Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CYP4A11	1579	broad.mit.edu	37	1	47402416	47402416	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47402416G>A	uc001cqp.3	-	4	481	c.430C>T	c.(430-432)CGG>TGG	p.R144W	CYP4A11_uc001cqq.2_Missense_Mutation_p.R144W|CYP4A11_uc010omm.1_RNA	NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	144					long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	GTCAGCATCCGTCGATGCTGG	0.443													18	58	---	---	---	---	capture	Missense_Mutation	SNP	47402416	47402416	CYP4A11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	4143	132
DOCK7	85440	broad.mit.edu	37	1	63001286	63001286	+	Silent	SNP	C	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:63001286C>A	uc001daq.2	-	29	3523	c.3489G>T	c.(3487-3489)ACG>ACT	p.T1163T	DOCK7_uc001dan.2_Silent_p.T1024T|DOCK7_uc001dao.2_Silent_p.T1024T|DOCK7_uc001dap.2_Silent_p.T1132T|DOCK7_uc001dam.2_Silent_p.T343T|DOCK7_uc010oov.1_5'UTR	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1163					activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						CTTGTACATTCGTAGAAAATC	0.398													15	16	---	---	---	---	capture	Silent	SNP	63001286	63001286	DOCK7	1	C	A	A	A	1	0	0	0	0	0	0	0	1	392	31	4	4	4648	132
VTCN1	79679	broad.mit.edu	37	1	117699373	117699373	+	Silent	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117699373G>A	uc001ehb.2	-	3	340	c.268C>T	c.(268-270)CTG>TTG	p.L90L	VTCN1_uc001ehc.2_5'UTR|VTCN1_uc009whf.1_Intron	NM_024626	NP_078902	Q7Z7D3	VTCN1_HUMAN	V-set domain containing T cell activation	90	Ig-like V-type 1.|Extracellular (Potential).					integral to membrane|plasma membrane					0	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		TGCTCCGACAGCTCATCTTTG	0.458													66	64	---	---	---	---	capture	Silent	SNP	117699373	117699373	VTCN1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	17116	132
TXNIP	10628	broad.mit.edu	37	1	145440100	145440100	+	Silent	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145440100G>A	uc001enn.3	+	4	875	c.534G>A	c.(532-534)GTG>GTA	p.V178V	NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_Silent_p.V123V	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	178					cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATGGGCGGGTGTCTGTCTCTG	0.433													72	189	---	---	---	---	capture	Silent	SNP	145440100	145440100	TXNIP	1	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	16685	132
NR1I3	9970	broad.mit.edu	37	1	161203002	161203002	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161203002G>A	uc001fzx.2	-	4	568	c.365C>T	c.(364-366)ACC>ATC	p.T122I	TOMM40L_uc009wuf.1_Intron|NR1I3_uc001fzf.2_Missense_Mutation_p.T122I|NR1I3_uc001fzg.2_Missense_Mutation_p.T93I|NR1I3_uc001fzh.2_Missense_Mutation_p.T93I|NR1I3_uc001fzi.2_Missense_Mutation_p.T93I|NR1I3_uc001fzj.2_Missense_Mutation_p.T93I|NR1I3_uc001fzk.2_Missense_Mutation_p.T93I|NR1I3_uc001fzl.2_Missense_Mutation_p.T93I|NR1I3_uc001fzm.2_Missense_Mutation_p.T47I|NR1I3_uc001fzn.2_Intron|NR1I3_uc009wug.2_Intron|NR1I3_uc001fzp.2_Missense_Mutation_p.T122I|NR1I3_uc001fzo.2_Intron|NR1I3_uc001fzq.2_Intron|NR1I3_uc001fzr.2_Intron|NR1I3_uc001fzs.2_Intron|NR1I3_uc001fzt.2_Intron|NR1I3_uc001fzu.2_Intron|NR1I3_uc001fzv.2_Intron|NR1I3_uc001fzw.2_Missense_Mutation_p.T122I|NR1I3_uc001fzy.2_Missense_Mutation_p.T122I|NR1I3_uc001fzz.2_Missense_Mutation_p.T122I|NR1I3_uc001gaa.2_Missense_Mutation_p.T122I|NR1I3_uc001gab.2_Missense_Mutation_p.T122I|NR1I3_uc001gac.2_Missense_Mutation_p.T93I|NR1I3_uc010pkm.1_Missense_Mutation_p.T93I|NR1I3_uc010pkn.1_Missense_Mutation_p.T122I	NM_001077480	NP_001070948	Q14994	NR1I3_HUMAN	constitutive androstane receptor isoform 2	122					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	androgen receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(1)|skin(1)	2	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CATGTGGCGGGTGTGGGCCCC	0.557													64	97	---	---	---	---	capture	Missense_Mutation	SNP	161203002	161203002	NR1I3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	10528	132
MYST4	23522	broad.mit.edu	37	10	76735758	76735758	+	Missense_Mutation	SNP	G	A	A	rs146395020	byFrequency	TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:76735758G>A	uc001jwn.1	+	8	2156	c.1663G>A	c.(1663-1665)GGA>AGA	p.G555R	MYST4_uc001jwm.1_Intron|MYST4_uc001jwo.1_Intron|MYST4_uc001jwp.1_Intron	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	555	Negatively regulates HAT activity.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					TACCACTCAGGGACAGTCTCG	0.493			T	CREBBP	AML								53	7	---	---	---	---	capture	Missense_Mutation	SNP	76735758	76735758	MYST4	10	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10015	132
CYP2C18	1562	broad.mit.edu	37	10	96443660	96443660	+	Silent	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96443660G>A	uc001kjv.3	+	1	410	c.84G>A	c.(82-84)AGG>AGA	p.R28R	CYP2C18_uc001kjw.3_Silent_p.R28R	NM_000772	NP_000763	P33260	CP2CI_HUMAN	cytochrome P450 family 2 subfamily C polypeptide	28					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(3)|lung(1)|skin(1)	5		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)		GAAGAGGGAGGCTCCCGTCTG	0.483													11	30	---	---	---	---	capture	Silent	SNP	96443660	96443660	CYP2C18	10	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	4125	132
CYP2C19	1557	broad.mit.edu	37	10	96612523	96612523	+	Missense_Mutation	SNP	G	A	A	rs138112316		TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96612523G>A	uc010qnz.1	+	9	1325	c.1325G>A	c.(1324-1326)CGC>CAC	p.R442H	CYP2C19_uc010qny.1_Missense_Mutation_p.R420H	NM_000769	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C,	442			R -> C (in allele CYP2C19*16; lowered catalytic activity).		exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)	GGCCTGGCCCGCATGGAGCTG	0.433													4	74	---	---	---	---	capture	Missense_Mutation	SNP	96612523	96612523	CYP2C19	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4126	132
BTBD16	118663	broad.mit.edu	37	10	124066797	124066797	+	Nonsense_Mutation	SNP	T	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124066797T>A	uc001lgc.1	+	10	1136	c.885T>A	c.(883-885)TAT>TAA	p.Y295*	BTBD16_uc001lgd.1_Nonsense_Mutation_p.Y294*	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	295										skin(1)	1		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				TTCCGACTTATGAAACCGTGA	0.353													44	4	---	---	---	---	capture	Nonsense_Mutation	SNP	124066797	124066797	BTBD16	10	T	A	A	A	1	0	0	0	0	0	1	0	0	660	51	5	4	1529	132
OR4C46	119749	broad.mit.edu	37	11	51515606	51515606	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:51515606G>A	uc010ric.1	+	1	325	c.325G>A	c.(325-327)GAG>AAG	p.E109K		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CGGAGGTGCAGAGGGCATCCT	0.473													62	73	---	---	---	---	capture	Missense_Mutation	SNP	51515606	51515606	OR4C46	11	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	10955	132
CPSF6	11052	broad.mit.edu	37	12	69652697	69652697	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69652697C>T	uc001sut.3	+	6	1132	c.1022C>T	c.(1021-1023)CCG>CTG	p.P341L	CPSF6_uc001suu.3_Missense_Mutation_p.P378L|CPSF6_uc010stk.1_5'UTR	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	341	Pro-rich.				mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			GCTCCTCCTCCGCATCTTCCT	0.617													59	79	---	---	---	---	capture	Missense_Mutation	SNP	69652697	69652697	CPSF6	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3794	132
SLC6A15	55117	broad.mit.edu	37	12	85255645	85255645	+	Silent	SNP	T	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85255645T>A	uc001szv.2	-	12	2452	c.1959A>T	c.(1957-1959)GCA>GCT	p.A653A	SLC6A15_uc010sul.1_Silent_p.A546A|SLC6A15_uc001szw.1_Missense_Mutation_p.H315L	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1	653	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						AGGTCACAGATGCTAAATTAC	0.438													17	60	---	---	---	---	capture	Silent	SNP	85255645	85255645	SLC6A15	12	T	A	A	A	1	0	0	0	0	0	0	0	1	652	51	4	4	14570	132
ARL1	400	broad.mit.edu	37	12	101794864	101794864	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101794864T>A	uc001tib.2	-	4	461	c.312A>T	c.(310-312)AAA>AAT	p.K104N	ARL1_uc010svn.1_Missense_Mutation_p.K58N|ARL1_uc010svo.1_RNA|ARL1_uc001tic.2_Missense_Mutation_p.K104N	NM_001177	NP_001168	P40616	ARL1_HUMAN	ADP-ribosylation factor-like 1	104					small GTPase mediated signal transduction	Golgi membrane	enzyme activator activity|GTP binding|GTPase activity|metal ion binding|protein binding			central_nervous_system(1)	1		Lung NSC(355;2.1e-05)|Breast(359;0.00015)|Myeloproliferative disorder(1001;0.163)		GBM - Glioblastoma multiforme(134;1.67e-09)|BRCA - Breast invasive adenocarcinoma(302;0.0125)		CTAACTCTGATTTGGAAATGC	0.348													30	65	---	---	---	---	capture	Missense_Mutation	SNP	101794864	101794864	ARL1	12	T	A	A	A	1	0	0	0	0	1	0	0	0	673	52	4	4	918	132
CDX2	1045	broad.mit.edu	37	13	28537311	28537311	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28537311A>G	uc001urv.2	-	3	1057	c.883T>C	c.(883-885)TCT>CCT	p.S295P		NM_001265	NP_001256	Q99626	CDX2_HUMAN	caudal type homeobox 2	295					organ morphogenesis|transcription from RNA polymerase II promoter		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		CCAGGGACAGAGCCAGGCACT	0.657			T	ETV6	AML								15	18	---	---	---	---	capture	Missense_Mutation	SNP	28537311	28537311	CDX2	13	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	3152	132
TEP1	7011	broad.mit.edu	37	14	20841727	20841727	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20841727G>A	uc001vxe.2	-	46	6660	c.6620C>T	c.(6619-6621)TCA>TTA	p.S2207L	TEP1_uc010ahj.1_5'Flank|TEP1_uc010ahk.2_Missense_Mutation_p.S1550L|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.S2099L|TEP1_uc010tlh.1_Missense_Mutation_p.S545L	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2207	WD 14.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CAGAAGCTCTGACCCAGGCTG	0.577													26	19	---	---	---	---	capture	Missense_Mutation	SNP	20841727	20841727	TEP1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	15644	132
CASC5	57082	broad.mit.edu	37	15	40911168	40911168	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40911168T>G	uc010bbs.1	+	10	573	c.412T>G	c.(412-414)TTG>GTG	p.L138V	CASC5_uc010ucq.1_Intron|CASC5_uc001zme.2_Missense_Mutation_p.L112V|CASC5_uc010bbt.1_Missense_Mutation_p.L112V	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	138	Interaction with BUB1 and BUB1B.				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		GATGAACACATTGCTTTCTGC	0.333													53	76	---	---	---	---	capture	Missense_Mutation	SNP	40911168	40911168	CASC5	15	T	G	G	G	1	0	0	0	0	1	0	0	0	673	52	4	4	2639	132
FES	2242	broad.mit.edu	37	15	91438682	91438682	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91438682C>T	uc002bpv.2	+	19	2459	c.2363C>T	c.(2362-2364)GCC>GTC	p.A788V	FES_uc010uqj.1_Missense_Mutation_p.A660V|FES_uc010uqk.1_Missense_Mutation_p.A770V|FES_uc002bpw.2_RNA|FES_uc010bny.2_Missense_Mutation_p.A647V|FES_uc002bpx.2_Missense_Mutation_p.A718V|FES_uc002bpy.2_Missense_Mutation_p.A730V	NM_002005	NP_001996	P07332	FES_HUMAN	feline sarcoma oncogene isoform 1	788	Protein kinase.				axon guidance|cell proliferation|peptidyl-tyrosine phosphorylation	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TGTCCTGATGCCGTGTTCAGG	0.632													4	124	---	---	---	---	capture	Missense_Mutation	SNP	91438682	91438682	FES	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5766	132
ADAMTS17	170691	broad.mit.edu	37	15	100537641	100537641	+	Silent	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:100537641G>A	uc002bvv.1	-	19	2824	c.2745C>T	c.(2743-2745)AGC>AGT	p.S915S		NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	915	TSP type-1 3.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GGCCTTCACAGCTCTGCACTg	0.567													14	54	---	---	---	---	capture	Silent	SNP	100537641	100537641	ADAMTS17	15	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	262	132
ZKSCAN2	342357	broad.mit.edu	37	16	25251946	25251946	+	Missense_Mutation	SNP	C	T	T	rs148950715	byFrequency	TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:25251946C>T	uc002dod.3	-	7	2502	c.2095G>A	c.(2095-2097)GAC>AAC	p.D699N	ZKSCAN2_uc010vcl.1_Missense_Mutation_p.D495N	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	699					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		TTGCTGGGGTCGGTACTCTGG	0.418													63	53	---	---	---	---	capture	Missense_Mutation	SNP	25251946	25251946	ZKSCAN2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17567	132
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	T	T	rs28934575		TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577548C>T	uc002gim.2	-	7	927	c.733G>A	c.(733-735)GGC>AGC	p.G245S	TP53_uc002gig.1_Missense_Mutation_p.G245S|TP53_uc002gih.2_Missense_Mutation_p.G245S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G113S|TP53_uc010cng.1_Missense_Mutation_p.G113S|TP53_uc002gii.1_Missense_Mutation_p.G113S|TP53_uc010cnh.1_Missense_Mutation_p.G245S|TP53_uc010cni.1_Missense_Mutation_p.G245S|TP53_uc002gij.2_Missense_Mutation_p.G245S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G152S|TP53_uc002gio.2_Missense_Mutation_p.G113S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	245	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> A (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G245S(274)|p.G245D(93)|p.G245V(50)|p.G245C(47)|p.G245R(10)|p.G245A(8)|p.0?(7)|p.G245G(3)|p.G245fs*2(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.G245fs*22(1)|p.M243fs*18(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGGTTCATGCCGCCCATGCAG	0.577	G245S(SKLMS1_SOFT_TISSUE)|G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKMEL2_SKIN)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			91	4	---	---	---	---	capture	Missense_Mutation	SNP	7577548	7577548	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	132
PIRT	644139	broad.mit.edu	37	17	10728644	10728644	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10728644C>T	uc010col.2	-	2	614	c.319G>A	c.(319-321)GGG>AGG	p.G107R		NM_001101387	NP_001094857	P0C851	PIRT_HUMAN	phosphoinositide-interacting regulator of	107	Helical; (Potential).					integral to membrane				ovary(1)	1						CACACCAGCCCGCACACCAGC	0.527													37	60	---	---	---	---	capture	Missense_Mutation	SNP	10728644	10728644	PIRT	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11848	132
CCL3	6348	broad.mit.edu	37	17	34416597	34416597	+	Silent	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34416597C>T	uc002hkv.2	-	2	222	c.120G>A	c.(118-120)CGG>CGA	p.R40R		NM_002983	NP_002974	P10147	CCL3_HUMAN	chemokine (C-C motif) ligand 3	40		Involved in GAG binding.		R->A: Slightly reduces heparin binding.	cell-cell signaling|cellular calcium ion homeostasis|cellular component movement|cytoskeleton organization|exocytosis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|regulation of viral genome replication	extracellular space|soluble fraction	chemoattractant activity|chemokine activity|signal transducer activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GTGGAATCTGCCGGGAGGTGT	0.542													5	240	---	---	---	---	capture	Silent	SNP	34416597	34416597	CCL3	17	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	2874	132
KIF18B	146909	broad.mit.edu	37	17	43004364	43004364	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43004364C>T	uc010wji.1	-	14	2469	c.2368G>A	c.(2368-2370)GTT>ATT	p.V790I	KIF18B_uc002iht.2_Missense_Mutation_p.V799I|KIF18B_uc010wjh.1_Missense_Mutation_p.V787I	NM_001080443	NP_001073912			kinesin family member 18B											ovary(2)	2		Prostate(33;0.155)				CACCTCGCAACGCGCTTCTTC	0.637													4	13	---	---	---	---	capture	Missense_Mutation	SNP	43004364	43004364	KIF18B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8203	132
MUC16	94025	broad.mit.edu	37	19	9077406	9077406	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9077406C>T	uc002mkp.2	-	3	10244	c.10040G>A	c.(10039-10041)TGG>TAG	p.W3347*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3348	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGAGCCATGCCACATAGAGAA	0.502													95	68	---	---	---	---	capture	Nonsense_Mutation	SNP	9077406	9077406	MUC16	19	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	9883	132
C19orf54	284325	broad.mit.edu	37	19	41250512	41250512	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41250512G>A	uc002oou.1	-	3	589	c.469C>T	c.(469-471)CGG>TGG	p.R157W	C19orf54_uc002oow.1_Missense_Mutation_p.T26M|C19orf54_uc002oox.1_RNA|C19orf54_uc002ooy.1_Missense_Mutation_p.R19W|C19orf54_uc010xvs.1_RNA	NM_198476	NP_940878	Q5BKX5	CS054_HUMAN	hypothetical protein LOC284325	157											0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GTGGCCACCCGTATGAGTCTC	0.627													16	33	---	---	---	---	capture	Missense_Mutation	SNP	41250512	41250512	C19orf54	19	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	1919	132
CEACAM5	1048	broad.mit.edu	37	19	42213611	42213611	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42213611C>A	uc002ork.2	+	2	198	c.77C>A	c.(76-78)ACC>AAC	p.T26N	CEACAM5_uc010ehz.1_Missense_Mutation_p.T26N|CEACAM5_uc002orj.1_Missense_Mutation_p.T26N|CEACAM5_uc002orl.2_Missense_Mutation_p.T26N	NM_004363	NP_004354	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion	26						anchored to membrane|basolateral plasma membrane|integral to plasma membrane				skin(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		TCACTTCTAACCTTCTGGAAC	0.537													64	116	---	---	---	---	capture	Missense_Mutation	SNP	42213611	42213611	CEACAM5	19	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	3164	132
NLRP12	91662	broad.mit.edu	37	19	54312882	54312882	+	Silent	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54312882G>A	uc002qch.3	-	3	2251	c.2031C>T	c.(2029-2031)CGC>CGT	p.R677R	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Silent_p.R677R|NLRP12_uc002qcj.3_Silent_p.R677R|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.R677R	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	677					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		AGCACCTCGCGCGGTCTTCCC	0.587													10	24	---	---	---	---	capture	Silent	SNP	54312882	54312882	NLRP12	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10381	132
SLC30A3	7781	broad.mit.edu	37	2	27481038	27481038	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27481038G>A	uc002rjk.2	-	3	601	c.415C>T	c.(415-417)CAC>TAC	p.H139Y	SLC30A3_uc002rjj.2_5'UTR|SLC30A3_uc010ylh.1_Missense_Mutation_p.H134Y	NM_003459	NP_003450	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter),	139	Cytoplasmic (Potential).				regulation of sequestering of zinc ion	cell junction|integral to plasma membrane|late endosome|membrane fraction|synaptic vesicle membrane	zinc transporting ATPase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGAACGGTGCCAGCCAAAG	0.637													19	87	---	---	---	---	capture	Missense_Mutation	SNP	27481038	27481038	SLC30A3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	14448	132
IL1A	3552	broad.mit.edu	37	2	113537182	113537182	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113537182C>T	uc002tig.2	-	5	1341	c.381G>A	c.(379-381)ATG>ATA	p.M127I		NM_000575	NP_000566	P01583	IL1A_HUMAN	interleukin 1, alpha proprotein	127					anti-apoptosis|apoptosis|cell proliferation|cellular response to heat|cytokine-mediated signaling pathway|fever generation|immune response|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation vascular endothelial growth factor production|response to copper ion	cytosol|extracellular space	copper ion binding|cytokine activity|interleukin-1 receptor binding			lung(1)	1						TGATGATCCTCATAAAGTTGT	0.393													16	47	---	---	---	---	capture	Missense_Mutation	SNP	113537182	113537182	IL1A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	7573	132
ARMC9	80210	broad.mit.edu	37	2	232127073	232127073	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:232127073A>T	uc002vrq.3	+	12	1193	c.1081A>T	c.(1081-1083)ATC>TTC	p.I361F	ARMC9_uc002vrp.3_Missense_Mutation_p.I361F|ARMC9_uc002vrr.1_RNA	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	361							binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		GCAAGCCTACATCAGCAATGA	0.498													19	110	---	---	---	---	capture	Missense_Mutation	SNP	232127073	232127073	ARMC9	2	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	951	132
BCAS1	8537	broad.mit.edu	37	20	52570143	52570143	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:52570143T>C	uc002xws.2	-	11	1846	c.1508A>G	c.(1507-1509)AAG>AGG	p.K503R	BCAS1_uc010zza.1_Missense_Mutation_p.K169R|BCAS1_uc010zzb.1_Missense_Mutation_p.K429R|BCAS1_uc010gim.2_Missense_Mutation_p.K359R|BCAS1_uc002xwt.2_Missense_Mutation_p.K489R|BCAS1_uc010gil.1_Missense_Mutation_p.K425R	NM_003657	NP_003648	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	503						cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			TGCTGACTTCTTGTCCTTCGA	0.537													36	100	---	---	---	---	capture	Missense_Mutation	SNP	52570143	52570143	BCAS1	20	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	1339	132
RAD54L2	23132	broad.mit.edu	37	3	51690165	51690165	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51690165C>T	uc011bdt.1	+	19	3330	c.3205C>T	c.(3205-3207)CAG>TAG	p.Q1069*	RAD54L2_uc003dbh.2_Nonsense_Mutation_p.Q658*|RAD54L2_uc011bdu.1_Nonsense_Mutation_p.Q763*|RAD54L2_uc003dbj.2_Nonsense_Mutation_p.Q395*	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2	1069						nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		AGTCCTTGTGCAGAAGGTGGT	0.458													23	55	---	---	---	---	capture	Nonsense_Mutation	SNP	51690165	51690165	RAD54L2	3	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	12889	132
DPPA2	151871	broad.mit.edu	37	3	109028077	109028077	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:109028077C>G	uc003dxo.2	-	4	529	c.282G>C	c.(280-282)AAG>AAC	p.K94N		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	94	SAP.					nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						CCCGACACACCTTATTAATGG	0.443													10	250	---	---	---	---	capture	Missense_Mutation	SNP	109028077	109028077	DPPA2	3	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	4689	132
PDGFRA	5156	broad.mit.edu	37	4	55133558	55133558	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55133558T>C	uc003han.3	+	6	1193	c.862T>C	c.(862-864)TAC>CAC	p.Y288H	PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Missense_Mutation_p.Y182H|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	288	Ig-like C2-type 3.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CAGTGGAGATTACGAATGTGC	0.473			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			78	68	---	---	---	---	capture	Missense_Mutation	SNP	55133558	55133558	PDGFRA	4	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	11564	132
RBM46	166863	broad.mit.edu	37	4	155720138	155720138	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155720138T>C	uc003ioo.2	+	4	997	c.824T>C	c.(823-825)TTT>TCT	p.F275S	RBM46_uc011cim.1_Missense_Mutation_p.F275S|RBM46_uc003iop.1_Missense_Mutation_p.F275S	NM_144979	NP_659416	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	275	RRM 3.						nucleotide binding|RNA binding			central_nervous_system(1)|skin(1)	2	all_hematologic(180;0.24)	Renal(120;0.0854)				GATTATGCTTTTGTTCACTTT	0.363													11	17	---	---	---	---	capture	Missense_Mutation	SNP	155720138	155720138	RBM46	4	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	13035	132
LPCAT1	79888	broad.mit.edu	37	5	1494825	1494825	+	Silent	SNP	C	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1494825C>A	uc003jcm.2	-	3	600	c.483G>T	c.(481-483)CCG>CCT	p.P161P		NM_024830	NP_079106	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	161	Lumenal (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TTCCCCAGATCGGGATGTCTC	0.597													31	15	---	---	---	---	capture	Silent	SNP	1494825	1494825	LPCAT1	5	C	A	A	A	1	0	0	0	0	0	0	0	1	392	31	4	4	8826	132
HSPB3	8988	broad.mit.edu	37	5	53751847	53751847	+	Silent	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:53751847C>T	uc003jph.1	+	1	403	c.228C>T	c.(226-228)GAC>GAT	p.D76D		NM_006308	NP_006299	Q12988	HSPB3_HUMAN	heat shock 27kDa protein 3	76					cell death|response to heat|response to unfolded protein	cytoplasm|nucleus					0		Lung NSC(810;0.00104)				TCCTGCTGGACGTGGTCCAGT	0.547													19	51	---	---	---	---	capture	Silent	SNP	53751847	53751847	HSPB3	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7346	132
CTNNA1	1495	broad.mit.edu	37	5	138221907	138221907	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:138221907C>T	uc003ldh.2	+	8	1164	c.1069C>T	c.(1069-1071)CGT>TGT	p.R357C	CTNNA1_uc011cyx.1_Missense_Mutation_p.R254C|CTNNA1_uc011cyy.1_Missense_Mutation_p.R234C|CTNNA1_uc003ldi.2_Missense_Mutation_p.R55C|CTNNA1_uc003ldj.2_Missense_Mutation_p.R357C|CTNNA1_uc003ldl.2_Translation_Start_Site	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	357	Interaction with alpha-actinin.				adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCAGGCTGGACGTAAAGAAAG	0.378													8	38	---	---	---	---	capture	Missense_Mutation	SNP	138221907	138221907	CTNNA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3975	132
PCDHGA9	56107	broad.mit.edu	37	5	140782734	140782734	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140782734C>T	uc003lkh.1	+	1	215	c.215C>T	c.(214-216)ACG>ATG	p.T72M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Missense_Mutation_p.T72M	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9 isoform 1	72	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGGTAGGACGCAGCTTTTC	0.622													32	76	---	---	---	---	capture	Missense_Mutation	SNP	140782734	140782734	PCDHGA9	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11464	132
BTNL8	79908	broad.mit.edu	37	5	180377067	180377067	+	Silent	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180377067C>T	uc003mmp.2	+	8	1260	c.1026C>T	c.(1024-1026)TAC>TAT	p.Y342Y	BTNL8_uc003mmq.2_3'UTR|BTNL8_uc011dhg.1_Silent_p.Y217Y|BTNL8_uc010jll.2_3'UTR|BTNL8_uc010jlm.2_Silent_p.Y226Y|BTNL8_uc011dhh.1_Silent_p.Y158Y	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor	342	B30.2/SPRY.|Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGAAACATTACTGGGAGGTGG	0.522													32	66	---	---	---	---	capture	Silent	SNP	180377067	180377067	BTNL8	5	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	1555	132
KIF13A	63971	broad.mit.edu	37	6	17772259	17772259	+	Silent	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17772259G>A	uc003ncg.3	-	37	4461	c.4356C>T	c.(4354-4356)ACC>ACT	p.T1452T	KIF13A_uc003ncf.2_Silent_p.T1439T|KIF13A_uc003nch.3_Silent_p.T1452T|KIF13A_uc003nci.3_Silent_p.T1439T|KIF13A_uc003nce.1_Silent_p.T38T	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	1452					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			AAGGGCTGACGGTTAAGGCAT	0.433													4	136	---	---	---	---	capture	Silent	SNP	17772259	17772259	KIF13A	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8196	132
DAXX	1616	broad.mit.edu	37	6	33289539	33289539	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33289539C>T	uc003oec.2	-	2	368	c.164G>A	c.(163-165)GGC>GAC	p.G55D	DAXX_uc011drd.1_Intron|DAXX_uc011dre.1_Missense_Mutation_p.G67D|DAXX_uc003oed.2_Missense_Mutation_p.G55D|DAXX_uc010juw.2_5'UTR	NM_001350	NP_001341	Q9UER7	DAXX_HUMAN	death-domain associated protein isoform a	55	Necessary for interaction with USP7.				activation of JUN kinase activity|androgen receptor signaling pathway|apoptosis|induction of apoptosis via death domain receptors|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|regulation of protein ubiquitination|transcription, DNA-dependent	chromosome, centromeric region|cytosol|nucleolus|PML body	androgen receptor binding|heat shock protein binding|p53 binding|protein homodimerization activity|protein N-terminus binding|receptor signaling protein activity|transcription factor binding|ubiquitin protein ligase binding			pancreas(18)|ovary(2)|skin(2)|prostate(1)	23						GCATTTCTTGCCGCCCGAACT	0.597			Mis|F|N		Pancreatic neuroendocrine tumors								6	452	---	---	---	---	capture	Missense_Mutation	SNP	33289539	33289539	DAXX	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4202	132
KPNA5	3841	broad.mit.edu	37	6	117023258	117023258	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117023258C>G	uc003pxh.2	+	6	643	c.512C>G	c.(511-513)GCT>GGT	p.A171G		NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5	168	ARM 3.|NLS binding site (major) (By similarity).				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		GAAACTGGGGCTGTTCCGATT	0.318													13	90	---	---	---	---	capture	Missense_Mutation	SNP	117023258	117023258	KPNA5	6	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	8353	132
UTRN	7402	broad.mit.edu	37	6	144757266	144757266	+	Missense_Mutation	SNP	A	T	T	rs150684617		TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:144757266A>T	uc003qkt.2	+	9	1143	c.1051A>T	c.(1051-1053)ACC>TCC	p.T351S	UTRN_uc010khq.1_Missense_Mutation_p.T351S	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	351	Interaction with SYNM.|Spectrin 2.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CCAGTTTGCAACCCATGAAGT	0.453													14	57	---	---	---	---	capture	Missense_Mutation	SNP	144757266	144757266	UTRN	6	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	16985	132
DMTF1	9988	broad.mit.edu	37	7	86811558	86811558	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86811558A>G	uc003uih.2	+	10	1051	c.725A>G	c.(724-726)CAT>CGT	p.H242R	DMTF1_uc003uii.2_5'UTR|DMTF1_uc003uij.2_5'UTR|DMTF1_uc011khb.1_Missense_Mutation_p.H154R|DMTF1_uc003uik.2_RNA|DMTF1_uc003uil.2_Missense_Mutation_p.H242R|DMTF1_uc003uin.2_5'UTR	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	242	Interaction with CCND1, CCND2 and CCND3 (By similarity).|Myb-like 1.|Required for DNA-binding (By similarity).				cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					CGGATAAAGCATGGCAATGAC	0.433													10	73	---	---	---	---	capture	Missense_Mutation	SNP	86811558	86811558	DMTF1	7	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	4550	132
TRPV5	56302	broad.mit.edu	37	7	142605705	142605705	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142605705T>C	uc003wby.1	-	15	2429	c.2165A>G	c.(2164-2166)GAT>GGT	p.D722G		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	722	Cytoplasmic (Potential).|Involved in Ca(2+)-dependent inactivation (By similarity).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					CTCCTCTCCATCCCCCTCACT	0.567													3	75	---	---	---	---	capture	Missense_Mutation	SNP	142605705	142605705	TRPV5	7	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	16482	132
PTK2B	2185	broad.mit.edu	37	8	27296903	27296903	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:27296903G>A	uc003xfn.1	+	25	2630	c.1822G>A	c.(1822-1824)GTC>ATC	p.V608I	PTK2B_uc003xfo.1_Missense_Mutation_p.V608I|PTK2B_uc003xfp.1_Missense_Mutation_p.V608I|PTK2B_uc003xfq.1_Missense_Mutation_p.V608I|PTK2B_uc003xfr.1_Missense_Mutation_p.V354I	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a	608	Protein kinase.				apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)		AGCCAGTGACGTCTGGATGTT	0.547													20	96	---	---	---	---	capture	Missense_Mutation	SNP	27296903	27296903	PTK2B	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12658	132
GEM	2669	broad.mit.edu	37	8	95264452	95264452	+	Splice_Site	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95264452C>T	uc003ygj.2	-	4	658	c.409_splice	c.e4-1	p.G137_splice	GEM_uc003ygi.2_Splice_Site_p.G137_splice	NM_005261	NP_005252	P55040	GEM_HUMAN	GTP-binding mitogen-induced T-cell protein						cell surface receptor linked signaling pathway|immune response|small GTPase mediated signal transduction	internal side of plasma membrane	calmodulin binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding			lung(1)	1	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)			CATTTTCCCCCTAATGAAACA	0.453													29	31	---	---	---	---	capture	Splice_Site	SNP	95264452	95264452	GEM	8	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	6269	132
ZFAT	57623	broad.mit.edu	37	8	135613849	135613849	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:135613849C>T	uc003yup.2	-	6	2288	c.2113G>A	c.(2113-2115)GCC>ACC	p.A705T	ZFAT_uc003yun.2_Missense_Mutation_p.A693T|ZFAT_uc003yuo.2_Missense_Mutation_p.A693T|ZFAT_uc010meh.2_Missense_Mutation_p.A693T|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Missense_Mutation_p.A693T|ZFAT_uc010mej.2_Missense_Mutation_p.A643T|ZFAT_uc003yur.2_Missense_Mutation_p.A693T	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	705					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TGCTCAGGGGCAGCTTTGCAA	0.557													48	61	---	---	---	---	capture	Missense_Mutation	SNP	135613849	135613849	ZFAT	8	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	17512	132
DOCK8	81704	broad.mit.edu	37	9	439344	439344	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:439344G>A	uc003zgf.2	+	40	5291	c.5179G>A	c.(5179-5181)GGC>AGC	p.G1727S	DOCK8_uc010mgu.2_Missense_Mutation_p.G1029S|DOCK8_uc010mgv.2_Missense_Mutation_p.G1627S|DOCK8_uc003zgk.2_Missense_Mutation_p.G1185S	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1727	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CACCGAGAGTGGCCTGGTAGG	0.622													42	7	---	---	---	---	capture	Missense_Mutation	SNP	439344	439344	DOCK8	9	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	4649	132
COL15A1	1306	broad.mit.edu	37	9	101788194	101788194	+	Silent	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101788194G>A	uc004azb.1	+	16	2195	c.1989G>A	c.(1987-1989)GAG>GAA	p.E663E		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	663	Triple-helical region 2 (COL2).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				AGGGCCCTGAGGGACAGCCTG	0.582													12	5	---	---	---	---	capture	Silent	SNP	101788194	101788194	COL15A1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	3637	132
ABCA1	19	broad.mit.edu	37	9	107555100	107555100	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107555100C>G	uc004bcl.2	-	42	6037	c.5724G>C	c.(5722-5724)CAG>CAC	p.Q1908H		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1908					Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGATGTCATTCTGGCCTCCAC	0.423													15	40	---	---	---	---	capture	Missense_Mutation	SNP	107555100	107555100	ABCA1	9	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	28	132
GBGT1	26301	broad.mit.edu	37	9	136031442	136031442	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136031442G>T	uc004ccw.2	-	4	429	c.148C>A	c.(148-150)CTG>ATG	p.L50M	RALGDS_uc011mcw.1_Missense_Mutation_p.A62D|GBGT1_uc004ccx.2_Missense_Mutation_p.L3M|GBGT1_uc010nab.2_Missense_Mutation_p.L50M|GBGT1_uc011mcx.1_Intron|GBGT1_uc010nac.1_Translation_Start_Site|GBGT1_uc004ccy.1_Missense_Mutation_p.L50M	NM_021996	NP_068836	Q8N5D6	GBGT1_HUMAN	globoside	50	Lumenal (Potential).				carbohydrate metabolic process|glycolipid biosynthetic process	Golgi membrane|integral to membrane	metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		TTGTAGTGCAGCTTCATGTTG	0.567													22	0	---	---	---	---	capture	Missense_Mutation	SNP	136031442	136031442	GBGT1	9	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	6212	132
GRPR	2925	broad.mit.edu	37	X	16142166	16142166	+	Silent	SNP	G	A	A			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:16142166G>A	uc004cxj.2	+	1	743	c.90G>A	c.(88-90)GTG>GTA	p.V30V		NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	30	Extracellular (Potential).				cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)|lung(1)	4	Hepatocellular(33;0.183)					ATCTCCCCGTGAACGATGACT	0.478											OREG0019682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	139	---	---	---	---	capture	Silent	SNP	16142166	16142166	GRPR	23	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	6741	132
FOXR2	139628	broad.mit.edu	37	X	55650332	55650332	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55650332G>C	uc004duo.2	+	1	500	c.188G>C	c.(187-189)AGG>ACG	p.R63T		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	63					embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						CCTCAGAAGAGGAGACCCAGT	0.537													12	21	---	---	---	---	capture	Missense_Mutation	SNP	55650332	55650332	FOXR2	23	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	5976	132
MAGEA5	4104	broad.mit.edu	37	X	151283896	151283896	+	Silent	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151283896C>T	uc004ffj.2	-	3	322	c.117G>A	c.(115-117)GTG>GTA	p.V39V		NM_021049	NP_066387	P43359	MAGA5_HUMAN	melanoma antigen family A, 5	39	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					AGGAGGAGGACACAGCCTCCT	0.647													25	34	---	---	---	---	capture	Silent	SNP	151283896	151283896	MAGEA5	23	C	T	T	T	1	0	0	0	0	0	0	0	1	210	17	2	2	9083	132
OPN1MW	2652	broad.mit.edu	37	X	153490645	153490645	+	Silent	SNP	C	T	T			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153490645C>T	uc004fkd.2	+	2	463	c.381C>T	c.(379-381)GTC>GTT	p.V127V		NM_000513	NP_000504	P04001	OPSG_HUMAN	opsin 1 (cone pigments), medium-wave-sensitive	127	Extracellular.				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTATGTGTGTCCTGGAGGGCT	0.617													27	36	---	---	---	---	capture	Silent	SNP	153490645	153490645	OPN1MW	23	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	10782	132
BCL11B	64919	broad.mit.edu	37	14	99642350	99642351	+	Frame_Shift_Ins	INS	-	CA	CA			TCGA-14-0740-01	TCGA-14-0740-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:99642350_99642351insCA	uc001yga.2	-	4	1089_1090	c.822_823insTG	c.(820-825)GTGGCGfs	p.V274fs	BCL11B_uc001ygb.2_Frame_Shift_Ins_p.V203fs	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1	274_275						nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GGGGACTGCGCCACGGCCTCCG	0.718			T	TLX3	T-ALL								5	4	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	99642350	99642351	BCL11B	14	-	CA	CA	CA	1	0	1	1	0	0	0	0	0	338	26	5	5	1353	132
