---	---	---	capture	Missense_Mutation	SNP	33554930	33554930	C18orf21	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1881	126
MUC16	94025	broad.mit.edu	37	19	9062926	9062926	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9062926C>T	uc002mkp.2	-	3	24724	c.24520G>A	c.(24520-24522)GTG>ATG	p.V8174M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8176	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTGGTGACACTGTGAGCTGA	0.502													48	116	---	---	---	---	capture	Missense_Mutation	SNP	9062926	9062926	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	9883	126
TMEM38A	79041	broad.mit.edu	37	19	16790904	16790904	+	Silent	SNP	C	T	T	rs144587502		TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16790904C>T	uc002nes.2	+	2	325	c.234C>T	c.(232-234)ATC>ATT	p.I78I		NM_024074	NP_076979	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	78	Cytoplasmic (Potential).					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			central_nervous_system(2)|ovary(1)	3						AGCCACTGATCGATTACTTCA	0.602													30	89	---	---	---	---	capture	Silent	SNP	16790904	16790904	TMEM38A	19	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	16042	126
CCNE1	898	broad.mit.edu	37	19	30313489	30313489	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:30313489C>G	uc002nsn.2	+	11	1272	c.1089C>G	c.(1087-1089)CAC>CAG	p.H363Q	CCNE1_uc002nso.2_Missense_Mutation_p.H348Q|CCNE1_uc002nsp.2_Missense_Mutation_p.H110Q	NM_001238	NP_001229	P24864	CCNE1_HUMAN	cyclin E1 isoform 1	363					androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity			lung(2)	2	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			TACAGACCCACAGAGACAGCT	0.428													86	207	---	---	---	---	capture	Missense_Mutation	SNP	30313489	30313489	CCNE1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	220	17	4	4	2891	126
ZNF569	148266	broad.mit.edu	37	19	37904887	37904887	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37904887G>C	uc002ogi.2	-	6	1231	c.673C>G	c.(673-675)CAC>GAC	p.H225D	ZNF569_uc002ogh.2_Missense_Mutation_p.H66D|ZNF569_uc002ogj.2_Missense_Mutation_p.H249D	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	225	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTTCCTTGTGACTGAAGGCT	0.348													51	118	---	---	---	---	capture	Missense_Mutation	SNP	37904887	37904887	ZNF569	19	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	17879	126
EML2	24139	broad.mit.edu	37	19	46116829	46116829	+	Silent	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46116829G>A	uc002pcn.2	-	18	1829	c.1794C>T	c.(1792-1794)CAC>CAT	p.H598H	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Silent_p.H482H|EML2_uc010xxl.1_Silent_p.H745H|EML2_uc010xxm.1_Silent_p.H799H	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	598	WD 10.				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		AGCTAAACAGGTGAACTTTGC	0.572													42	108	---	---	---	---	capture	Silent	SNP	46116829	46116829	EML2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	5052	126
PLB1	151056	broad.mit.edu	37	2	28741363	28741363	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:28741363C>A	uc002rmb.1	+	3	148	c.148C>A	c.(148-150)CCA>ACA	p.P50T	PLB1_uc010ezj.1_Missense_Mutation_p.P50T	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	50	4 X 308-326 AA approximate repeats.|Extracellular (Potential).|1.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					CCCATGCAACCCAAATAAATT	0.428													57	106	---	---	---	---	capture	Missense_Mutation	SNP	28741363	28741363	PLB1	2	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	11927	126
HCK	3055	broad.mit.edu	37	20	30681787	30681787	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30681787T>C	uc002wxh.2	+	11	1385	c.1214T>C	c.(1213-1215)GTC>GCC	p.V405A	HCK_uc010gdy.2_Missense_Mutation_p.V384A|HCK_uc002wxi.2_Missense_Mutation_p.V383A	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	405	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	p.P405S(1)		lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTGGCCCGGGTCATTGAGGAC	0.552													3	157	---	---	---	---	capture	Missense_Mutation	SNP	30681787	30681787	HCK	20	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	6920	126
C20orf132	140699	broad.mit.edu	37	20	35752057	35752057	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35752057C>T	uc010zvu.1	-	17	2052	c.1961G>A	c.(1960-1962)GGC>GAC	p.G654D	C20orf132_uc002xgk.2_Missense_Mutation_p.G276D	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1	55											0		Myeloproliferative disorder(115;0.00878)				TGTGTACAGGCCACTTGGGAT	0.408													53	83	---	---	---	---	capture	Missense_Mutation	SNP	35752057	35752057	C20orf132	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2068	126
HNF4A	3172	broad.mit.edu	37	20	43042366	43042366	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43042366C>T	uc002xma.2	+	4	507	c.418C>T	c.(418-420)CGA>TGA	p.R140*	HNF4A_uc002xlt.2_Nonsense_Mutation_p.R118*|HNF4A_uc002xlu.2_Nonsense_Mutation_p.R118*|HNF4A_uc002xlv.2_Nonsense_Mutation_p.R118*|HNF4A_uc002xly.2_Nonsense_Mutation_p.R140*|HNF4A_uc002xlz.2_Nonsense_Mutation_p.R140*|HNF4A_uc010ggq.2_Nonsense_Mutation_p.R133*	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	140					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GATCAGCACTCGAAGGTCAAG	0.632													13	20	---	---	---	---	capture	Nonsense_Mutation	SNP	43042366	43042366	HNF4A	20	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	7178	126
LIMK2	3985	broad.mit.edu	37	22	31658176	31658176	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31658176G>A	uc003akh.2	+	6	753	c.608G>A	c.(607-609)CGC>CAC	p.R203H	LIMK2_uc003akg.2_Missense_Mutation_p.R120H|LIMK2_uc003aki.2_Intron|LIMK2_uc003akj.2_Missense_Mutation_p.R182H|LIMK2_uc003akk.2_Missense_Mutation_p.R182H|LIMK2_uc011aln.1_Missense_Mutation_p.R120H	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	203	PDZ.					mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						CCTGGGGACCGCATCCTGGAG	0.547													4	207	---	---	---	---	capture	Missense_Mutation	SNP	31658176	31658176	LIMK2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8722	126
STK32B	55351	broad.mit.edu	37	4	5461833	5461833	+	Silent	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:5461833C>T	uc003gih.1	+	9	851	c.787C>T	c.(787-789)CTG>TTG	p.L263L	STK32B_uc010ida.1_Silent_p.L216L	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B	263	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						ACTGCAGCTCCTGACCAAGGA	0.552											OREG0016061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	61	---	---	---	---	capture	Silent	SNP	5461833	5461833	STK32B	4	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	15188	126
ADH1B	125	broad.mit.edu	37	4	100232699	100232699	+	Missense_Mutation	SNP	A	C	C			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100232699A>C	uc003hus.3	-	7	1027	c.943T>G	c.(943-945)TGG>GGG	p.W315G	ADH1A_uc011ceg.1_Intron|ADH1B_uc003hut.3_Missense_Mutation_p.W275G|ADH1B_uc011ceh.1_Missense_Mutation_p.W160G|ADH1B_uc011cei.1_Missense_Mutation_p.W275G	NM_000668	NP_000659	P00325	ADH1B_HUMAN	class I alcohol dehydrogenase, beta subunit	315					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|zinc ion binding			ovary(1)|breast(1)	2				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Fomepizole(DB01213)|NADH(DB00157)	GCCCCCTTCCAGGTGCGTCCA	0.383													112	136	---	---	---	---	capture	Missense_Mutation	SNP	100232699	100232699	ADH1B	4	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	308	126
TACR3	6870	broad.mit.edu	37	4	104640358	104640358	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:104640358G>A	uc003hxe.1	-	1	618	c.475C>T	c.(475-477)CGC>TGC	p.R159C		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	159	Extracellular (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TTCTGGAAGCGGCAGTAGTTG	0.542													22	27	---	---	---	---	capture	Missense_Mutation	SNP	104640358	104640358	TACR3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15395	126
VEGFC	7424	broad.mit.edu	37	4	177650867	177650867	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:177650867G>A	uc003ius.1	-	2	611	c.181C>T	c.(181-183)CGG>TGG	p.R61W		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	61					angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		GACACAGACCGTAACTGCTCC	0.408													37	46	---	---	---	---	capture	Missense_Mutation	SNP	177650867	177650867	VEGFC	4	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	17034	126
PLEKHG4B	153478	broad.mit.edu	37	5	140705	140705	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140705C>T	uc003jak.2	+	1	333	c.283C>T	c.(283-285)CAG>TAG	p.Q95*		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	95					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CAGAGGGGCCCAGGCTGCAGC	0.662													11	11	---	---	---	---	capture	Nonsense_Mutation	SNP	140705	140705	PLEKHG4B	5	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	11975	126
SLC6A19	340024	broad.mit.edu	37	5	1216997	1216997	+	Silent	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1216997C>T	uc003jbw.3	+	8	1166	c.1110C>T	c.(1108-1110)TCC>TCT	p.S370S		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	370	Extracellular (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GCAACGCCTCCGACCCCGCGG	0.627													84	190	---	---	---	---	capture	Silent	SNP	1216997	1216997	SLC6A19	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14574	126
SLIT3	6586	broad.mit.edu	37	5	168310294	168310294	+	Missense_Mutation	SNP	C	T	T	rs138901310		TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168310294C>T	uc003mab.2	-	5	881	c.461G>A	c.(460-462)CGC>CAC	p.R154H	SLIT3_uc010jjg.2_Missense_Mutation_p.R154H|SLIT3_uc010jji.2_Missense_Mutation_p.R154H	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	154	LRR 4.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTGATGCCGCGGAACGCCTT	0.502													50	80	---	---	---	---	capture	Missense_Mutation	SNP	168310294	168310294	SLIT3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14633	126
MUC21	394263	broad.mit.edu	37	6	30954349	30954349	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30954349A>G	uc003nsh.2	+	2	648	c.397A>G	c.(397-399)AGC>GGC	p.S133G	MUC21_uc003nsi.1_RNA	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor	133	Ser-rich.|7.|28 X 15 AA approximate tandem repeats.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CAGTGGGGCCAGCACAGCCAC	0.612													3	109	---	---	---	---	capture	Missense_Mutation	SNP	30954349	30954349	MUC21	6	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9887	126
TFAP2D	83741	broad.mit.edu	37	6	50696983	50696983	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:50696983C>T	uc003paf.2	+	5	1353	c.841C>T	c.(841-843)CGG>TGG	p.R281W	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	281	H-S-H (helix-span-helix), dimerization.						DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					AGCAGGAAGACGGAAAGCAGC	0.423													90	121	---	---	---	---	capture	Missense_Mutation	SNP	50696983	50696983	TFAP2D	6	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	15675	126
EPB41L2	2037	broad.mit.edu	37	6	131277174	131277174	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:131277174C>G	uc003qch.2	-	2	634	c.452G>C	c.(451-453)AGC>ACC	p.S151T	EPB41L2_uc003qcg.1_Missense_Mutation_p.S151T|EPB41L2_uc011eby.1_Missense_Mutation_p.S151T|EPB41L2_uc003qci.2_Missense_Mutation_p.S151T|EPB41L2_uc010kfk.2_Missense_Mutation_p.S151T|EPB41L2_uc010kfl.1_Missense_Mutation_p.S151T	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	151					cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TTCTTCCTTGCTCACTGAGGG	0.408													232	347	---	---	---	---	capture	Missense_Mutation	SNP	131277174	131277174	EPB41L2	6	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	5108	126
C6orf118	168090	broad.mit.edu	37	6	165715366	165715366	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:165715366C>T	uc003qum.3	-	2	481	c.445G>A	c.(445-447)GTG>ATG	p.V149M	C6orf118_uc011egi.1_RNA	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN	hypothetical protein LOC168090	149											0		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		ACAGCCTCCACTGGAAGGAAA	0.627													91	116	---	---	---	---	capture	Missense_Mutation	SNP	165715366	165715366	C6orf118	6	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	2300	126
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			836	133	---	---	---	---	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	126
EGFR	1956	broad.mit.edu	37	7	55225428	55225428	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55225428G>T	uc003tqk.2	+	11	1526	c.1280G>T	c.(1279-1281)CGC>CTC	p.R427L	EGFR_uc003tqi.2_Missense_Mutation_p.R427L|EGFR_uc003tqj.2_Missense_Mutation_p.R427L|EGFR_uc010kzg.1_Missense_Mutation_p.R382L|EGFR_uc011kco.1_Missense_Mutation_p.R374L|EGFR_uc011kcp.1_RNA|EGFR_uc011kcq.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	427	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GAAATCATACGCGGCAGGACC	0.368		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			19	961	---	---	---	---	capture	Missense_Mutation	SNP	55225428	55225428	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	4922	126
CNPY4	245812	broad.mit.edu	37	7	99717380	99717380	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99717380C>T	uc003uto.2	+	1	116	c.13C>T	c.(13-15)CGG>TGG	p.R5W	TAF6_uc003uti.2_5'Flank|TAF6_uc003utk.2_5'Flank|TAF6_uc011kji.1_5'UTR|TAF6_uc003utj.2_5'Flank|TAF6_uc003utl.2_5'Flank|TAF6_uc003utm.2_5'Flank|TAF6_uc003utn.1_5'Flank	NM_152755	NP_689968	Q8N129	CNPY4_HUMAN	canopy 4 homolog precursor	5						extracellular region					0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGGACCTGTGCGGTTGGGAAT	0.542													34	100	---	---	---	---	capture	Missense_Mutation	SNP	99717380	99717380	CNPY4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3595	126
SPDYE6	729597	broad.mit.edu	37	7	101989079	101989079	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:101989079G>T	uc011kkp.1	-	6	1215	c.794C>A	c.(793-795)TCC>TAC	p.S265Y	SPDYE6_uc003uzb.2_Missense_Mutation_p.S121Y	NM_001146210	NP_001139682	P0CI01	SPDE6_HUMAN	speedy homolog E6	265											0						GTTTTGTTTGGAGTCCTCGTC	0.557													57	447	---	---	---	---	capture	Missense_Mutation	SNP	101989079	101989079	SPDYE6	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	14925	126
SPAM1	6677	broad.mit.edu	37	7	123594466	123594466	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123594466G>A	uc003vld.2	+	4	1244	c.842G>A	c.(841-843)CGA>CAA	p.R281Q	SPAM1_uc003vle.2_Missense_Mutation_p.R281Q|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.R281Q|SPAM1_uc010lku.2_Missense_Mutation_p.R281Q	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	281					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	GTGCGCAATCGAGTTCGGGAA	0.428													52	147	---	---	---	---	capture	Missense_Mutation	SNP	123594466	123594466	SPAM1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14878	126
FLNC	2318	broad.mit.edu	37	7	128491526	128491526	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128491526G>A	uc003vnz.3	+	35	5895	c.5686G>A	c.(5686-5688)GTG>ATG	p.V1896M	FLNC_uc003voa.3_Missense_Mutation_p.V1863M	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1896	Filamin 17.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GTCACTGGCCGTGGAGGGCCC	0.622													53	113	---	---	---	---	capture	Missense_Mutation	SNP	128491526	128491526	FLNC	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5879	126
SLC13A4	26266	broad.mit.edu	37	7	135376342	135376342	+	Silent	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:135376342G>A	uc003vta.2	-	12	1961	c.1272C>T	c.(1270-1272)CTC>CTT	p.L424L	SLC13A4_uc003vtb.2_Silent_p.L425L|PL-5283_uc003vsz.3_RNA	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate	424	Helical; (Potential).					integral to plasma membrane	sodium:sulfate symporter activity				0						GAATGAGGAAGAGGAGGAAGC	0.478													35	95	---	---	---	---	capture	Silent	SNP	135376342	135376342	SLC13A4	7	G	A	A	A	1	0	0	0	0	0	0	0	1	418	33	2	2	14287	126
CLU	1191	broad.mit.edu	37	8	27456003	27456003	+	Silent	SNP	C	T	T	rs144959547	byFrequency	TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:27456003C>T	uc003xfw.1	-	7	1372	c.1314G>A	c.(1312-1314)GCG>GCA	p.A438A	CLU_uc010lux.1_Silent_p.A303A|CLU_uc003xfx.1_Silent_p.A438A|CLU_uc003xfy.1_Silent_p.A449A|CLU_uc003xfz.1_Silent_p.A490A	NM_203339	NP_976084	P10909	CLUS_HUMAN	clusterin isoform 2	438					chaperone-mediated protein folding|complement activation, classical pathway|innate immune response|lipid metabolic process|negative regulation of apoptosis|negative regulation of protein homooligomerization|platelet activation|platelet degranulation|positive regulation of NF-kappaB transcription factor activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|response to misfolded protein|response to virus|reverse cholesterol transport	chromaffin granule|cytosol|endoplasmic reticulum|microsome|mitochondrial membrane|nucleus|perinuclear region of cytoplasm|platelet alpha granule lumen|spherical high-density lipoprotein particle	misfolded protein binding|ubiquitin protein ligase binding			ovary(2)	2		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		ATTCCTGCAGCGCTTTCTCCG	0.542													4	136	---	---	---	---	capture	Silent	SNP	27456003	27456003	CLU	8	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3533	126
ZBTB10	65986	broad.mit.edu	37	8	81431744	81431744	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:81431744G>T	uc003ybx.3	+	6	3195	c.2597G>T	c.(2596-2598)TGT>TTT	p.C866F	ZBTB10_uc003ybv.3_Missense_Mutation_p.C574F|ZBTB10_uc003ybw.3_Missense_Mutation_p.C842F|ZBTB10_uc010lzt.2_Missense_Mutation_p.C864F	NM_001105539	NP_001099009	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10 isoform	866					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			lung(1)	1	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			GGAGAAGTTTGTATGTCTCTA	0.408													10	13	---	---	---	---	capture	Missense_Mutation	SNP	81431744	81431744	ZBTB10	8	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	17403	126
TAF1L	138474	broad.mit.edu	37	9	32630679	32630679	+	Silent	SNP	A	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32630679A>T	uc003zrg.1	-	1	4989	c.4899T>A	c.(4897-4899)CTT>CTA	p.L1633L	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1633					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TATCCTTCTCAAGTTGAGTCA	0.448													115	170	---	---	---	---	capture	Silent	SNP	32630679	32630679	TAF1L	9	A	T	T	T	1	0	0	0	0	0	0	0	1	54	5	4	4	15411	126
OR13C9	286362	broad.mit.edu	37	9	107379535	107379535	+	Silent	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107379535G>A	uc011lvr.1	-	1	951	c.951C>T	c.(949-951)AGC>AGT	p.S317S		NM_001001956	NP_001001956	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C,	317	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCATTCACTTGCTAAAGAACC	0.353													110	182	---	---	---	---	capture	Silent	SNP	107379535	107379535	OR13C9	9	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	10843	126
SVEP1	79987	broad.mit.edu	37	9	113173765	113173765	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113173765G>A	uc010mtz.2	-	37	6563	c.6226C>T	c.(6226-6228)CCC>TCC	p.P2076S	SVEP1_uc010mty.2_Missense_Mutation_p.P2S	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	2076	Sushi 11.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ATACAACGGGGCATGTCTTGA	0.483													3	49	---	---	---	---	capture	Missense_Mutation	SNP	113173765	113173765	SVEP1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15308	126
ADAMTS13	11093	broad.mit.edu	37	9	136302931	136302931	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136302931G>A	uc004cdv.3	+	13	1942	c.1498G>A	c.(1498-1500)GAC>AAC	p.D500N	ADAMTS13_uc004cdp.3_Intron|ADAMTS13_uc004cdt.1_Missense_Mutation_p.D500N|ADAMTS13_uc004cdu.1_Missense_Mutation_p.D469N|ADAMTS13_uc004cdw.3_Missense_Mutation_p.D500N|ADAMTS13_uc004cdx.3_Missense_Mutation_p.D469N|ADAMTS13_uc004cdy.1_RNA|ADAMTS13_uc004cdz.3_Missense_Mutation_p.D170N|ADAMTS13_uc004cds.1_Intron|ADAMTS13_uc004cdr.1_RNA	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	500	Cell attachment site (Potential).				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GAAGCGTGGAGACAGCTTCCT	0.627													52	71	---	---	---	---	capture	Missense_Mutation	SNP	136302931	136302931	ADAMTS13	9	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	258	126
ASMT	438	broad.mit.edu	37	X	1746635	1746635	+	Silent	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1746635C>T	uc004cqd.2	+	5	559	c.414C>T	c.(412-414)CCC>CCT	p.P138P	ASMT_uc010ncy.2_Silent_p.P138P|ASMT_uc004cqe.2_Silent_p.P138P	NM_004043	NP_004034	P46597	HIOM_HUMAN	acetylserotonin O-methyltransferase	138					melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity			skin(1)	1		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTGGCGTTCCCGCTGAAGAGC	0.353													11	375	---	---	---	---	capture	Silent	SNP	1746635	1746635	ASMT	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	1036	126
FIGF	2277	broad.mit.edu	37	X	15381369	15381369	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15381369G>A	uc004cwt.1	-	2	672	c.163C>T	c.(163-165)CGA>TGA	p.R55*		NM_004469	NP_004460	O43915	VEGFD_HUMAN	vascular endothelial growth factor D	55					angiogenesis|cell differentiation|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of mast cell chemotaxis|vascular endothelial growth factor receptor signaling pathway	extracellular space|membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity|platelet-derived growth factor receptor binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					TGAGTAATTCGAAGTAGTTCC	0.453													73	6	---	---	---	---	capture	Nonsense_Mutation	SNP	15381369	15381369	FIGF	23	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	5835	126
KIAA1210	57481	broad.mit.edu	37	X	118221675	118221675	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118221675C>T	uc004era.3	-	11	3518	c.3518G>A	c.(3517-3519)CGA>CAA	p.R1173Q		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1173										ovary(4)|skin(1)	5						TTTCTCTAGTCGTGAGGTCAT	0.468													36	6	---	---	---	---	capture	Missense_Mutation	SNP	118221675	118221675	KIAA1210	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8136	126
FLNA	2316	broad.mit.edu	37	X	153588591	153588591	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153588591G>A	uc004fkk.2	-	22	3821	c.3572C>T	c.(3571-3573)GCG>GTG	p.A1191V	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Missense_Mutation_p.A1191V	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1191	Filamin 10.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGTCAGCTCCGCGCTGCCCGC	0.642											OREG0003593	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	35	48	---	---	---	---	capture	Missense_Mutation	SNP	153588591	153588591	FLNA	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5877	126
RAB39B	116442	broad.mit.edu	37	X	154490213	154490213	+	Nonsense_Mutation	SNP	C	A	A			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154490213C>A	uc004fne.2	-	2	796	c.517G>T	c.(517-519)GAG>TAG	p.E173*		NM_171998	NP_741995	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	173					protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTAACCAGCTCATATATGTCT	0.473													47	12	---	---	---	---	capture	Nonsense_Mutation	SNP	154490213	154490213	RAB39B	23	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	12825	126
KIF19	124602	broad.mit.edu	37	17	72342551	72342551	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-3650-01	TCGA-12-3650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72342551delC	uc002jkm.3	+	8	950	c.812delC	c.(811-813)GCCfs	p.A271fs	KIF19_uc002jkj.2_Frame_Shift_Del_p.A271fs|KIF19_uc002jkk.2_Frame_Shift_Del_p.A229fs|KIF19_uc002jkl.2_Frame_Shift_Del_p.A229fs	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	271	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						AAGGAGGGGGCCCACATCAAC	0.597													3	6	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	72342551	72342551	KIF19	17	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	8204	126
