Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NECAP2	55707	broad.mit.edu	37	1	16778338	16778338	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16778338G>A	uc001ayo.2	+	6	585	c.495G>A	c.(493-495)ATG>ATA	p.M165I	NECAP2_uc001ayp.3_RNA|NECAP2_uc010ocd.1_Missense_Mutation_p.M139I|NECAP2_uc001ayq.2_Missense_Mutation_p.M165I	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1	165					endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TTTAGAACATGAAGAAGAAGG	0.602													165	150	---	---	---	---	capture	Missense_Mutation	SNP	16778338	16778338	NECAP2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	10215	129
HNRNPR	10236	broad.mit.edu	37	1	23648083	23648083	+	Missense_Mutation	SNP	A	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:23648083A>C	uc001bgr.3	-	7	908	c.749T>G	c.(748-750)GTT>GGT	p.V250G	HNRNPR_uc001bgp.3_Missense_Mutation_p.V250G|HNRNPR_uc009vqk.2_Missense_Mutation_p.V149G|HNRNPR_uc001bgs.3_Missense_Mutation_p.V149G|HNRNPR_uc010odw.1_Missense_Mutation_p.V212G|HNRNPR_uc010odx.1_Missense_Mutation_p.V90G|HNRNPR_uc009vql.2_Missense_Mutation_p.V111G	NM_005826	NP_005817	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R	250	RRM 2.					catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		AATGGATCCAACAAAAAGTCT	0.363													23	291	---	---	---	---	capture	Missense_Mutation	SNP	23648083	23648083	HNRNPR	1	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	7197	129
PUM1	9698	broad.mit.edu	37	1	31406150	31406150	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:31406150C>T	uc001bsi.1	-	22	3582	c.3469G>A	c.(3469-3471)GGC>AGC	p.G1157S	PUM1_uc001bsf.1_Missense_Mutation_p.G825S|PUM1_uc001bsg.1_Missense_Mutation_p.G891S|PUM1_uc001bsh.1_Missense_Mutation_p.G1159S|PUM1_uc001bsj.1_Missense_Mutation_p.G1133S|PUM1_uc010oga.1_Missense_Mutation_p.G1015S|PUM1_uc001bsk.1_Missense_Mutation_p.G1195S|PUM1_uc010ogb.1_Missense_Mutation_p.G1098S	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	1157	PUM-HD.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		ATGTGCTTGCCATAGGTGTAC	0.537													135	137	---	---	---	---	capture	Missense_Mutation	SNP	31406150	31406150	PUM1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	12720	129
KCNQ4	9132	broad.mit.edu	37	1	41285881	41285881	+	Silent	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:41285881C>T	uc001cgh.1	+	7	1072	c.990C>T	c.(988-990)CAC>CAT	p.H330H	KCNQ4_uc001cgi.1_Silent_p.H330H	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein	330	Cytoplasmic.				sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			AGGAGCAGCACCGGCAGAAGC	0.617													4	21	---	---	---	---	capture	Silent	SNP	41285881	41285881	KCNQ4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	8007	129
AMPD1	270	broad.mit.edu	37	1	115215817	115215817	+	Missense_Mutation	SNP	G	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115215817G>T	uc001efe.1	-	16	2246	c.2162C>A	c.(2161-2163)GCC>GAC	p.A721D	DENND2C_uc001eez.2_5'Flank|AMPD1_uc001eff.1_Missense_Mutation_p.A717D	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	721					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GCGGATTTGGGCTACATTTGT	0.398													41	73	---	---	---	---	capture	Missense_Mutation	SNP	115215817	115215817	AMPD1	1	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	585	129
PDE4DIP	9659	broad.mit.edu	37	1	144882550	144882550	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144882550G>A	uc001elw.3	-	24	3760	c.3469C>T	c.(3469-3471)CCT>TCT	p.P1157S	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Missense_Mutation_p.P164S	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1157					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCTTCCCAGGGGAACCAACC	0.522			T	PDGFRB	MPD								61	242	---	---	---	---	capture	Missense_Mutation	SNP	144882550	144882550	PDE4DIP	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11546	129
IQGAP3	128239	broad.mit.edu	37	1	156532968	156532968	+	Silent	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156532968C>T	uc001fpf.2	-	8	831	c.756G>A	c.(754-756)CTG>CTA	p.L252L	IQGAP3_uc009wsb.1_Silent_p.L209L	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	252					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGGCCTGGGCCAGCATCTCTT	0.572													107	162	---	---	---	---	capture	Silent	SNP	156532968	156532968	IQGAP3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	7739	129
KCNT2	343450	broad.mit.edu	37	1	196227421	196227421	+	Missense_Mutation	SNP	C	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196227421C>A	uc001gtd.1	-	26	3174	c.3114G>T	c.(3112-3114)CAG>CAT	p.Q1038H	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.Q971H|KCNT2_uc001gtf.1_Missense_Mutation_p.Q1014H|KCNT2_uc001gtg.1_RNA|KCNT2_uc001gth.1_Missense_Mutation_p.Q542H	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1038	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						TCAGTCGCTGCTGGGTTATTT	0.468													46	74	---	---	---	---	capture	Missense_Mutation	SNP	196227421	196227421	KCNT2	1	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	8014	129
BTAF1	9044	broad.mit.edu	37	10	93756207	93756207	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:93756207G>A	uc001khr.2	+	24	3489	c.3391G>A	c.(3391-3393)GGT>AGT	p.G1131S	BTAF1_uc001kht.1_Missense_Mutation_p.G569S	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	1131	HEAT 7.				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				TCGTTGTGTAGGTGTCATGAG	0.423													40	22	---	---	---	---	capture	Missense_Mutation	SNP	93756207	93756207	BTAF1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	1524	129
CYP2C18	1562	broad.mit.edu	37	10	96447958	96447958	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96447958G>A	uc001kjv.3	+	3	734	c.408G>A	c.(406-408)ATG>ATA	p.M136I	CYP2C18_uc001kjw.3_Missense_Mutation_p.M136I|CYP2C19_uc009xus.1_Missense_Mutation_p.M1I|CYP2C19_uc010qny.1_5'UTR	NM_000772	NP_000763	P33260	CP2CI_HUMAN	cytochrome P450 family 2 subfamily C polypeptide	136					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(3)|lung(1)|skin(1)	5		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)		ATTTTGGGATGGGGAAGAGGA	0.478													6	90	---	---	---	---	capture	Missense_Mutation	SNP	96447958	96447958	CYP2C18	10	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	4125	129
TDRD1	56165	broad.mit.edu	37	10	115947725	115947725	+	Silent	SNP	A	G	G			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:115947725A>G	uc001lbg.1	+	2	288	c.135A>G	c.(133-135)GGA>GGG	p.G45G	TDRD1_uc001lbf.2_Silent_p.G36G|TDRD1_uc001lbh.1_Silent_p.G36G|TDRD1_uc001lbi.1_Silent_p.G36G	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	45					DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GAAGTCCTGGAACACTTCCTA	0.358													3	110	---	---	---	---	capture	Silent	SNP	115947725	115947725	TDRD1	10	A	G	G	G	1	0	0	0	0	0	0	0	1	106	9	3	3	15615	129
KRTAP5-3	387266	broad.mit.edu	37	11	1629152	1629152	+	Missense_Mutation	SNP	C	G	G			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1629152C>G	uc001ltw.1	-	1	542	c.464G>C	c.(463-465)TGC>TCC	p.C155S		NM_001012708	NP_001012726	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	155	11 X 4 AA repeats of C-C-X-P.					keratin filament				ovary(2)	2		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		GGACTGGGAGCAGCTGGGCTT	0.388													5	258	---	---	---	---	capture	Missense_Mutation	SNP	1629152	1629152	KRTAP5-3	11	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	8482	129
KRTAP5-3	387266	broad.mit.edu	37	11	1629156	1629156	+	Missense_Mutation	SNP	T	A	A	rs75371407		TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1629156T>A	uc001ltw.1	-	1	538	c.460A>T	c.(460-462)AGC>TGC	p.S154C		NM_001012708	NP_001012726	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	154	11 X 4 AA repeats of C-C-X-P.					keratin filament				ovary(2)	2		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		TGGGAGCAGCTGGGCTTGCAG	0.403													6	249	---	---	---	---	capture	Missense_Mutation	SNP	1629156	1629156	KRTAP5-3	11	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	8482	129
OR51G1	79324	broad.mit.edu	37	11	4945317	4945317	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4945317C>T	uc010qyr.1	-	1	253	c.253G>A	c.(253-255)GGC>AGC	p.G85S		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGAAAATGCCCAGCACAGTG	0.483													34	65	---	---	---	---	capture	Missense_Mutation	SNP	4945317	4945317	OR51G1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	11002	129
OR10A6	390093	broad.mit.edu	37	11	7949483	7949483	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7949483C>T	uc010rbh.1	-	1	727	c.727G>A	c.(727-729)GCT>ACT	p.A243T		NM_001004461	NP_001004461	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GTGAGGTGAGCGGCACAGGTG	0.453													40	56	---	---	---	---	capture	Missense_Mutation	SNP	7949483	7949483	OR10A6	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10798	129
KCNA4	3739	broad.mit.edu	37	11	30033870	30033870	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:30033870C>T	uc001msk.2	-	2	1508	c.356G>A	c.(355-357)AGG>AAG	p.R119K		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	119						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ACTCAGCTCCCTCAGGATCTT	0.408													25	41	---	---	---	---	capture	Missense_Mutation	SNP	30033870	30033870	KCNA4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	7927	129
ODZ4	26011	broad.mit.edu	37	11	78380300	78380300	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:78380300C>T	uc001ozl.3	-	32	7553	c.7090G>A	c.(7090-7092)GGG>AGG	p.G2364R	ODZ4_uc001ozk.3_Missense_Mutation_p.G589R|ODZ4_uc009yvb.1_Missense_Mutation_p.G948R	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2364	Extracellular (Potential).|YD 23.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						AGAGGGGTCCCGATGTTGTCA	0.483													49	82	---	---	---	---	capture	Missense_Mutation	SNP	78380300	78380300	ODZ4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10742	129
TMEM135	65084	broad.mit.edu	37	11	86778833	86778833	+	Missense_Mutation	SNP	C	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:86778833C>A	uc001pch.2	+	2	262	c.239C>A	c.(238-240)GCC>GAC	p.A80D	TMEM135_uc010rtt.1_5'UTR|TMEM135_uc001pci.2_Missense_Mutation_p.A80D|TMEM135_uc001pcg.1_Missense_Mutation_p.A80D	NM_022918	NP_075069	Q86UB9	TM135_HUMAN	transmembrane protein 135	80	Helical; (Potential).					integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GCTAATGGGGCCTTGTATATG	0.358													51	103	---	---	---	---	capture	Missense_Mutation	SNP	86778833	86778833	TMEM135	11	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	15935	129
MTNR1B	4544	broad.mit.edu	37	11	92715081	92715081	+	Missense_Mutation	SNP	G	A	A	rs8192553	byFrequency	TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92715081G>A	uc001pdk.1	+	2	795	c.692G>A	c.(691-693)CGC>CAC	p.R231H		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	231	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	CTTCAGGCCCGCAGGAAAGCC	0.582													29	62	---	---	---	---	capture	Missense_Mutation	SNP	92715081	92715081	MTNR1B	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9862	129
ITPR2	3709	broad.mit.edu	37	12	26835518	26835518	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:26835518C>T	uc001rhg.2	-	12	1654	c.1237G>A	c.(1237-1239)GTT>ATT	p.V413I		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	413	Cytoplasmic (Potential).|MIR 5.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TTTAACATAACAGGCCTCTCT	0.388													35	127	---	---	---	---	capture	Missense_Mutation	SNP	26835518	26835518	ITPR2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	7844	129
CCNT1	904	broad.mit.edu	37	12	49086898	49086898	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49086898G>A	uc001rse.1	-	9	2422	c.2099C>T	c.(2098-2100)TCG>TTG	p.S700L	LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_Missense_Mutation_p.S415L	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	700					cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6						GCCAGATCTCGAGGAGATTCC	0.507													35	50	---	---	---	---	capture	Missense_Mutation	SNP	49086898	49086898	CCNT1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2905	129
ITGB7	3695	broad.mit.edu	37	12	53585372	53585372	+	Missense_Mutation	SNP	G	A	A	rs141610554	byFrequency	TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53585372G>A	uc009zmv.2	-	15	2436	c.2365C>T	c.(2365-2367)CGC>TGC	p.R789C	ITGB7_uc001scc.2_Missense_Mutation_p.R789C|ITGB7_uc010snz.1_RNA	NM_000889	NP_000880	P26010	ITB7_HUMAN	integrin, beta 7 precursor	789	Cytoplasmic (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|regulation of immune response	integrin complex	identical protein binding|metal ion binding|receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|breast(1)	8						TCTTGAAAGCGAGGATTGATG	0.507													71	101	---	---	---	---	capture	Missense_Mutation	SNP	53585372	53585372	ITGB7	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7823	129
LEMD3	23592	broad.mit.edu	37	12	65633734	65633734	+	Silent	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:65633734G>A	uc001ssl.1	+	7	1953	c.1947G>A	c.(1945-1947)CTG>CTA	p.L649L	LEMD3_uc009zqo.1_Silent_p.L648L	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	649					negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		GTGTCGTTCTGCGTTACATGA	0.294													26	55	---	---	---	---	capture	Silent	SNP	65633734	65633734	LEMD3	12	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	8641	129
CCT2	10576	broad.mit.edu	37	12	69985894	69985894	+	Silent	SNP	T	G	G			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69985894T>G	uc001svb.1	+	8	799	c.705T>G	c.(703-705)GCT>GCG	p.A235A	CCT2_uc009zrm.1_RNA|CCT2_uc009zrn.1_Silent_p.A235A|CCT2_uc010stl.1_Silent_p.A188A	NM_006431	NP_006422	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2	235					'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TTGAAAATGCTAAAATTCTTA	0.239													62	95	---	---	---	---	capture	Silent	SNP	69985894	69985894	CCT2	12	T	G	G	G	1	0	0	0	0	0	0	0	1	678	53	4	4	2924	129
SCARB1	949	broad.mit.edu	37	12	125294730	125294730	+	Nonsense_Mutation	SNP	C	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125294730C>A	uc001ugo.3	-	6	1085	c.832G>T	c.(832-834)GAG>TAG	p.E278*	SCARB1_uc001ugn.3_Nonsense_Mutation_p.E278*|SCARB1_uc001ugm.3_Nonsense_Mutation_p.E278*|SCARB1_uc010tbd.1_Nonsense_Mutation_p.E278*|SCARB1_uc010tbe.1_Nonsense_Mutation_p.E237*|SCARB1_uc001ugp.3_Nonsense_Mutation_p.E278*	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1	278	Extracellular (Potential).				adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	CGGCAGGCCTCCGGGCTGTAG	0.552													12	18	---	---	---	---	capture	Nonsense_Mutation	SNP	125294730	125294730	SCARB1	12	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	13773	129
OR4K13	390433	broad.mit.edu	37	14	20502107	20502107	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20502107G>A	uc010tkz.1	-	1	811	c.811C>T	c.(811-813)CTT>TTT	p.L271F		NM_001004714	NP_001004714	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K,	271	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AACACAGAAAGAATTTTATCT	0.378													24	23	---	---	---	---	capture	Missense_Mutation	SNP	20502107	20502107	OR4K13	14	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	10972	129
C14orf43	91748	broad.mit.edu	37	14	74203800	74203800	+	Silent	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74203800G>A	uc001xot.2	-	3	2433	c.1650C>T	c.(1648-1650)GAC>GAT	p.D550D	C14orf43_uc001xou.2_Silent_p.D550D|C14orf43_uc010tud.1_Silent_p.D550D|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	550					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)		GACCCTTCCCGTCCTCATCAA	0.602													51	28	---	---	---	---	capture	Silent	SNP	74203800	74203800	C14orf43	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1760	129
NUDT14	256281	broad.mit.edu	37	14	105642875	105642875	+	Missense_Mutation	SNP	A	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105642875A>T	uc010tyn.1	-	4	538	c.424T>A	c.(424-426)TAC>AAC	p.Y142N	NUDT14_uc001yqi.2_RNA	NM_177533	NP_803877	O95848	NUD14_HUMAN	nudix-type motif 14	142	Nudix hydrolase.					cytoplasm	metal ion binding|protein binding|UDP-sugar diphosphatase activity			skin(1)	1		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		ACTCACCAGTATGTGGCGACC	0.478										HNSCC(42;0.11)			20	25	---	---	---	---	capture	Missense_Mutation	SNP	105642875	105642875	NUDT14	14	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	10637	129
TJP1	7082	broad.mit.edu	37	15	30000963	30000963	+	Silent	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:30000963G>A	uc001zcr.2	-	25	5125	c.4650C>T	c.(4648-4650)CAC>CAT	p.H1550H	TJP1_uc010azl.2_Silent_p.H1538H|TJP1_uc001zcq.2_Silent_p.H1474H|TJP1_uc001zcs.2_Silent_p.H1470H	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	1550					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GCAGAAGATTGTGATTGAATT	0.413													13	417	---	---	---	---	capture	Silent	SNP	30000963	30000963	TJP1	15	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	15814	129
BAHD1	22893	broad.mit.edu	37	15	40750817	40750817	+	Missense_Mutation	SNP	C	T	T	rs144910683		TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40750817C>T	uc001zlu.2	+	2	225	c.154C>T	c.(154-156)CGC>TGC	p.R52C	BAHD1_uc001zlt.2_Missense_Mutation_p.R52C|BAHD1_uc010bbp.1_Missense_Mutation_p.R52C|BAHD1_uc001zlv.2_Missense_Mutation_p.R52C	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	52					heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CACAGGGCGCCGCAAGAATTA	0.632													68	109	---	---	---	---	capture	Missense_Mutation	SNP	40750817	40750817	BAHD1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1286	129
SLCO3A1	28232	broad.mit.edu	37	15	92690225	92690225	+	Silent	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:92690225C>T	uc002bqx.2	+	8	1725	c.1524C>T	c.(1522-1524)GGC>GGT	p.G508G	SLCO3A1_uc002bqy.2_Silent_p.G508G|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Silent_p.G450G	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,	508	Extracellular (Potential).|Kazal-like.				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			ATCTCACGGGCTGTGCGTGCC	0.557													31	61	---	---	---	---	capture	Silent	SNP	92690225	92690225	SLCO3A1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	353	28	2	2	14620	129
SSTR5	6755	broad.mit.edu	37	16	1129429	1129429	+	Silent	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1129429C>T	uc002ckq.2	+	1	649	c.561C>T	c.(559-561)AAC>AAT	p.N187N	LOC146336_uc002cko.2_5'Flank|LOC146336_uc002ckp.1_5'Flank	NM_001053	NP_001044	P35346	SSR5_HUMAN	somatostatin receptor 5	187	Extracellular (Potential).				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			lung(1)	1		Hepatocellular(780;0.00369)			Octreotide(DB00104)	GTACCTGCAACGCCAGCTGGC	0.692													4	9	---	---	---	---	capture	Silent	SNP	1129429	1129429	SSTR5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15093	129
MYH8	4626	broad.mit.edu	37	17	10295897	10295897	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10295897G>A	uc002gmm.2	-	38	5625	c.5530C>T	c.(5530-5532)CGG>TGG	p.R1844W	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1844	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TCATGTTTCCGTAAACCTTTA	0.433									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				5	274	---	---	---	---	capture	Missense_Mutation	SNP	10295897	10295897	MYH8	17	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	9951	129
STAT3	6774	broad.mit.edu	37	17	40474479	40474479	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40474479G>A	uc002hzl.1	-	21	2162	c.1922C>T	c.(1921-1923)ACA>ATA	p.T641I	STAT3_uc002hzk.1_Missense_Mutation_p.T641I|STAT3_uc002hzm.1_Missense_Mutation_p.T641I|STAT3_uc010wgh.1_Missense_Mutation_p.T543I|STAT3_uc002hzn.1_Missense_Mutation_p.T641I	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	641	SH2.				cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CTGCTGCTTTGTGTATGGTTC	0.463									Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome				34	284	---	---	---	---	capture	Missense_Mutation	SNP	40474479	40474479	STAT3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	15156	129
LRRC30	339291	broad.mit.edu	37	18	7231759	7231759	+	Missense_Mutation	SNP	T	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7231759T>C	uc010wzk.1	+	1	623	c.623T>C	c.(622-624)CTG>CCG	p.L208P		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	208	LRR 6.									ovary(1)|liver(1)	2						ATCCAGCACCTGGCCAGCCTG	0.562													35	65	---	---	---	---	capture	Missense_Mutation	SNP	7231759	7231759	LRRC30	18	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	8901	129
DCC	1630	broad.mit.edu	37	18	50278484	50278484	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:50278484C>T	uc002lfe.1	+	2	739	c.152C>T	c.(151-153)ACA>ATA	p.T51I	DCC_uc010xdr.1_5'UTR	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	51	Extracellular (Potential).|Ig-like C2-type 1.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GATGCCGTCACAATGCGGGGA	0.498													19	63	---	---	---	---	capture	Missense_Mutation	SNP	50278484	50278484	DCC	18	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	4241	129
MUC16	94025	broad.mit.edu	37	19	9006685	9006685	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9006685C>T	uc002mkp.2	-	44	39767	c.39563G>A	c.(39562-39564)GGC>GAC	p.G13188D	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.G5D|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13190	SEA 8.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTTCCTGGAGCCAGGGTGACC	0.527													101	160	---	---	---	---	capture	Missense_Mutation	SNP	9006685	9006685	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9883	129
CYP2A13	1553	broad.mit.edu	37	19	41600897	41600897	+	Silent	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41600897C>T	uc002opt.2	+	8	1204	c.1195C>T	c.(1195-1197)CTG>TTG	p.L399L		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	399					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	GGGCTCCGTGCTGAGAGACCC	0.557													81	128	---	---	---	---	capture	Silent	SNP	41600897	41600897	CYP2A13	19	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	4121	129
PSG8	440533	broad.mit.edu	37	19	43258694	43258694	+	Missense_Mutation	SNP	C	T	T	rs148019273	byFrequency	TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43258694C>T	uc002ouo.2	-	5	1132	c.1034G>A	c.(1033-1035)CGT>CAT	p.R345H	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Missense_Mutation_p.R184H|PSG8_uc002ouh.2_Missense_Mutation_p.R345H|PSG8_uc010ein.2_Missense_Mutation_p.R223H|PSG8_uc002ouj.3_Missense_Mutation_p.R127H|PSG8_uc002ouk.3_Missense_Mutation_p.R184H|PSG8_uc002oul.3_Missense_Mutation_p.R345H|PSG8_uc002oum.3_Missense_Mutation_p.R252H|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.R252H	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	345	Ig-like C2-type 3.					extracellular region					0		Prostate(69;0.00899)				TTCTCCTGAACGGTAATAGGT	0.473													69	124	---	---	---	---	capture	Missense_Mutation	SNP	43258694	43258694	PSG8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12556	129
CEACAM16	388551	broad.mit.edu	37	19	45208902	45208902	+	Missense_Mutation	SNP	G	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45208902G>T	uc010xxd.1	+	5	910	c.704G>T	c.(703-705)CGC>CTC	p.R235L	CEACAM16_uc002ozq.2_Missense_Mutation_p.R294L	NM_001039213	NP_001034302	A7LI12	A7LI12_HUMAN	carcinoembryonic antigen-related cell adhesion	235										ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				TCCACCACCCGCACAGGCTGC	0.612													16	20	---	---	---	---	capture	Missense_Mutation	SNP	45208902	45208902	CEACAM16	19	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	3157	129
TEAD2	8463	broad.mit.edu	37	19	49862740	49862740	+	Silent	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49862740G>A	uc002pnj.2	-	3	340	c.249C>T	c.(247-249)ATC>ATT	p.I83I	TEAD2_uc002png.2_Silent_p.I83I|TEAD2_uc002pnh.2_Silent_p.I83I|TEAD2_uc002pni.2_Silent_p.I83I|TEAD2_uc010yao.1_5'UTR|TEAD2_uc010emw.2_Silent_p.I83I	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2	83	TEA.				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		TGTAGCGGGCGATCAGTTCAT	0.512													6	248	---	---	---	---	capture	Silent	SNP	49862740	49862740	TEAD2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	15624	129
MXD1	4084	broad.mit.edu	37	2	70164461	70164461	+	Missense_Mutation	SNP	T	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70164461T>C	uc002sfy.2	+	5	673	c.413T>C	c.(412-414)ATT>ACT	p.I138T	MXD1_uc010yqp.1_Missense_Mutation_p.I138T|MXD1_uc010yqq.1_Missense_Mutation_p.I75T|MXD1_uc010yqr.1_RNA|MXD1_uc010yqs.1_Missense_Mutation_p.I128T	NM_002357	NP_002348	Q05195	MAD1_HUMAN	MAX dimerization protein 1	138					cell proliferation|multicellular organismal development	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0						AAGCTGGGCATTGAGAGGATC	0.577													35	55	---	---	---	---	capture	Missense_Mutation	SNP	70164461	70164461	MXD1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	9909	129
RAB11FIP5	26056	broad.mit.edu	37	2	73316366	73316366	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73316366C>T	uc002siu.3	-	2	750	c.509G>A	c.(508-510)CGC>CAC	p.R170H	RAB11FIP5_uc002sit.3_Missense_Mutation_p.R92H	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	170					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						CAGGTTGTTGCGCGTGAACTG	0.532													7	531	---	---	---	---	capture	Missense_Mutation	SNP	73316366	73316366	RAB11FIP5	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12792	129
C2orf51	200523	broad.mit.edu	37	2	88828848	88828848	+	Silent	SNP	G	A	A	rs148580273		TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:88828848G>A	uc002stb.1	+	4	541	c.399G>A	c.(397-399)CCG>CCA	p.P133P		NM_152670	NP_689883	Q96LM6	TSC21_HUMAN	chromosome 2 open reading frame 51	133						nucleus				skin(1)	1						CTGACTTTCCGTGCCTCGTGG	0.572													44	100	---	---	---	---	capture	Silent	SNP	88828848	88828848	C2orf51	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	2153	129
NMS	129521	broad.mit.edu	37	2	101089991	101089991	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:101089991G>A	uc002tan.1	+	3	180	c.173G>A	c.(172-174)CGC>CAC	p.R58H		NM_001011717	NP_001011717	Q5H8A3	NMS_HUMAN	neuromedin S precursor	58					neuropeptide signaling pathway|regulation of smooth muscle contraction	extracellular region				ovary(1)	1						CCTCTTTCTCGCCAACCTAAG	0.259													16	31	---	---	---	---	capture	Missense_Mutation	SNP	101089991	101089991	NMS	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10409	129
TTN	7273	broad.mit.edu	37	2	179457532	179457532	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179457532G>A	uc010zfg.1	-	249	51834	c.51610C>T	c.(51610-51612)CCG>TCG	p.P17204S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P10899S|TTN_uc010zfi.1_Missense_Mutation_p.P10832S|TTN_uc010zfj.1_Missense_Mutation_p.P10707S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18131							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGGCTCCGGAACATGAGCT	0.408													83	160	---	---	---	---	capture	Missense_Mutation	SNP	179457532	179457532	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	16617	129
ZFAND2B	130617	broad.mit.edu	37	2	220073015	220073015	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220073015A>G	uc002vka.2	+	5	644	c.472A>G	c.(472-474)ACA>GCA	p.T158A	ZFAND2B_uc010zkt.1_Missense_Mutation_p.T158A|ZFAND2B_uc010fwd.1_Missense_Mutation_p.T158A|ZFAND2B_uc002vjy.1_Missense_Mutation_p.T158A|ZFAND2B_uc002vjz.1_Missense_Mutation_p.T158A|ZFAND2B_uc002vkb.1_Missense_Mutation_p.T49A	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	158						endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTGGCTTCTACAAGCACTGT	0.552													26	35	---	---	---	---	capture	Missense_Mutation	SNP	220073015	220073015	ZFAND2B	2	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	17508	129
SP110	3431	broad.mit.edu	37	2	231042927	231042927	+	Missense_Mutation	SNP	G	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:231042927G>T	uc002vqh.3	-	13	1633	c.1393C>A	c.(1393-1395)CCC>ACC	p.P465T	SP110_uc002vqg.3_Missense_Mutation_p.P465T|SP110_uc002vqi.3_Missense_Mutation_p.P465T|SP110_uc010fxk.2_Missense_Mutation_p.P463T|SP110_uc010fxj.2_Missense_Mutation_p.P108T	NM_004509	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform a	465	SAND.				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		CAGGTCACGGGGAGCTTAGAA	0.413													12	38	---	---	---	---	capture	Missense_Mutation	SNP	231042927	231042927	SP110	2	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	14853	129
BMP2	650	broad.mit.edu	37	20	6758901	6758901	+	Missense_Mutation	SNP	A	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:6758901A>T	uc002wmu.1	+	3	1141	c.356A>T	c.(355-357)GAA>GTA	p.E119V		NM_001200	NP_001191	P12643	BMP2_HUMAN	bone morphogenetic protein 2 preproprotein	119					BMP signaling pathway involved in heart induction|bone mineralization involved in bone maturation|cardiac cell differentiation|cardiac epithelial to mesenchymal transition|cartilage development|growth|negative regulation of cell cycle|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|pathway-restricted SMAD protein phosphorylation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cartilage development|positive regulation of endothelial cell proliferation|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of phosphatase activity|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	activin receptor activity, type II|BMP receptor binding|cytokine activity|growth factor activity|phosphatase activator activity|protein heterodimerization activity|SMAD binding|transforming growth factor beta receptor binding			ovary(1)|breast(1)	2					Simvastatin(DB00641)	GAATCTTTGGAAGAACTACCA	0.363													6	155	---	---	---	---	capture	Missense_Mutation	SNP	6758901	6758901	BMP2	20	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	1447	129
PLK1S1	55857	broad.mit.edu	37	20	21143040	21143040	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:21143040G>A	uc002wsb.2	+	5	1067	c.934G>A	c.(934-936)GAG>AAG	p.E312K	PLK1S1_uc010zsh.1_Missense_Mutation_p.E209K|PLK1S1_uc010zsi.1_Missense_Mutation_p.E179K|PLK1S1_uc010zsj.1_RNA|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_RNA	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1	312					spindle organization	centrosome	protein kinase binding				0						TATTGAAGTTGAGGAAAAAAG	0.448													14	24	---	---	---	---	capture	Missense_Mutation	SNP	21143040	21143040	PLK1S1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11998	129
RYBP	23429	broad.mit.edu	37	3	72427619	72427619	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:72427619C>T	uc003dpe.2	-	4	691	c.574G>A	c.(574-576)GGG>AGG	p.G192R		NM_012234	NP_036366	Q8N488	RYBP_HUMAN	RING1 and YY1 binding protein	202	Interaction with E4TF1B.|Ser-rich.				apoptosis|histone H2A monoubiquitination|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleoplasm	DNA binding|protein binding|transcription corepressor activity|zinc ion binding				0		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;0.000197)|Epithelial(33;0.00068)|LUSC - Lung squamous cell carcinoma(21;0.00228)|Lung(16;0.00677)|KIRC - Kidney renal clear cell carcinoma(39;0.198)|Kidney(39;0.232)		CTCTCTGACCCCGAGCTGCTC	0.512													12	30	---	---	---	---	capture	Missense_Mutation	SNP	72427619	72427619	RYBP	3	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	13658	129
NUDT16	131870	broad.mit.edu	37	3	131101062	131101062	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:131101062C>T	uc003eof.2	+	2	253	c.212C>T	c.(211-213)CCA>CTA	p.P71L	uc003eoc.1_5'Flank|NUDT16_uc011bln.1_Missense_Mutation_p.P58L|NUDT16_uc003eog.1_Missense_Mutation_p.P71L	NM_152395	NP_689608	Q96DE0	NUD16_HUMAN	nudix-type motif 16	104	Nudix hydrolase.					nucleolus|nucleoplasm	hydrolase activity|metal ion binding|RNA binding				0						GGGTCAGGGCCACGCGTTGTG	0.692													10	53	---	---	---	---	capture	Missense_Mutation	SNP	131101062	131101062	NUDT16	3	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	10639	129
SPSB4	92369	broad.mit.edu	37	3	140866045	140866045	+	Silent	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:140866045G>A	uc003ett.2	+	3	1010	c.756G>A	c.(754-756)CAG>CAA	p.Q252Q	SPSB4_uc010hum.2_3'UTR	NM_080862	NP_543138	Q96A44	SPSB4_HUMAN	splA/ryanodine receptor domain and SOCS box	252	SOCS box.				intracellular signal transduction	cytoplasm	protein binding				0						TGGGCCGCCAGCGCCTGCAGG	0.617													29	27	---	---	---	---	capture	Silent	SNP	140866045	140866045	SPSB4	3	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	15007	129
DRD5	1816	broad.mit.edu	37	4	9783859	9783859	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9783859G>A	uc003gmb.3	+	1	602	c.206G>A	c.(205-207)CGC>CAC	p.R69H		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	69	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	GTGCGGAGCCGCCACCTGCGC	0.647													9	39	---	---	---	---	capture	Missense_Mutation	SNP	9783859	9783859	DRD5	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4715	129
FGFBP1	9982	broad.mit.edu	37	4	15938124	15938124	+	Silent	SNP	G	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15938124G>T	uc003gom.2	-	2	250	c.132C>A	c.(130-132)GGC>GGA	p.G44G		NM_005130	NP_005121	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	44					cell-cell signaling|negative regulation of cell proliferation|signal transduction	extracellular space|plasma membrane	heparin binding				0						TCTGGGTGTTGCCCAGAGTGT	0.517													6	233	---	---	---	---	capture	Silent	SNP	15938124	15938124	FGFBP1	4	G	T	T	T	1	0	0	0	0	0	0	0	1	587	46	4	4	5806	129
RFC1	5981	broad.mit.edu	37	4	39306546	39306546	+	Missense_Mutation	SNP	C	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39306546C>A	uc003gty.1	-	15	2135	c.2001G>T	c.(1999-2001)GAG>GAT	p.E667D	RFC1_uc003gtx.1_Missense_Mutation_p.E666D	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	667					DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						TGTATCCCAACTCCTAATCAA	0.433													142	249	---	---	---	---	capture	Missense_Mutation	SNP	39306546	39306546	RFC1	4	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	13139	129
LIMCH1	22998	broad.mit.edu	37	4	41621353	41621353	+	Silent	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:41621353G>A	uc003gvu.3	+	8	885	c.831G>A	c.(829-831)ACG>ACA	p.T277T	LIMCH1_uc003gvt.1_Silent_p.T118T|LIMCH1_uc003gvv.3_Silent_p.T277T|LIMCH1_uc003gvw.3_Silent_p.T277T|LIMCH1_uc003gvx.3_Silent_p.T277T|LIMCH1_uc003gwe.3_Silent_p.T277T|LIMCH1_uc003gvy.3_Silent_p.T118T|LIMCH1_uc003gwa.3_Silent_p.T118T|LIMCH1_uc003gvz.3_Silent_p.T118T|LIMCH1_uc011byu.1_Silent_p.T123T|LIMCH1_uc003gwc.3_Silent_p.T123T|LIMCH1_uc003gwd.3_Silent_p.T123T|LIMCH1_uc011byv.1_Silent_p.T28T|LIMCH1_uc003gwb.1_Silent_p.T125T	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	277					actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						GCAATCAGACGGCCTACGTCC	0.567													65	99	---	---	---	---	capture	Silent	SNP	41621353	41621353	LIMCH1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8717	129
UGT2B11	10720	broad.mit.edu	37	4	70080048	70080048	+	Silent	SNP	A	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70080048A>C	uc003heh.2	-	1	402	c.393T>G	c.(391-393)GTT>GTG	p.V131V	uc003hei.1_Intron	NM_001073	NP_001064	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family,	131					estrogen metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						TCTTATTTGAAACTACATCTT	0.343													3	132	---	---	---	---	capture	Silent	SNP	70080048	70080048	UGT2B11	4	A	C	C	C	1	0	0	0	0	0	0	0	1	2	1	4	4	16839	129
FRAS1	80144	broad.mit.edu	37	4	79295398	79295398	+	Missense_Mutation	SNP	A	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79295398A>T	uc003hlb.2	+	25	3584	c.3144A>T	c.(3142-3144)AAA>AAT	p.K1048N	FRAS1_uc003hkw.2_Missense_Mutation_p.K1048N	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1047	FU 14.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CAAAGCACAAATGCACAGGTA	0.473													41	97	---	---	---	---	capture	Missense_Mutation	SNP	79295398	79295398	FRAS1	4	A	T	T	T	1	0	0	0	0	1	0	0	0	50	4	4	4	5986	129
NDST4	64579	broad.mit.edu	37	4	115767016	115767016	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:115767016A>G	uc003ibu.2	-	10	2757	c.2078T>C	c.(2077-2079)CTC>CCC	p.L693P	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	693	Lumenal (Potential).|Heparan sulfate N-sulfotransferase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GGGGTCAATGAGGATGGTGAT	0.428													3	138	---	---	---	---	capture	Missense_Mutation	SNP	115767016	115767016	NDST4	4	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10165	129
ODZ3	55714	broad.mit.edu	37	4	183658027	183658027	+	Missense_Mutation	SNP	G	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183658027G>T	uc003ivd.1	+	16	3071	c.3034G>T	c.(3034-3036)GCA>TCA	p.A1012S	ODZ3_uc003ive.1_Missense_Mutation_p.A418S	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1012	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		TTCCAGAGCTGCAGGGTATAA	0.388													23	59	---	---	---	---	capture	Missense_Mutation	SNP	183658027	183658027	ODZ3	4	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	10741	129
TRIML1	339976	broad.mit.edu	37	4	189063477	189063477	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189063477G>C	uc003izm.1	+	3	691	c.576G>C	c.(574-576)GAG>GAC	p.E192D	TRIML1_uc003izn.1_5'Flank	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	192	Potential.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TGAAGGAAGAGGAGCAGCTGC	0.388													23	54	---	---	---	---	capture	Missense_Mutation	SNP	189063477	189063477	TRIML1	4	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	16433	129
G3BP1	10146	broad.mit.edu	37	5	151180343	151180343	+	Missense_Mutation	SNP	G	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151180343G>T	uc003lun.2	+	11	1278	c.1107G>T	c.(1105-1107)TTG>TTT	p.L369F	G3BP1_uc003lum.2_Missense_Mutation_p.L369F|G3BP1_uc011dcu.1_Missense_Mutation_p.L187F|G3BP1_uc010jhz.2_Missense_Mutation_p.L187F|G3BP1_uc003luq.2_Missense_Mutation_p.L37F	NM_005754	NP_005745	Q13283	G3BP1_HUMAN	Ras-GTPase-activating protein SH3-domain-binding	369	RRM.				Ras protein signal transduction|transport	cytosol|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|endonuclease activity|protein binding|RNA binding			skin(3)|ovary(1)	4		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			TGGTGGAGTTGCGCATTAACA	0.353													46	128	---	---	---	---	capture	Missense_Mutation	SNP	151180343	151180343	G3BP1	5	G	T	T	T	1	0	0	0	0	1	0	0	0	594	46	4	4	6083	129
GRIA1	2890	broad.mit.edu	37	5	153030021	153030021	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:153030021C>T	uc003lva.3	+	4	957	c.592C>T	c.(592-594)CGG>TGG	p.R198W	GRIA1_uc003luy.3_Missense_Mutation_p.R198W|GRIA1_uc003luz.3_Missense_Mutation_p.R103W|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.R118W|GRIA1_uc011dcx.1_Missense_Mutation_p.R129W|GRIA1_uc011dcy.1_Missense_Mutation_p.R208W|GRIA1_uc011dcz.1_Missense_Mutation_p.R208W|GRIA1_uc010jia.1_Missense_Mutation_p.R178W	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	198	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GAAAAAGGAGCGGCTGGTGGT	0.542													39	74	---	---	---	---	capture	Missense_Mutation	SNP	153030021	153030021	GRIA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	6700	129
CCNG1	900	broad.mit.edu	37	5	162869506	162869506	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:162869506C>T	uc003lzb.2	+	7	957	c.823C>T	c.(823-825)CGG>TGG	p.R275W	CCNG1_uc011dek.1_Missense_Mutation_p.R139W|CCNG1_uc011del.1_Missense_Mutation_p.R139W|CCNG1_uc003lzc.2_RNA	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1	275				RQLKHSYYRITHLPTIPEMVP -> LKWSLNWIITAPKNFS EAFLHNLVLWIP (in Ref. 4; AAB03903).	cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		GCGTACTGCACGGCAATTGAA	0.378													77	142	---	---	---	---	capture	Missense_Mutation	SNP	162869506	162869506	CCNG1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	2894	129
PPP1R11	6992	broad.mit.edu	37	6	30035220	30035220	+	Silent	SNP	C	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30035220C>A	uc003npb.2	+	1	289	c.33C>A	c.(31-33)ACC>ACA	p.T11T	PPP1R11_uc010jrw.2_RNA|PPP1R11_uc003npc.2_RNA	NM_021959	NP_068778	O60927	PP1RB_HUMAN	protein phosphatase 1, regulatory (inhibitor)	11						soluble fraction	protein binding|protein phosphatase inhibitor activity			ovary(1)|lung(1)|skin(1)	3						TGAGCGAGACCGTCACTGAGA	0.632													30	68	---	---	---	---	capture	Silent	SNP	30035220	30035220	PPP1R11	6	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	12254	129
ENPP4	22875	broad.mit.edu	37	6	46107333	46107333	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46107333G>C	uc003oxy.2	+	2	272	c.13G>C	c.(13-15)GTA>CTA	p.V5L		NM_014936	NP_055751	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	5						integral to membrane	hydrolase activity			ovary(3)|skin(1)	4						GAAGTTATTAGTAATACTTTT	0.343													59	99	---	---	---	---	capture	Missense_Mutation	SNP	46107333	46107333	ENPP4	6	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	5087	129
COL9A1	1297	broad.mit.edu	37	6	71004007	71004007	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:71004007C>T	uc003pfg.3	-	5	718	c.559G>A	c.(559-561)GTG>ATG	p.V187M		NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	187	Nonhelical region (NC4).|TSP N-terminal.				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						CTCCTCTCCACGCCAATCATG	0.433													94	162	---	---	---	---	capture	Missense_Mutation	SNP	71004007	71004007	COL9A1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3672	129
TTK	7272	broad.mit.edu	37	6	80741263	80741263	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:80741263G>A	uc003pjc.2	+	14	1675	c.1601G>A	c.(1600-1602)GGA>GAA	p.G534E	TTK_uc003pjb.3_Missense_Mutation_p.G533E	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	534	Protein kinase.|ATP (By similarity).				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		ATAGGAAGTGGAGGTTCAAGC	0.279													4	126	---	---	---	---	capture	Missense_Mutation	SNP	80741263	80741263	TTK	6	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	16602	129
TMEM181	57583	broad.mit.edu	37	6	159050767	159050767	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159050767G>A	uc003qrm.3	+	15	1620	c.1609G>A	c.(1609-1611)GAG>AAG	p.E537K		NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178	537					pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		ACCACCAGCCGAGTTCTTATC	0.542													52	133	---	---	---	---	capture	Missense_Mutation	SNP	159050767	159050767	TMEM181	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15983	129
FKBP9	11328	broad.mit.edu	37	7	33044873	33044873	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:33044873G>A	uc003tdh.2	+	10	1804	c.1623G>A	c.(1621-1623)ATG>ATA	p.M541I	AVL9_uc011kai.1_Intron|FKBP9_uc011kak.1_RNA|FKBP9_uc011kal.1_Missense_Mutation_p.M594I|FKBP9_uc011kam.1_Missense_Mutation_p.M309I	NM_007270	NP_009201	O95302	FKBP9_HUMAN	FK506 binding protein 9 precursor	541	EF-hand 2.				protein folding	endoplasmic reticulum|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity			central_nervous_system(13)|ovary(1)	14			GBM - Glioblastoma multiforme(11;0.0156)			TGAAGAATATGTTCACCAACC	0.493													45	96	---	---	---	---	capture	Missense_Mutation	SNP	33044873	33044873	FKBP9	7	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5860	129
STK17A	9263	broad.mit.edu	37	7	43622866	43622866	+	Silent	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43622866C>T	uc003tih.2	+	1	175	c.24C>T	c.(22-24)GGC>GGT	p.G8G		NM_004760	NP_004751	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	8					apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			skin(2)	2						AGAAGCCAGGCAGCGGCGGCT	0.567													8	14	---	---	---	---	capture	Silent	SNP	43622866	43622866	STK17A	7	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	15180	129
SLC26A5	375611	broad.mit.edu	37	7	103048353	103048353	+	Missense_Mutation	SNP	A	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103048353A>T	uc003vbz.2	-	8	1069	c.833T>A	c.(832-834)TTT>TAT	p.F278Y	SLC26A5_uc003vbt.1_Missense_Mutation_p.F278Y|SLC26A5_uc003vbu.1_Missense_Mutation_p.F278Y|SLC26A5_uc003vbv.1_Missense_Mutation_p.F278Y|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Missense_Mutation_p.F278Y|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	278	Cytoplasmic (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						TCTCTCATTAAACTCCTTGCC	0.468													57	145	---	---	---	---	capture	Missense_Mutation	SNP	103048353	103048353	SLC26A5	7	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	14412	129
CFTR	1080	broad.mit.edu	37	7	117306983	117306983	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117306983C>T	uc003vjd.2	+	27	4396	c.4264C>T	c.(4264-4266)CGG>TGG	p.R1422W	CFTR_uc011knq.1_Missense_Mutation_p.R828W	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	1422	Cytoplasmic (Potential).|ABC transporter 2.				respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	GAACAAAGTGCGGCAGTACGA	0.552									Cystic_Fibrosis				17	55	---	---	---	---	capture	Missense_Mutation	SNP	117306983	117306983	CFTR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3260	129
KIAA1549	57670	broad.mit.edu	37	7	138546043	138546043	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138546043G>C	uc011kql.1	-	16	5138	c.5089C>G	c.(5089-5091)CTC>GTC	p.L1697V	KIAA1549_uc011kqi.1_Missense_Mutation_p.L481V|KIAA1549_uc003vuk.3_Missense_Mutation_p.L1647V|KIAA1549_uc011kqj.1_Missense_Mutation_p.L1697V|KIAA1549_uc011kqk.1_Missense_Mutation_p.L481V	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1697						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						GGGGCCACGAGGGCAAAGGCG	0.697			O	BRAF	pilocytic astrocytoma								20	73	---	---	---	---	capture	Missense_Mutation	SNP	138546043	138546043	KIAA1549	7	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	8166	129
PARP12	64761	broad.mit.edu	37	7	139727128	139727128	+	Missense_Mutation	SNP	C	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139727128C>A	uc003vvl.1	-	10	2450	c.1576G>T	c.(1576-1578)GTT>TTT	p.V526F	PARP12_uc003vvk.1_Missense_Mutation_p.V312F|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	526	PARP catalytic.					nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					ATCTTCTGAACAAAGTAGAAA	0.512													4	186	---	---	---	---	capture	Missense_Mutation	SNP	139727128	139727128	PARP12	7	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	11360	129
OR2A14	135941	broad.mit.edu	37	7	143826811	143826811	+	Silent	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143826811C>T	uc011kua.1	+	1	606	c.606C>T	c.(604-606)TGC>TGT	p.C202C		NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A,	202	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					TTGCAGCCTGCGTGTTCATCC	0.577													151	396	---	---	---	---	capture	Silent	SNP	143826811	143826811	OR2A14	7	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	10880	129
CNTNAP2	26047	broad.mit.edu	37	7	147092850	147092850	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:147092850G>C	uc003weu.1	+	10	2164	c.1648G>C	c.(1648-1650)GAC>CAC	p.D550H		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	550	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGTCAGCATTGACATGTGTGC	0.428										HNSCC(39;0.1)			60	244	---	---	---	---	capture	Missense_Mutation	SNP	147092850	147092850	CNTNAP2	7	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	3612	129
DLC1	10395	broad.mit.edu	37	8	13251148	13251148	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:13251148G>A	uc003wwm.2	-	4	1672	c.1228C>T	c.(1228-1230)CGA>TGA	p.R410*	DLC1_uc003wwn.2_Nonsense_Mutation_p.R410*|DLC1_uc011kxy.1_Nonsense_Mutation_p.R410*	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	410					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						AAATTTACTCGTGTCTGATTT	0.423													77	128	---	---	---	---	capture	Nonsense_Mutation	SNP	13251148	13251148	DLC1	8	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	4508	129
MTUS1	57509	broad.mit.edu	37	8	17573333	17573333	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:17573333A>G	uc003wxv.2	-	5	3001	c.2527T>C	c.(2527-2529)TAT>CAT	p.Y843H	MTUS1_uc003wxt.2_Missense_Mutation_p.Y90H|MTUS1_uc011kyg.1_5'UTR|MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Missense_Mutation_p.Y789H	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	843						Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		GGCTTCAAATAAAAGGATCCT	0.428													112	186	---	---	---	---	capture	Missense_Mutation	SNP	17573333	17573333	MTUS1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	9875	129
ATAD2	29028	broad.mit.edu	37	8	124382139	124382139	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124382139C>T	uc003yqh.3	-	7	961	c.853G>A	c.(853-855)GAT>AAT	p.D285N	ATAD2_uc011lii.1_Missense_Mutation_p.D76N|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.D285N	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	285	Asp-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			tcttctccatcttcttcatct	0.159													27	51	---	---	---	---	capture	Missense_Mutation	SNP	124382139	124382139	ATAD2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	1062	129
FREM1	158326	broad.mit.edu	37	9	14789086	14789086	+	Silent	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:14789086G>A	uc003zlm.2	-	23	4598	c.4008C>T	c.(4006-4008)TCC>TCT	p.S1336S	FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1336	CSPG 9.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		TCATGCCAGGGGAGAGAGGAA	0.493													12	16	---	---	---	---	capture	Silent	SNP	14789086	14789086	FREM1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	5987	129
TEK	7010	broad.mit.edu	37	9	27205000	27205000	+	Silent	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27205000G>A	uc003zqi.3	+	14	2743	c.2301G>A	c.(2299-2301)CTG>CTA	p.L767L	TEK_uc011lno.1_Silent_p.L724L|TEK_uc011lnp.1_Silent_p.L620L|TEK_uc003zqj.1_Silent_p.L701L	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	767	Helical; (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		TGGCCTTTCTGATCATATTGC	0.517													66	132	---	---	---	---	capture	Silent	SNP	27205000	27205000	TEK	9	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	15636	129
VPS13A	23230	broad.mit.edu	37	9	79985216	79985216	+	Missense_Mutation	SNP	T	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79985216T>C	uc004akr.2	+	64	8971	c.8711T>C	c.(8710-8712)CTA>CCA	p.L2904P	VPS13A_uc004akp.3_Missense_Mutation_p.L2904P|VPS13A_uc004akq.3_Missense_Mutation_p.L2904P|VPS13A_uc004aks.2_Missense_Mutation_p.L2865P	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	2904					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						GGAATGGCACTAGGACTTAAG	0.373													6	141	---	---	---	---	capture	Missense_Mutation	SNP	79985216	79985216	VPS13A	9	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	17071	129
FOXR2	139628	broad.mit.edu	37	X	55650313	55650313	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55650313C>T	uc004duo.2	+	1	481	c.169C>T	c.(169-171)CCA>TCA	p.P57S		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	57					embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						AATGAAGCCCCCAGAAATGCC	0.517													47	111	---	---	---	---	capture	Missense_Mutation	SNP	55650313	55650313	FOXR2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5976	129
YIPF6	286451	broad.mit.edu	37	X	67742720	67742720	+	Missense_Mutation	SNP	C	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:67742720C>A	uc004dwy.2	+	6	576	c.553C>A	c.(553-555)CTT>ATT	p.L185I	YIPF6_uc011mph.1_Missense_Mutation_p.L142I	NM_173834	NP_776195	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	185	Helical; (Potential).					endoplasmic reticulum|integral to membrane					0						CATGGTTCGGCTTTTTGTGGT	0.408													56	114	---	---	---	---	capture	Missense_Mutation	SNP	67742720	67742720	YIPF6	23	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	17363	129
FAM199X	139231	broad.mit.edu	37	X	103434406	103434406	+	Missense_Mutation	SNP	T	C	C			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:103434406T>C	uc004elw.2	+	6	1280	c.1114T>C	c.(1114-1116)TCC>CCC	p.S372P	FAM199X_uc004elx.2_Missense_Mutation_p.S146P	NM_207318	NP_997201	Q6PEV8	F199X_HUMAN	hypothetical protein LOC139231	372										ovary(1)	1						AGAGGTGCTGTCCTTGAAAGT	0.473													64	127	---	---	---	---	capture	Missense_Mutation	SNP	103434406	103434406	FAM199X	23	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	5482	129
COL4A5	1287	broad.mit.edu	37	X	107911614	107911614	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107911614G>A	uc004enz.1	+	41	3872	c.3670G>A	c.(3670-3672)GAA>AAA	p.E1224K	COL4A5_uc011mso.1_Missense_Mutation_p.E1224K	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	1224	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						TCCAAAGGGCGAACCAGGCTT	0.532									Alport_syndrome_with_Diffuse_Leiomyomatosis				39	66	---	---	---	---	capture	Missense_Mutation	SNP	107911614	107911614	COL4A5	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3659	129
ZNF275	10838	broad.mit.edu	37	X	152613030	152613030	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152613030C>T	uc004fhg.1	+	4	1064	c.887C>T	c.(886-888)CCC>CTC	p.P296L	ZNF275_uc011mym.1_Missense_Mutation_p.P296L|ZNF275_uc011myn.1_Missense_Mutation_p.P233L			A6NFS0	A6NFS0_HUMAN	SubName: Full=cDNA FLJ16723 fis, clone UTERU3004418, highly similar to Zinc finger protein 275; SubName: Full=Putative uncharacterized protein ZNF275;	296						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TACGGGTGTCCCCACTGCGGC	0.682													6	9	---	---	---	---	capture	Missense_Mutation	SNP	152613030	152613030	ZNF275	23	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	17690	129
SLC10A3	8273	broad.mit.edu	37	X	153716308	153716308	+	Silent	SNP	C	A	A			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153716308C>A	uc004flq.2	-	3	1236	c.972G>T	c.(970-972)CTG>CTT	p.L324L	UBL4A_uc004flo.2_5'Flank|SLC10A3_uc004flr.2_Silent_p.L295L|SLC10A3_uc004flp.2_Silent_p.L324L	NM_001142392	NP_001135864	P09131	P3_HUMAN	solute carrier family 10, member 3 isoform 1	324	Helical; (Potential).				organic anion transport	integral to membrane	bile acid:sodium symporter activity			ovary(1)|skin(1)	2	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCAGGGTCCCCAGGATCTTGG	0.607													36	74	---	---	---	---	capture	Silent	SNP	153716308	153716308	SLC10A3	23	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	14268	129
EHBP1L1	254102	broad.mit.edu	37	11	65349460	65349460	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65349460delA	uc001oeo.3	+	9	1582	c.1317delA	c.(1315-1317)GGAfs	p.G439fs	EHBP1L1_uc001oep.1_Intron	NM_001099409	NP_001092879	Q8N3D4	EH1L1_HUMAN	tangerin	439										central_nervous_system(1)	1						ACACTAAGGGACCAGAGGCGA	0.597													20	41	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	65349460	65349460	EHBP1L1	11	A	-	-	-	1	0	1	0	1	0	0	0	0	119	10	5	5	4931	129
MYO16	23026	broad.mit.edu	37	13	109792874	109792874	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:109792874delG	uc001vqt.1	+	32	4374	c.4248delG	c.(4246-4248)CTGfs	p.L1416fs	MYO16_uc010agk.1_Frame_Shift_Del_p.L1438fs	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1416	Pro-rich.				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TCGAGATGCTGGGGCACGCGG	0.736													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	109792874	109792874	MYO16	13	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	9974	129
FN1	2335	broad.mit.edu	37	2	216288171	216288171	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:216288171delG	uc002vfa.2	-	9	1561	c.1295delC	c.(1294-1296)ACTfs	p.T432fs	FN1_uc002vfb.2_Frame_Shift_Del_p.T432fs|FN1_uc002vfc.2_Frame_Shift_Del_p.T432fs|FN1_uc002vfd.2_Frame_Shift_Del_p.T432fs|FN1_uc002vfe.2_Frame_Shift_Del_p.T432fs|FN1_uc002vff.2_Frame_Shift_Del_p.T432fs|FN1_uc002vfg.2_Frame_Shift_Del_p.T432fs|FN1_uc002vfh.2_Frame_Shift_Del_p.T432fs|FN1_uc002vfi.2_Frame_Shift_Del_p.T432fs|FN1_uc002vfj.2_Frame_Shift_Del_p.T432fs|FN1_uc002vfl.2_Frame_Shift_Del_p.T432fs	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	432	Fibronectin type-II 2.|Collagen-binding.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGTGCAATCAGTGTAATTGTG	0.488													16	62	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	216288171	216288171	FN1	2	G	-	-	-	1	0	1	0	1	0	0	0	0	468	36	5	5	5906	129
UBAP1	51271	broad.mit.edu	37	9	34234331	34234331	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-5295-01	TCGA-12-5295-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34234331delA	uc003ztx.2	+	3	387	c.152delA	c.(151-153)GAAfs	p.E51fs	UBAP1_uc010mka.1_Intron|UBAP1_uc003zty.2_Frame_Shift_Del_p.E51fs|UBAP1_uc011loi.1_Intron|UBAP1_uc011loj.1_Frame_Shift_Del_p.E115fs|KIF24_uc010mkb.2_Intron|UBAP1_uc003ztz.2_Frame_Shift_Del_p.E51fs	NM_016525	NP_057609	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	51	UMA.					cytoplasm					0			LUSC - Lung squamous cell carcinoma(29;0.00272)			GTTGTCAGAGAAGTACAGGTA	0.318													63	158	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	34234331	34234331	UBAP1	9	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	16718	129
