Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FAM131C	348487	broad.mit.edu	37	1	16390042	16390042	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16390042C>T	uc001axz.3	-	2	302	c.112G>A	c.(112-114)GTG>ATG	p.V38M	FAM131C_uc010obz.1_Missense_Mutation_p.V38M	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487	38											0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGGAGCCACGGTGGGAGTG	0.632													25	55	---	---	---	---	capture	Missense_Mutation	SNP	16390042	16390042	FAM131C	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5395	130
RCAN3	11123	broad.mit.edu	37	1	24857822	24857822	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24857822C>T	uc001bjj.2	+	3	623	c.310C>T	c.(310-312)CGA>TGA	p.R104*	RCAN3_uc009vrd.2_Nonsense_Mutation_p.R104*|RCAN3_uc009vre.2_Intron|RCAN3_uc009vrf.2_Nonsense_Mutation_p.R104*|RCAN3_uc009vrg.2_Intron	NM_013441	NP_038469	Q9UKA8	RCAN3_HUMAN	Down syndrome critical region gene 1-like 2	104					anatomical structure morphogenesis|calcium-mediated signaling		nucleotide binding|RNA binding|troponin I binding				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		AGCAAGAGCGCGAATAGAACT	0.413													43	76	---	---	---	---	capture	Nonsense_Mutation	SNP	24857822	24857822	RCAN3	1	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	13065	130
GRIK3	2899	broad.mit.edu	37	1	37285426	37285426	+	Missense_Mutation	SNP	T	C	C			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:37285426T>C	uc001caz.2	-	12	1919	c.1784A>G	c.(1783-1785)CAC>CGC	p.H595R	GRIK3_uc001cba.1_Missense_Mutation_p.H595R	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	595	Cytoplasmic (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	GTTGCAGGGGTGAGCATCGTA	0.562													4	19	---	---	---	---	capture	Missense_Mutation	SNP	37285426	37285426	GRIK3	1	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	6708	130
SLC44A5	204962	broad.mit.edu	37	1	75679448	75679448	+	Missense_Mutation	SNP	C	G	G			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75679448C>G	uc001dgu.2	-	22	2048	c.1904G>C	c.(1903-1905)AGA>ACA	p.R635T	SLC44A5_uc001dgt.2_Missense_Mutation_p.R635T|SLC44A5_uc001dgs.2_Missense_Mutation_p.R593T|SLC44A5_uc001dgr.2_Missense_Mutation_p.R593T|SLC44A5_uc010oqz.1_Missense_Mutation_p.R674T|SLC44A5_uc010ora.1_Missense_Mutation_p.R629T|SLC44A5_uc010orb.1_Missense_Mutation_p.R505T	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	635	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						CACTGGCAGTCTTTGTGTGAA	0.318													94	130	---	---	---	---	capture	Missense_Mutation	SNP	75679448	75679448	SLC44A5	1	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	14531	130
HRNR	388697	broad.mit.edu	37	1	152187697	152187697	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152187697G>A	uc001ezt.1	-	3	6484	c.6408C>T	c.(6406-6408)CAC>CAT	p.H2136H		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2136					keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCTAGAGCCGTGTTGTCCGT	0.557													35	627	---	---	---	---	capture	Silent	SNP	152187697	152187697	HRNR	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7284	130
GOLT1A	127845	broad.mit.edu	37	1	204170871	204170871	+	Silent	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204170871C>T	uc001has.1	-	3	372	c.186G>A	c.(184-186)CGG>CGA	p.R62R	GOLT1A_uc001hat.1_Silent_p.R62R	NM_198447	NP_940849	Q6ZVE7	GOT1A_HUMAN	golgi transport 1 homolog A	62	Cytoplasmic (Potential).				protein transport|vesicle-mediated transport	Golgi membrane|integral to membrane					0	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)			TGAGTTTGTGCCGTTGGAAGA	0.567													6	223	---	---	---	---	capture	Silent	SNP	204170871	204170871	GOLT1A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	6504	130
NID1	4811	broad.mit.edu	37	1	236189279	236189279	+	Missense_Mutation	SNP	G	A	A	rs147220938		TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:236189279G>A	uc001hxo.2	-	8	2003	c.1901C>T	c.(1900-1902)TCG>TTG	p.S634L	NID1_uc009xgd.2_Missense_Mutation_p.S634L	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	634	Nidogen G2 beta-barrel.				cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	GCTGTCCACCGAGAGCTGCTG	0.592													145	199	---	---	---	---	capture	Missense_Mutation	SNP	236189279	236189279	NID1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10321	130
OPN4	94233	broad.mit.edu	37	10	88418396	88418396	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:88418396G>A	uc001kdq.2	+	4	807	c.580G>A	c.(580-582)GTT>ATT	p.V194I	OPN4_uc001kdp.2_Missense_Mutation_p.V205I|OPN4_uc010qmk.1_Missense_Mutation_p.V205I|OPN4_uc009xsx.1_5'Flank	NM_033282	NP_150598	Q9UHM6	OPN4_HUMAN	opsin 4 isoform 1	194	Helical; Name=4; (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity			ovary(1)	1						CCTGCTGGGCGTTTGGCTCTA	0.647													66	17	---	---	---	---	capture	Missense_Mutation	SNP	88418396	88418396	OPN4	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10786	130
SCUBE2	57758	broad.mit.edu	37	11	9074727	9074727	+	Missense_Mutation	SNP	G	A	A	rs77907325		TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:9074727G>A	uc001mhh.1	-	12	1446	c.1366C>T	c.(1366-1368)CGT>TGT	p.R456C	SCUBE2_uc001mhi.1_Missense_Mutation_p.R456C|SCUBE2_uc001mhj.1_Intron	NM_020974	NP_066025	Q9NQ36	SCUB2_HUMAN	CEGP1 protein precursor	456						extracellular region	calcium ion binding			ovary(1)|skin(1)	2				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		AGGGACACACGGGGTGACACA	0.537													24	56	---	---	---	---	capture	Missense_Mutation	SNP	9074727	9074727	SCUBE2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13838	130
TMPRSS4	56649	broad.mit.edu	37	11	117985881	117985881	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117985881G>A	uc010rxo.1	+	11	1329	c.1038G>A	c.(1036-1038)GCG>GCA	p.A346A	TMPRSS4_uc010rxp.1_Silent_p.A341A|TMPRSS4_uc010rxq.1_Silent_p.A199A|TMPRSS4_uc010rxr.1_Silent_p.A321A|TMPRSS4_uc010rxs.1_Silent_p.A306A|TMPRSS4_uc009yzu.2_Intron|TMPRSS4_uc010rxt.1_Silent_p.A321A	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1	346	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		TGCTGCAGGCGTCAGTCCAGG	0.552													14	14	---	---	---	---	capture	Silent	SNP	117985881	117985881	TMPRSS4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16132	130
MFRP	83552	broad.mit.edu	37	11	119216274	119216274	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119216274G>C	uc001pwj.2	-	5	657	c.497C>G	c.(496-498)CCC>CGC	p.P166R	MFRP_uc010rzf.1_RNA|MFRP_uc010rzg.1_Missense_Mutation_p.P166R	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein	117	C1q.					collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		GTGGGTGTTGGGGGGGTAAGG	0.567													47	67	---	---	---	---	capture	Missense_Mutation	SNP	119216274	119216274	MFRP	11	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	9438	130
POU2F3	25833	broad.mit.edu	37	11	120168973	120168973	+	Splice_Site	SNP	G	C	C			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120168973G>C	uc001pxc.2	+	4	235	c.133_splice	c.e4-1	p.I45_splice	POU2F3_uc010rzk.1_Splice_Site|POU2F3_uc010rzl.1_Splice_Site	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor						negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		TCCACTTGCAGATTAAAACCG	0.547													314	378	---	---	---	---	capture	Splice_Site	SNP	120168973	120168973	POU2F3	11	G	C	C	C	1	0	0	0	0	0	0	1	0	429	33	5	4	12174	130
ZNF202	7753	broad.mit.edu	37	11	123600382	123600382	+	Missense_Mutation	SNP	C	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123600382C>A	uc001pzd.1	-	5	954	c.554G>T	c.(553-555)GGG>GTG	p.G185V	ZNF202_uc001pzc.1_5'UTR|ZNF202_uc001pze.1_Missense_Mutation_p.G185V|ZNF202_uc001pzf.1_Missense_Mutation_p.G185V	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202	185					lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TGCCGGTGCCCCCAGATCTGG	0.607													3	39	---	---	---	---	capture	Missense_Mutation	SNP	123600382	123600382	ZNF202	11	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	17643	130
ACAD8	27034	broad.mit.edu	37	11	134128470	134128470	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:134128470C>T	uc001qhk.2	+	4	503	c.442C>T	c.(442-444)CCG>TCG	p.P148S	ACAD8_uc009zdc.2_Missense_Mutation_p.P50S|ACAD8_uc010sco.1_Missense_Mutation_p.P50S|ACAD8_uc010scp.1_RNA|ACAD8_uc010scq.1_Missense_Mutation_p.P71S|ACAD8_uc001qhl.2_Intron|ACAD8_uc010scr.1_Missense_Mutation_p.P110S|ACAD8_uc009zde.1_Missense_Mutation_p.P21S	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8	148					branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)		ATTTTGCCCACCGCTCTGTAC	0.433													24	46	---	---	---	---	capture	Missense_Mutation	SNP	134128470	134128470	ACAD8	11	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	110	130
TMEM117	84216	broad.mit.edu	37	12	44782427	44782427	+	Missense_Mutation	SNP	C	T	T	rs150984405		TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:44782427C>T	uc001rod.2	+	8	1583	c.1517C>T	c.(1516-1518)ACG>ATG	p.T506M	TMEM117_uc001roe.2_Missense_Mutation_p.T402M|TMEM117_uc009zkc.2_3'UTR	NM_032256	NP_115632	Q9H0C3	TM117_HUMAN	transmembrane protein 117	506						endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		CAAGACCCAACGACTTCTAAA	0.398													86	138	---	---	---	---	capture	Missense_Mutation	SNP	44782427	44782427	TMEM117	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15916	130
NR2C1	7181	broad.mit.edu	37	12	95425195	95425195	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:95425195G>A	uc001tdm.3	-	11	1579	c.1323C>T	c.(1321-1323)TGC>TGT	p.C441C	NR2C1_uc010suu.1_Intron|NR2C1_uc001tdo.3_Silent_p.C441C|NR2C1_uc001tdn.3_Silent_p.C441C	NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	441					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						TCACTTGCCAGCACTGGGCAA	0.368													4	191	---	---	---	---	capture	Silent	SNP	95425195	95425195	NR2C1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	10529	130
VPS29	51699	broad.mit.edu	37	12	110929907	110929907	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110929907A>G	uc001tqy.2	-	4	512	c.452T>C	c.(451-453)GTG>GCG	p.V151A	VPS29_uc001tqw.2_RNA|VPS29_uc001tqx.2_Missense_Mutation_p.V155A|VPS29_uc001tqz.2_RNA	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1	151					protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						ATCCATCAACACAAATGATGG	0.328													3	116	---	---	---	---	capture	Missense_Mutation	SNP	110929907	110929907	VPS29	12	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	17082	130
KSR2	283455	broad.mit.edu	37	12	118198984	118198984	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118198984G>A	uc001two.2	-	4	786	c.731C>T	c.(730-732)CCG>CTG	p.P244L		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	273	Pro-rich.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGTGCCCGGCGGGGTCACGGT	0.701													147	181	---	---	---	---	capture	Missense_Mutation	SNP	118198984	118198984	KSR2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8502	130
ARHGAP5	394	broad.mit.edu	37	14	32561686	32561686	+	Missense_Mutation	SNP	A	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:32561686A>T	uc001wrl.2	+	2	2050	c.1811A>T	c.(1810-1812)GAT>GTT	p.D604V	ARHGAP5_uc001wrm.2_Missense_Mutation_p.D604V|ARHGAP5_uc001wrn.2_Missense_Mutation_p.D604V|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	604					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTAGGGAAGGATGGCCTTGCC	0.373													4	199	---	---	---	---	capture	Missense_Mutation	SNP	32561686	32561686	ARHGAP5	14	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	879	130
ATXN2L	11273	broad.mit.edu	37	16	28846701	28846701	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28846701C>T	uc002drc.2	+	20	2834	c.2666C>T	c.(2665-2667)GCG>GTG	p.A889V	uc010vct.1_Intron|ATXN2L_uc002drb.2_Missense_Mutation_p.A889V|ATXN2L_uc002dqy.2_Missense_Mutation_p.A889V|ATXN2L_uc002dra.2_Missense_Mutation_p.A889V|ATXN2L_uc002dqz.2_Missense_Mutation_p.A889V|ATXN2L_uc010vdb.1_Missense_Mutation_p.A895V|ATXN2L_uc002dre.2_Missense_Mutation_p.A889V|ATXN2L_uc002drf.2_Missense_Mutation_p.A298V|ATXN2L_uc002drg.2_Missense_Mutation_p.A171V	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	889						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						TCCCAGCATGCGGCCCCCAGT	0.632													4	64	---	---	---	---	capture	Missense_Mutation	SNP	28846701	28846701	ATXN2L	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1203	130
ITGAX	3687	broad.mit.edu	37	16	31384692	31384692	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31384692G>A	uc002ebu.1	+	20	2556	c.2489G>A	c.(2488-2490)CGC>CAC	p.R830H	ITGAX_uc002ebt.2_Missense_Mutation_p.R830H	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	830	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CTGTCCTACCGCTACGTGGCA	0.622													45	66	---	---	---	---	capture	Missense_Mutation	SNP	31384692	31384692	ITGAX	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7812	130
KRT23	25984	broad.mit.edu	37	17	39092707	39092707	+	Missense_Mutation	SNP	C	T	T	rs148371500		TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39092707C>T	uc002hvm.1	-	2	738	c.149G>A	c.(148-150)CGG>CAG	p.R50Q	KRT23_uc010wfl.1_Intron|KRT23_uc010cxf.1_Intron|KRT23_uc010cxg.2_Missense_Mutation_p.R50Q|KRT23_uc002hvn.1_Missense_Mutation_p.R50Q	NM_015515	NP_056330	Q9C075	K1C23_HUMAN	keratin 23	50	Head.					intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)|Ovarian(249;0.15)				TGGGCAGCTCCGCGTGGTGAA	0.692													81	82	---	---	---	---	capture	Missense_Mutation	SNP	39092707	39092707	KRT23	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8380	130
KRTAP4-9	100132386	broad.mit.edu	37	17	39262036	39262036	+	Silent	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39262036C>T	uc010wfp.1	+	1	396	c.396C>T	c.(394-396)TCC>TCT	p.S132S		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	132	21.|29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].					keratin filament					0						gctgtgtgtccagctgctgca	0.194													9	17	---	---	---	---	capture	Silent	SNP	39262036	39262036	KRTAP4-9	17	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	8477	130
DGKE	8526	broad.mit.edu	37	17	54940030	54940030	+	Missense_Mutation	SNP	G	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:54940030G>T	uc002iur.2	+	12	1762	c.1582G>T	c.(1582-1584)GGG>TGG	p.G528W	DGKE_uc002ius.1_3'UTR	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	528					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)					TTGGGCCCAAGGGCCCTGCAC	0.448													4	38	---	---	---	---	capture	Missense_Mutation	SNP	54940030	54940030	DGKE	17	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	4426	130
CASKIN2	57513	broad.mit.edu	37	17	73498864	73498864	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73498864G>C	uc002joc.2	-	18	2841	c.2291C>G	c.(2290-2292)TCT>TGT	p.S764C	CASKIN2_uc010wsc.1_Missense_Mutation_p.S682C	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	764	Pro-rich.					cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGCCGGGCTAGAGGGTGAGCC	0.667													32	43	---	---	---	---	capture	Missense_Mutation	SNP	73498864	73498864	CASKIN2	17	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	2643	130
EVPL	2125	broad.mit.edu	37	17	74017966	74017966	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74017966G>A	uc002jqi.2	-	7	1017	c.789C>T	c.(787-789)GGC>GGT	p.G263G	EVPL_uc010wss.1_Silent_p.G263G|EVPL_uc010wst.1_5'UTR	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	263	Spectrin.|Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						CCCGCCGCACGCCCGCAGGGT	0.756													3	6	---	---	---	---	capture	Silent	SNP	74017966	74017966	EVPL	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5247	130
SLC25A10	1468	broad.mit.edu	37	17	79682531	79682531	+	Silent	SNP	C	T	T	rs146181618	byFrequency	TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79682531C>T	uc002kbi.2	+	3	323	c.237C>T	c.(235-237)TTC>TTT	p.F79F	SLC25A10_uc010wut.1_Silent_p.F234F|SLC25A10_uc010dif.2_Silent_p.F79F|SLC25A10_uc010wuu.1_Silent_p.F33F	NM_012140	NP_036272	Q9UBX3	DIC_HUMAN	solute carrier family 25 (mitochondrial carrier;	79	Solcar 1.|Helical; Name=2; (Potential).				gluconeogenesis|mitochondrial transport	integral to membrane|mitochondrial inner membrane|nucleus	protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		Succinic acid(DB00139)	TGACTCGGTTCGCCATCTACG	0.687													218	229	---	---	---	---	capture	Silent	SNP	79682531	79682531	SLC25A10	17	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	14364	130
ADNP2	22850	broad.mit.edu	37	18	77896288	77896288	+	Missense_Mutation	SNP	C	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77896288C>A	uc002lnw.2	+	4	3447	c.2992C>A	c.(2992-2994)CCC>ACC	p.P998T		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	998					cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GGAGCAGCCTCCCATCCTAAA	0.517													6	230	---	---	---	---	capture	Missense_Mutation	SNP	77896288	77896288	ADNP2	18	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	324	130
ZNF358	140467	broad.mit.edu	37	19	7585663	7585663	+	Missense_Mutation	SNP	T	C	C	rs28655671		TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7585663T>C	uc002mgn.2	+	2	1705	c.1535T>C	c.(1534-1536)CTT>CCT	p.L512P	MCOLN1_uc010dvh.1_5'Flank|MCOLN1_uc002mgo.2_5'Flank|MCOLN1_uc002mgp.2_5'Flank	NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358	512					embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						AGCCCAGACCTTGATCCTGTG	0.537													31	106	---	---	---	---	capture	Missense_Mutation	SNP	7585663	7585663	ZNF358	19	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	17747	130
MEGF8	1954	broad.mit.edu	37	19	42855690	42855690	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42855690G>A	uc002otl.3	+	16	3399	c.2764G>A	c.(2764-2766)GGC>AGC	p.G922S	MEGF8_uc002otm.3_Missense_Mutation_p.G530S	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	989	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				CCCACACGGGGGCTGTCGAGG	0.662													10	10	---	---	---	---	capture	Missense_Mutation	SNP	42855690	42855690	MEGF8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9376	130
ZNF513	130557	broad.mit.edu	37	2	27600813	27600813	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27600813C>T	uc002rkk.2	-	4	1425	c.1225G>A	c.(1225-1227)GTC>ATC	p.V409I	ZNF513_uc002rkj.2_Missense_Mutation_p.V347I	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	409	C2H2-type 5.				regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGTATGGACGCGCTGGTGC	0.587													181	228	---	---	---	---	capture	Missense_Mutation	SNP	27600813	27600813	ZNF513	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17837	130
IL1R1	3554	broad.mit.edu	37	2	102791960	102791960	+	Silent	SNP	C	T	T	rs113665542	byFrequency;by1000genomes	TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102791960C>T	uc002tbq.2	+	11	1476	c.1158C>T	c.(1156-1158)GAC>GAT	p.D386D	IL1R1_uc010fix.2_Intron|IL1R1_uc002tbp.2_Silent_p.D386D|IL1R1_uc002tbr.2_Silent_p.D386D	NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor	386	TIR.|Cytoplasmic (Potential).				innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)	AGACCTATGACGCATATATAC	0.363													186	233	---	---	---	---	capture	Silent	SNP	102791960	102791960	IL1R1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7581	130
ANKAR	150709	broad.mit.edu	37	2	190603404	190603404	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:190603404G>A	uc002uqw.1	+	18	3483	c.3483G>A	c.(3481-3483)TTG>TTA	p.L1161L	ANKAR_uc002uqu.2_RNA|ANKAR_uc002uqx.1_RNA|ANKAR_uc002uqy.1_Silent_p.L328L	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1232						integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			CTATTGTCTTGACAGGTAAGA	0.294													60	80	---	---	---	---	capture	Silent	SNP	190603404	190603404	ANKAR	2	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	620	130
DYNLRB1	83658	broad.mit.edu	37	20	33114101	33114101	+	Missense_Mutation	SNP	T	C	C			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33114101T>C	uc002xal.2	+	2	92	c.32T>C	c.(31-33)CTG>CCG	p.L11P	DYNLRB1_uc010zuk.1_Missense_Mutation_p.L11P|DYNLRB1_uc002xam.2_RNA|DYNLRB1_uc002xan.2_RNA|DYNLRB1_uc002xao.2_RNA	NM_014183	NP_054902	Q9NP97	DLRB1_HUMAN	Roadblock-1	11					microtubule-based movement|transport|visual behavior	centrosome|cytoplasmic dynein complex|microtubule	microtubule motor activity				0						CTGAAGCGACTGCAGAGCCAG	0.587													3	107	---	---	---	---	capture	Missense_Mutation	SNP	33114101	33114101	DYNLRB1	20	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	4805	130
AIRE	326	broad.mit.edu	37	21	45706905	45706905	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45706905G>A	uc002zei.2	+	3	479	c.352G>A	c.(352-354)GTC>ATC	p.V118I		NM_000383	NP_000374	O43918	AIRE_HUMAN	autoimmune regulator isoform 1	118					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding			skin(1)	1				Colorectal(79;0.0806)		GCCCCCGGCCGTCCCCAAGGC	0.672									Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy				66	49	---	---	---	---	capture	Missense_Mutation	SNP	45706905	45706905	AIRE	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	437	130
ITPR1	3708	broad.mit.edu	37	3	4669476	4669476	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:4669476C>T	uc003bqa.2	+	5	541	c.193C>T	c.(193-195)CGC>TGC	p.R65C	ITPR1_uc010hbz.2_Missense_Mutation_p.R65C|ITPR1_uc010hca.1_Missense_Mutation_p.R65C|ITPR1_uc011asu.1_Missense_Mutation_p.R65C|ITPR1_uc010hcb.1_Missense_Mutation_p.R65C	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	65	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		TCCCATGAACCGCTACTCTGC	0.468													71	156	---	---	---	---	capture	Missense_Mutation	SNP	4669476	4669476	ITPR1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7843	130
CHST2	9435	broad.mit.edu	37	3	142840212	142840212	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142840212A>G	uc003evm.2	+	2	1443	c.554A>G	c.(553-555)AAC>AGC	p.N185S		NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	185	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3						GAGCTATTCAACCAGAATCCC	0.622													31	55	---	---	---	---	capture	Missense_Mutation	SNP	142840212	142840212	CHST2	3	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	3369	130
SH3RF1	57630	broad.mit.edu	37	4	170190261	170190261	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:170190261G>C	uc003isa.1	-	2	438	c.103C>G	c.(103-105)CGA>GGA	p.R35G		NM_020870	NP_065921	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	35	RING-type.					Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding			breast(2)|lung(1)	3		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		AGCAAACATCGCTTGCAAAAC	0.517													3	90	---	---	---	---	capture	Missense_Mutation	SNP	170190261	170190261	SH3RF1	4	G	C	C	C	1	0	0	0	0	1	0	0	0	493	38	4	4	14151	130
PCDHA3	56145	broad.mit.edu	37	5	140181796	140181796	+	Silent	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140181796C>T	uc003lhf.2	+	1	1014	c.1014C>T	c.(1012-1014)CTC>CTT	p.L338L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.L338L	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	338	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGTTCTACTCGAAATTGTGG	0.398													102	132	---	---	---	---	capture	Silent	SNP	140181796	140181796	PCDHA3	5	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	11428	130
PCDHGB2	56103	broad.mit.edu	37	5	140741377	140741377	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140741377G>A	uc003ljs.1	+	1	1675	c.1675G>A	c.(1675-1677)GCG>ACG	p.A559T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.A559T|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	559	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAATGACAATGCGCCACGGGT	0.692													40	70	---	---	---	---	capture	Missense_Mutation	SNP	140741377	140741377	PCDHGB2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	11466	130
EIF4E1B	253314	broad.mit.edu	37	5	176070180	176070180	+	Missense_Mutation	SNP	C	G	G			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176070180C>G	uc010jkf.1	+	4	697	c.113C>G	c.(112-114)TCT>TGT	p.S38C		NM_001099408	NP_001092878	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E	38					regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity				0	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTCCAAACTCTCCCAGGACT	0.453													35	70	---	---	---	---	capture	Missense_Mutation	SNP	176070180	176070180	EIF4E1B	5	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	4984	130
SLC17A2	10246	broad.mit.edu	37	6	25917030	25917030	+	Silent	SNP	T	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25917030T>A	uc011dkb.1	-	7	896	c.813A>T	c.(811-813)ACA>ACT	p.T271T	SLC17A2_uc011dkc.1_Silent_p.T271T|SLC17A2_uc003nfl.2_Silent_p.T271T			O00624	NPT3_HUMAN	SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;	271					phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1						GTGGTAGGCATGTGACCATCG	0.478													59	88	---	---	---	---	capture	Silent	SNP	25917030	25917030	SLC17A2	6	T	A	A	A	1	0	0	0	0	0	0	0	1	652	51	4	4	14310	130
DNAH8	1769	broad.mit.edu	37	6	38834386	38834386	+	Missense_Mutation	SNP	G	A	A	rs139579198		TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38834386G>A	uc003ooe.1	+	44	6467	c.5867G>A	c.(5866-5868)CGC>CAC	p.R1956H		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TATGCTGGGCGCCAGGAACTA	0.323													46	55	---	---	---	---	capture	Missense_Mutation	SNP	38834386	38834386	DNAH8	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4563	130
SDK1	221935	broad.mit.edu	37	7	4116751	4116751	+	Silent	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4116751C>T	uc003smx.2	+	21	3271	c.3132C>T	c.(3130-3132)GAC>GAT	p.D1044D	SDK1_uc010kso.2_Silent_p.D320D	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1044	Fibronectin type-III 4.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACACCATCGACGTGGCCGCTG	0.587													35	133	---	---	---	---	capture	Silent	SNP	4116751	4116751	SDK1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13861	130
RHBDD2	57414	broad.mit.edu	37	7	75517607	75517607	+	Silent	SNP	G	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75517607G>T	uc003udw.1	+	4	1119	c.1035G>T	c.(1033-1035)GGG>GGT	p.G345G	RHBDD2_uc003udv.1_Silent_p.G204G	NM_001040456	NP_001035546	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2 isoform a	345						integral to membrane	serine-type endopeptidase activity				0						TGTATTCTGGGGCCTTGGGCA	0.622													141	410	---	---	---	---	capture	Silent	SNP	75517607	75517607	RHBDD2	7	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	13209	130
KCNH2	3757	broad.mit.edu	37	7	150649546	150649546	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150649546G>A	uc003wic.2	-	6	1537	c.1524C>T	c.(1522-1524)TTC>TTT	p.F508F	KCNH2_uc003wib.2_Silent_p.F168F|KCNH2_uc011kux.1_Silent_p.F412F|KCNH2_uc003wid.2_Silent_p.F168F|KCNH2_uc003wie.2_Silent_p.F508F	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	508	Helical; Name=Segment S3; (Potential).		Missing (in LQT2).		blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)	TGAGCAGGTCGAAGGGGATGG	0.627													40	123	---	---	---	---	capture	Silent	SNP	150649546	150649546	KCNH2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	7954	130
EPPK1	83481	broad.mit.edu	37	8	144941723	144941723	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144941723G>A	uc003zaa.1	-	1	5712	c.5699C>T	c.(5698-5700)GCG>GTG	p.A1900V		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1900	Plectin 31.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGTGACCCCCGCAATGCAGCC	0.632													29	35	---	---	---	---	capture	Missense_Mutation	SNP	144941723	144941723	EPPK1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5145	130
PTPRD	5789	broad.mit.edu	37	9	8492897	8492897	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:8492897C>T	uc003zkk.2	-	26	3143	c.2432G>A	c.(2431-2433)CGC>CAC	p.R811H	PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Missense_Mutation_p.R802H|PTPRD_uc003zkm.2_Missense_Mutation_p.R798H|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	811	Fibronectin type-III 5.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GGGCTTGCTGCGAGCACCATC	0.463										TSP Lung(15;0.13)			180	28	---	---	---	---	capture	Missense_Mutation	SNP	8492897	8492897	PTPRD	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12694	130
SHB	6461	broad.mit.edu	37	9	37919970	37919970	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:37919970C>T	uc004aax.2	-	6	1946	c.1378G>A	c.(1378-1380)GCC>ACC	p.A460T		NM_003028	NP_003019	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein	460	SH2.				angiogenesis|apoptosis|cell differentiation|signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity			central_nervous_system(2)|skin(1)	3		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		TTGGTTTTGGCCAGTTTCATG	0.502													4	175	---	---	---	---	capture	Missense_Mutation	SNP	37919970	37919970	SHB	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14161	130
KCNT1	57582	broad.mit.edu	37	9	138676650	138676650	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138676650G>A	uc011mdq.1	+	27	3145	c.3071G>A	c.(3070-3072)CGC>CAC	p.R1024H	KCNT1_uc011mdr.1_Missense_Mutation_p.R851H|KCNT1_uc010nbf.2_Missense_Mutation_p.R979H|KCNT1_uc004cgo.1_Missense_Mutation_p.R773H	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	1024						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		ACGTACGGCCGCCTCTTCCAG	0.637													239	104	---	---	---	---	capture	Missense_Mutation	SNP	138676650	138676650	KCNT1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8013	130
ARSD	414	broad.mit.edu	37	X	2836003	2836003	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2836003G>A	uc004cqy.2	-	5	781	c.705C>T	c.(703-705)GGC>GGT	p.G235G	ARSD_uc004cqz.1_Intron|ARSD_uc004cra.1_Silent_p.G235G	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor	235						lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGCAGCCCACGCCGGCCATGC	0.592													18	26	---	---	---	---	capture	Silent	SNP	2836003	2836003	ARSD	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	982	130
CXorf58	254158	broad.mit.edu	37	X	23953460	23953460	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:23953460C>T	uc004daz.1	+	7	1047	c.703C>T	c.(703-705)CGA>TGA	p.R235*	CXorf58_uc011mju.1_Nonsense_Mutation_p.R235*	NM_152761	NP_689974	Q96LI9	CX058_HUMAN	hypothetical protein LOC254158	235											0						AAACCGTCTACGAAATGAAAT	0.378													91	126	---	---	---	---	capture	Nonsense_Mutation	SNP	23953460	23953460	CXorf58	23	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	4074	130
ZNF182	7569	broad.mit.edu	37	X	47842386	47842386	+	Silent	SNP	G	A	A	rs141215624	byFrequency	TCGA-12-5299-01	TCGA-12-5299-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47842386G>A	uc004dir.2	-	6	598	c.252C>T	c.(250-252)TGC>TGT	p.C84C	ZNF182_uc004dis.2_Silent_p.C65C|ZNF182_uc004dit.2_Silent_p.C84C|ZNF182_uc011mlu.1_Silent_p.C65C	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1	84	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						CTTCTGCCGGGCATTCTTCTA	0.478													4	183	---	---	---	---	capture	Silent	SNP	47842386	47842386	ZNF182	23	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	17630	130
