Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
WDR8	49856	broad.mit.edu	37	1	3548093	3548093	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3548093C>T	uc001ako.2	-	11	1285	c.1177G>A	c.(1177-1179)GGA>AGA	p.G393R	WDR8_uc001akn.3_Missense_Mutation_p.G393R	NM_017818	NP_060288	Q9P2S5	WRP73_HUMAN	WD repeat domain 8	393	WD 6.					centrosome	protein binding				0	all_cancers(77;0.0128)|all_epithelial(69;0.00526)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;4.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.16e-22)|GBM - Glioblastoma multiforme(42;1.05e-14)|Colorectal(212;1.19e-05)|BRCA - Breast invasive adenocarcinoma(365;2.67e-05)|COAD - Colon adenocarcinoma(227;5.82e-05)|Kidney(185;0.000364)|KIRC - Kidney renal clear cell carcinoma(229;0.00223)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CTGCTGCCTCCCGTGCAGATG	0.667													8	11	---	---	---	---	capture	Missense_Mutation	SNP	3548093	3548093	WDR8	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	17210	134
OMA1	115209	broad.mit.edu	37	1	58946683	58946683	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:58946683T>C	uc001cyy.2	-	9	1617	c.1529A>G	c.(1528-1530)GAG>GGG	p.E510G	DAB1_uc001cyt.1_Intron|OMA1_uc001cyx.1_Intron	NM_145243	NP_660286	Q96E52	OMA1_HUMAN	OMA1 homolog, zinc metallopeptidase precursor	510					proteolysis	integral to membrane|mitochondrial membrane	metal ion binding|metalloendopeptidase activity			large_intestine(1)	1	all_cancers(7;6.54e-05)					TGGTATTTGCTCCTGTTTTTG	0.328													4	211	---	---	---	---	capture	Missense_Mutation	SNP	58946683	58946683	OMA1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10768	134
GJA8	2703	broad.mit.edu	37	1	147380346	147380346	+	Silent	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147380346G>A	uc001epu.1	+	2	327	c.264G>A	c.(262-264)CCG>CCA	p.P88P		NM_005267	NP_005258	P48165	CXA8_HUMAN	connexin 50	88	Helical; (Potential).		P -> S (in CZP1).		cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.0276)					TCTCCACCCCGTCCCTGATGT	0.642													57	50	---	---	---	---	capture	Silent	SNP	147380346	147380346	GJA8	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	6342	134
LAMB3	3914	broad.mit.edu	37	1	209803992	209803992	+	Missense_Mutation	SNP	G	A	A	rs114394307	by1000genomes	TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209803992G>A	uc001hhg.2	-	8	1301	c.911C>T	c.(910-912)CCG>CTG	p.P304L	LAMB3_uc009xco.2_Missense_Mutation_p.P304L|LAMB3_uc001hhh.2_Missense_Mutation_p.P304L|LAMB3_uc010psl.1_RNA|LAMB3_uc009xcp.1_Missense_Mutation_p.P240L	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	304	Laminin EGF-like 1.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GCCCTCCGCCGGTCTCCAGGG	0.622													3	74	---	---	---	---	capture	Missense_Mutation	SNP	209803992	209803992	LAMB3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8532	134
RYR2	6262	broad.mit.edu	37	1	237774131	237774131	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237774131C>T	uc001hyl.1	+	36	4873	c.4753C>T	c.(4753-4755)CGC>TGC	p.R1585C		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1585	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTGCCCCCCGCGCCTCCACGT	0.537													8	6	---	---	---	---	capture	Missense_Mutation	SNP	237774131	237774131	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13661	134
ITIH5	80760	broad.mit.edu	37	10	7679260	7679260	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:7679260C>T	uc001ijq.2	-	5	662	c.583G>A	c.(583-585)GCG>ACG	p.A195T	ITIH5_uc001ijr.1_Missense_Mutation_p.A195T	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	195					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						GCGATGCCCGCGCTCTCCAGG	0.662													71	13	---	---	---	---	capture	Missense_Mutation	SNP	7679260	7679260	ITIH5	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7830	134
C10orf54	64115	broad.mit.edu	37	10	73521395	73521395	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:73521395C>G	uc001jsd.2	-	2	612	c.471G>C	c.(469-471)GAG>GAC	p.E157D	CDH23_uc001jrx.3_Intron|C10orf54_uc001jse.2_Missense_Mutation_p.E25D|C10orf54_uc009xqm.2_Intron|C10orf54_uc001jsf.1_Missense_Mutation_p.E157D	NM_022153	NP_071436	Q9H7M9	GI24_HUMAN	platelet receptor Gi24 precursor	157	Ig-like.|Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)|central_nervous_system(1)	3						GGACCCTGTGCTCCGAGTGGT	0.617													2	8	---	---	---	---	capture	Missense_Mutation	SNP	73521395	73521395	C10orf54	10	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	1595	134
KCNQ1	3784	broad.mit.edu	37	11	2592573	2592573	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2592573C>T	uc001lwn.2	+	4	731	c.623C>T	c.(622-624)GCC>GTC	p.A208V	KCNQ1_uc009ydp.1_Intron|KCNQ1_uc001lwo.2_Missense_Mutation_p.A81V	NM_000218	NP_000209	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like	208	Helical; Name=Segment S3; (Potential).				blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	GTGGTCGTGGCCTCCATGGTG	0.652													29	32	---	---	---	---	capture	Missense_Mutation	SNP	2592573	2592573	KCNQ1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8004	134
LDHAL6A	160287	broad.mit.edu	37	11	18487327	18487327	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18487327C>G	uc001mop.1	+	4	649	c.388C>G	c.(388-390)CAC>GAC	p.H130D	LDHAL6A_uc001moq.2_Missense_Mutation_p.H130D	NM_001144071	NP_001137543	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A	130					glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	GTACAGTCCTCACTGCAAACT	0.279													57	160	---	---	---	---	capture	Missense_Mutation	SNP	18487327	18487327	LDHAL6A	11	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	8619	134
ANO5	203859	broad.mit.edu	37	11	22215065	22215065	+	Silent	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22215065G>A	uc001mqi.2	+	1	344	c.27G>A	c.(25-27)GTG>GTA	p.V9V	ANO5_uc001mqj.2_Silent_p.V9V	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	9	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						TCCTGGAAGTGTTGGCGGAGG	0.667													13	7	---	---	---	---	capture	Silent	SNP	22215065	22215065	ANO5	11	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	694	134
CKAP5	9793	broad.mit.edu	37	11	46801800	46801800	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46801800A>G	uc001ndi.1	-	20	2487	c.2377T>C	c.(2377-2379)TTC>CTC	p.F793L	CKAP5_uc009ylg.1_Missense_Mutation_p.F679L|CKAP5_uc001ndj.1_Missense_Mutation_p.F793L	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	793					cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						TCCTCAAAGAACATTCGCAAA	0.428													3	88	---	---	---	---	capture	Missense_Mutation	SNP	46801800	46801800	CKAP5	11	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	3410	134
OR4C3	256144	broad.mit.edu	37	11	48346804	48346804	+	Silent	SNP	T	C	C			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48346804T>C	uc010rhv.1	+	1	312	c.312T>C	c.(310-312)CCT>CCC	p.P104P		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	77	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTATGGCTCCTAAACTCATTG	0.463													14	340	---	---	---	---	capture	Silent	SNP	48346804	48346804	OR4C3	11	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	10954	134
OR10V1	390201	broad.mit.edu	37	11	59480721	59480721	+	Silent	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59480721G>A	uc001nof.1	-	1	598	c.598C>T	c.(598-600)CTG>TTG	p.L200L		NM_001005324	NP_001005324	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V,	200	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATGATATACAGAGCAGTCTTG	0.498													44	69	---	---	---	---	capture	Silent	SNP	59480721	59480721	OR10V1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	10824	134
USP15	9958	broad.mit.edu	37	12	62777954	62777954	+	Silent	SNP	T	C	C			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:62777954T>C	uc001src.1	+	11	1353	c.1344T>C	c.(1342-1344)TGT>TGC	p.C448C	USP15_uc001srb.1_Silent_p.C419C	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	448					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		CTTTAGTTTGTCCTGAGTGTG	0.358													58	76	---	---	---	---	capture	Silent	SNP	62777954	62777954	USP15	12	T	C	C	C	1	0	0	0	0	0	0	0	1	751	58	3	3	16928	134
ADAM21	8747	broad.mit.edu	37	14	70926319	70926319	+	Silent	SNP	C	T	T	rs142273524	byFrequency	TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:70926319C>T	uc001xmd.2	+	1	2103	c.2103C>T	c.(2101-2103)GTC>GTT	p.V701V		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	701	Helical; (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)|skin(1)	2				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGTTTACTGTCGGGCTTCTTA	0.413													79	90	---	---	---	---	capture	Silent	SNP	70926319	70926319	ADAM21	14	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	243	134
ZDHHC1	29800	broad.mit.edu	37	16	67429021	67429021	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67429021A>T	uc010vjm.1	-	10	1418	c.1114T>A	c.(1114-1116)TCG>ACG	p.S372T	TPPP3_uc002eta.2_5'Flank|TPPP3_uc002etb.2_5'Flank	NM_013304	NP_037436	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	372						integral to membrane	DNA binding|zinc ion binding				0		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		AGCAGAGGCGAGCGCCAGGGT	0.622													8	19	---	---	---	---	capture	Missense_Mutation	SNP	67429021	67429021	ZDHHC1	16	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	17480	134
KRTAP3-3	85293	broad.mit.edu	37	17	39150169	39150169	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39150169A>G	uc002hvr.1	-	1	217	c.181T>C	c.(181-183)TGC>CGC	p.C61R		NM_033185	NP_149441	Q9BYR6	KRA33_HUMAN	keratin associated protein 3-3	61						keratin filament	structural molecule activity				0		Breast(137;0.00043)				GTGGGCACGCAGGGCTGAGGA	0.627													3	107	---	---	---	---	capture	Missense_Mutation	SNP	39150169	39150169	KRTAP3-3	17	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	8467	134
ARHGAP28	79822	broad.mit.edu	37	18	6859874	6859874	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6859874C>T	uc010wzi.1	+	4	411	c.173C>T	c.(172-174)GCG>GTG	p.A58V	ARHGAP28_uc002knc.2_Missense_Mutation_p.A183V|ARHGAP28_uc002knd.2_Missense_Mutation_p.A76V|ARHGAP28_uc002kne.2_Missense_Mutation_p.A76V|ARHGAP28_uc002knf.2_Missense_Mutation_p.A67V			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;	58					signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				GGGAGTTTTGCGGTTCCCAGG	0.433													5	194	---	---	---	---	capture	Missense_Mutation	SNP	6859874	6859874	ARHGAP28	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	870	134
ABCA7	10347	broad.mit.edu	37	19	1042173	1042173	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1042173C>T	uc002lqw.3	+	5	644	c.413C>T	c.(412-414)ACG>ATG	p.T138M	ABCA7_uc010dsb.1_5'Flank|ABCA7_uc010dsa.2_Missense_Mutation_p.T138M	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	138	Extracellular (By similarity).				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACGCAGCACGGGTGAGGAG	0.692													7	22	---	---	---	---	capture	Missense_Mutation	SNP	1042173	1042173	ABCA7	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	37	134
PPM1N	147699	broad.mit.edu	37	19	46003206	46003206	+	Splice_Site	SNP	G	C	C			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46003206G>C	uc002pce.2	+	2	940	c.940_splice	c.e2-1	p.G314_splice	RTN2_uc002pcb.2_5'Flank|RTN2_uc002pcc.2_5'Flank|RTN2_uc002pcd.2_5'Flank|PPM1N_uc002pcf.2_Splice_Site	NM_001080401	NP_001073870	Q8N819	PPM1N_HUMAN	protein phosphatase 1B-like								magnesium ion binding|manganese ion binding|phosphoprotein phosphatase activity				0						ACCGGCTTCAGGGCAGCCTGG	0.607													5	7	---	---	---	---	capture	Splice_Site	SNP	46003206	46003206	PPM1N	19	G	C	C	C	1	0	0	0	0	0	0	1	0	455	35	5	4	12247	134
ZSCAN5B	342933	broad.mit.edu	37	19	56701423	56701423	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56701423C>T	uc010ygh.1	-	4	1261	c.1261G>A	c.(1261-1263)GCC>ACC	p.A421T		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	421	C2H2-type 3.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						GACTCGTGGGCGAACCGCTTT	0.567													33	41	---	---	---	---	capture	Missense_Mutation	SNP	56701423	56701423	ZSCAN5B	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	18115	134
CAD	790	broad.mit.edu	37	2	27465785	27465785	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27465785C>A	uc002rji.2	+	42	6586	c.6424C>A	c.(6424-6426)CTC>ATC	p.L2142I	CAD_uc010eyw.2_Missense_Mutation_p.L2079I	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	2142	ATCase (Aspartate transcarbamylase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CACTGATGTGCTCTACATGAC	0.582													29	35	---	---	---	---	capture	Missense_Mutation	SNP	27465785	27465785	CAD	2	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	2541	134
PRKD3	23683	broad.mit.edu	37	2	37501816	37501816	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37501816G>C	uc002rqd.2	-	10	1954	c.1399C>G	c.(1399-1401)CGC>GGC	p.R467G	PRKD3_uc002rqe.1_Missense_Mutation_p.R67G|PRKD3_uc002rqf.1_Missense_Mutation_p.R467G	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3	467	PH.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				GAAGATATGCGGAGAATTTCT	0.318													43	48	---	---	---	---	capture	Missense_Mutation	SNP	37501816	37501816	PRKD3	2	G	C	C	C	1	0	0	0	0	1	0	0	0	507	39	4	4	12416	134
ST6GAL2	84620	broad.mit.edu	37	2	107460204	107460204	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107460204C>T	uc002tdq.2	-	2	349	c.230G>A	c.(229-231)CGC>CAC	p.R77H	ST6GAL2_uc002tdr.2_Missense_Mutation_p.R77H|ST6GAL2_uc002tds.3_Missense_Mutation_p.R77H	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	77	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						CAGCGCCTGGCGTGCGTCCAG	0.677													27	43	---	---	---	---	capture	Missense_Mutation	SNP	107460204	107460204	ST6GAL2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15112	134
PPIG	9360	broad.mit.edu	37	2	170493100	170493100	+	Missense_Mutation	SNP	A	C	C			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170493100A>C	uc002uez.2	+	14	1552	c.1332A>C	c.(1330-1332)AAA>AAC	p.K444N	PPIG_uc010fpx.2_Missense_Mutation_p.K429N|PPIG_uc010fpy.2_Missense_Mutation_p.K437N|PPIG_uc002ufb.2_Missense_Mutation_p.K444N|PPIG_uc002ufd.2_Missense_Mutation_p.K441N	NM_004792	NP_004783	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G	444					protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|central_nervous_system(1)	3					L-Proline(DB00172)	ATTCAGAAAAAGATGACAAGT	0.313													25	27	---	---	---	---	capture	Missense_Mutation	SNP	170493100	170493100	PPIG	2	A	C	C	C	1	0	0	0	0	1	0	0	0	37	3	4	4	12225	134
KRTAP19-2	337969	broad.mit.edu	37	21	31859635	31859635	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31859635G>T	uc011acy.1	-	1	33	c.33C>A	c.(31-33)AGC>AGA	p.S11R		NM_181608	NP_853639	Q3LHN2	KR192_HUMAN	keratin associated protein 19-2	11						intermediate filament					0						GTCTGCAGAAGCTGCCACATC	0.572													46	84	---	---	---	---	capture	Missense_Mutation	SNP	31859635	31859635	KRTAP19-2	21	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	8449	134
TMPRSS3	64699	broad.mit.edu	37	21	43803237	43803237	+	Silent	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43803237G>A	uc002zbb.2	-	8	888	c.687C>T	c.(685-687)CCC>CCT	p.P229P	TMPRSS3_uc002zay.2_5'UTR|TMPRSS3_uc002zaz.2_Silent_p.P102P|TMPRSS3_uc002zba.2_Silent_p.P102P|TMPRSS3_uc002zbc.2_Silent_p.P229P|TMPRSS3_uc002zbd.2_Silent_p.P229P	NM_024022	NP_076927	P57727	TMPS3_HUMAN	transmembrane protease, serine 3 isoform 1	229	Peptidase S1.|Extracellular (Potential).				cellular sodium ion homeostasis|proteolysis	endoplasmic reticulum membrane|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity|sodium channel regulator activity			ovary(2)|breast(1)	3						TGGCCTGCCAGGGCCACTGCG	0.587													25	42	---	---	---	---	capture	Silent	SNP	43803237	43803237	TMPRSS3	21	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	16131	134
C22orf24	25775	broad.mit.edu	37	22	32334001	32334001	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32334001T>C	uc003aly.2	-	2	219	c.52A>G	c.(52-54)ACC>GCC	p.T18A	C22orf24_uc003alx.2_RNA	NM_015372	NP_056187	Q9Y442	CV024_HUMAN	hypothetical protein LOC25775	18						integral to membrane				central_nervous_system(1)	1						CTTGACATGGTCCAAAGACTT	0.413													182	237	---	---	---	---	capture	Missense_Mutation	SNP	32334001	32334001	C22orf24	22	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	2119	134
C3orf20	84077	broad.mit.edu	37	3	14802983	14802983	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14802983T>A	uc003byy.2	+	15	2760	c.2356T>A	c.(2356-2358)TTT>ATT	p.F786I	C3orf20_uc003byz.2_Missense_Mutation_p.F664I|C3orf20_uc003bza.2_Missense_Mutation_p.F664I|C3orf20_uc003bzb.1_Missense_Mutation_p.F287I|C3orf20_uc011avj.1_Missense_Mutation_p.F113I	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	786	Helical; (Potential).					cytoplasm|integral to membrane				ovary(3)|skin(1)	4						TCAACAGATGTTTGCCGGGGG	0.483													49	60	---	---	---	---	capture	Missense_Mutation	SNP	14802983	14802983	C3orf20	3	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	2193	134
NR2C2	7182	broad.mit.edu	37	3	15079601	15079601	+	Silent	SNP	C	G	G			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15079601C>G	uc003bzj.3	+	12	1684	c.1467C>G	c.(1465-1467)GGC>GGG	p.G489G	NR2C2_uc003bzi.2_Silent_p.G508G	NM_003298	NP_003289	P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	489	Ligand-binding (By similarity).				cell differentiation|nervous system development|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0						ATATAGATGGCTATGAGTATG	0.453													68	101	---	---	---	---	capture	Silent	SNP	15079601	15079601	NR2C2	3	C	G	G	G	1	0	0	0	0	0	0	0	1	353	28	4	4	10530	134
HSPBAP1	79663	broad.mit.edu	37	3	122459942	122459942	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122459942G>A	uc003efu.1	-	7	967	c.844C>T	c.(844-846)CGG>TGG	p.R282W	HSPBAP1_uc003eft.1_5'UTR	NM_024610	NP_078886	Q96EW2	HBAP1_HUMAN	Hspb associated protein 1	282	JmjC.					cytoplasm				ovary(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.0531)		TCTTCTACCCGGGCTAGGTGA	0.423													61	64	---	---	---	---	capture	Missense_Mutation	SNP	122459942	122459942	HSPBAP1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	7350	134
SLIT2	9353	broad.mit.edu	37	4	20541195	20541195	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:20541195C>A	uc003gpr.1	+	19	2168	c.1964C>A	c.(1963-1965)TCT>TAT	p.S655Y	SLIT2_uc003gps.1_Missense_Mutation_p.S647Y	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	655					apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						ACTCTCCATTCTTTATCTACT	0.299													55	81	---	---	---	---	capture	Missense_Mutation	SNP	20541195	20541195	SLIT2	4	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	14632	134
BANK1	55024	broad.mit.edu	37	4	102946614	102946614	+	Silent	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:102946614G>A	uc003hvy.3	+	9	1816	c.1542G>A	c.(1540-1542)CCG>CCA	p.P514P	BANK1_uc003hvx.3_Silent_p.P499P|BANK1_uc010ill.2_Silent_p.P381P|BANK1_uc003hvz.3_Silent_p.P484P	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	514					B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TCCCCCCGCCGCGACCTGTAG	0.433													21	32	---	---	---	---	capture	Silent	SNP	102946614	102946614	BANK1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1298	134
FHDC1	85462	broad.mit.edu	37	4	153897835	153897835	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:153897835G>A	uc003inf.2	+	11	3467	c.3392G>A	c.(3391-3393)CGG>CAG	p.R1131Q		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	1131					actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					GACTCCAGTCGGACCACGCTG	0.637													4	5	---	---	---	---	capture	Missense_Mutation	SNP	153897835	153897835	FHDC1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5822	134
POU4F3	5459	broad.mit.edu	37	5	145719603	145719603	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145719603C>A	uc003loa.2	+	2	702	c.613C>A	c.(613-615)CAG>AAG	p.Q205K		NM_002700	NP_002691	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	205	POU-specific.				sensory perception of sound|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGGGTGACCCAGGCGGACGT	0.657													4	79	---	---	---	---	capture	Missense_Mutation	SNP	145719603	145719603	POU4F3	5	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	12181	134
HIST1H2AA	221613	broad.mit.edu	37	6	25726720	25726720	+	Silent	SNP	G	A	A	rs150563946	byFrequency	TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25726720G>A	uc003nfc.2	-	1	71	c.36C>T	c.(34-36)CGC>CGT	p.R12R	HIST1H2BA_uc003nfd.2_5'Flank	NM_170745	NP_734466	Q96QV6	H2A1A_HUMAN	histone cluster 1, H2aa	12					nucleosome assembly	nucleosome|nucleus	DNA binding				0						TAGACTTGGCGCGTGCTTTTC	0.532													49	93	---	---	---	---	capture	Silent	SNP	25726720	25726720	HIST1H2AA	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7053	134
BTN3A3	10384	broad.mit.edu	37	6	26452287	26452287	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26452287A>G	uc003nhz.2	+	11	1583	c.1403A>G	c.(1402-1404)GAG>GGG	p.E468G	BTN3A3_uc003nia.2_Missense_Mutation_p.E426G|BTN3A3_uc011dkn.1_Missense_Mutation_p.E419G	NM_006994	NP_008925	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3 isoform a	468	B30.2/SPRY.|Cytoplasmic (Potential).					integral to membrane					0						CTGGACTATGAGACTGGAGAG	0.483													3	187	---	---	---	---	capture	Missense_Mutation	SNP	26452287	26452287	BTN3A3	6	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	1552	134
EEF1A1	1915	broad.mit.edu	37	6	74229196	74229196	+	Missense_Mutation	SNP	A	C	C			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74229196A>C	uc003phi.2	-	2	225	c.188T>G	c.(187-189)CTG>CGG	p.L63R	EEF1A1_uc003phd.2_5'Flank|EEF1A1_uc003phe.2_Missense_Mutation_p.L63R|EEF1A1_uc003phf.2_Missense_Mutation_p.L63R|EEF1A1_uc003phg.2_Missense_Mutation_p.L63R|EEF1A1_uc003phh.2_Intron|EEF1A1_uc003phj.2_Missense_Mutation_p.L63R|EEF1A1_uc003phk.2_Missense_Mutation_p.L63R|EEF1A1_uc003phl.2_Missense_Mutation_p.L63R|EEF1A1_uc003phm.1_Intron	NM_001402	NP_001393	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha	63						cytosol|eukaryotic translation elongation factor 1 complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0						CTCAGCTTTCAGTTTATCCAA	0.428											OREG0003890	type=REGULATORY REGION|Gene=LOC477388|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	86	127	---	---	---	---	capture	Missense_Mutation	SNP	74229196	74229196	EEF1A1	6	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	4878	134
IQCE	23288	broad.mit.edu	37	7	2611279	2611279	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2611279G>A	uc003smo.3	+	4	434	c.250G>A	c.(250-252)GCA>ACA	p.A84T	IQCE_uc010ksm.1_Missense_Mutation_p.A84T|IQCE_uc003sml.1_Missense_Mutation_p.A84T|IQCE_uc011jvy.1_Missense_Mutation_p.A68T|IQCE_uc011jvz.1_Missense_Mutation_p.A19T|IQCE_uc003smk.3_Missense_Mutation_p.A68T|IQCE_uc003smn.3_Missense_Mutation_p.A19T	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1	84											0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		GCTGGGAACCGCAAAGCCAGG	0.572													4	137	---	---	---	---	capture	Missense_Mutation	SNP	2611279	2611279	IQCE	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7729	134
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			793	154	---	---	---	---	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	134
HBP1	26959	broad.mit.edu	37	7	106829793	106829793	+	Silent	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106829793C>T	uc003vdy.2	+	7	1008	c.822C>T	c.(820-822)GGC>GGT	p.G274G	HBP1_uc011klv.1_Silent_p.G284G|HBP1_uc003vdz.2_Silent_p.G274G|HBP1_uc003vea.2_Silent_p.G274G|HBP1_uc003veb.1_Silent_p.G274G	NM_012257	NP_036389	O60381	HBP1_HUMAN	HMG-box transcription factor 1	274	AXH.				cell cycle arrest|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	DNA binding			skin(1)	1						TATCATTTGGCGAGTCTGTAC	0.368													71	174	---	---	---	---	capture	Silent	SNP	106829793	106829793	HBP1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6912	134
SLC30A8	169026	broad.mit.edu	37	8	118170045	118170045	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:118170045G>A	uc003yoh.2	+	4	764	c.534G>A	c.(532-534)ATG>ATA	p.M178I	SLC30A8_uc010mcz.2_Missense_Mutation_p.M129I|SLC30A8_uc011lia.1_Missense_Mutation_p.M129I|SLC30A8_uc003yog.2_Missense_Mutation_p.M129I	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	178	Helical; (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			CGACTGTGATGATCATCGTTT	0.547													70	130	---	---	---	---	capture	Missense_Mutation	SNP	118170045	118170045	SLC30A8	8	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	14453	134
NFKBIL2	4796	broad.mit.edu	37	8	145662013	145662013	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145662013C>T	uc011llg.1	-	16	1957	c.1942G>A	c.(1942-1944)GAC>AAC	p.D648N	uc011llh.1_Intron	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	648					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			AGGTCCAGGTCCCTGCGGTAC	0.682													26	43	---	---	---	---	capture	Missense_Mutation	SNP	145662013	145662013	NFKBIL2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	10289	134
ABO	28	broad.mit.edu	37	9	136136731	136136731	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136136731G>A	uc004cda.1	-	3	170	c.145C>T	c.(145-147)CGG>TGG	p.R49W	ABO_uc010naf.1_Translation_Start_Site|ABO_uc011mcz.1_Translation_Start_Site|ABO_uc010nag.1_Intron	NM_020469	NP_065202	P16442	BGAT_HUMAN	ABO blood group (alpha	49	Helical; Signal-anchor for type II membrane protein; (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	fucosylgalactoside 3-alpha-galactosyltransferase activity|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity|metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)		CAGAACCCCCGTTCCAGGCTT	0.607													6	6	---	---	---	---	capture	Missense_Mutation	SNP	136136731	136136731	ABO	9	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	97	134
NLGN4X	57502	broad.mit.edu	37	X	5811156	5811156	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:5811156G>T	uc010ndh.2	-	6	2654	c.2153C>A	c.(2152-2154)ACA>AAA	p.T718K	NLGN4X_uc004crp.2_Missense_Mutation_p.T738K|NLGN4X_uc004crq.2_Missense_Mutation_p.T718K|NLGN4X_uc010ndi.2_Missense_Mutation_p.T755K|NLGN4X_uc004crr.2_Missense_Mutation_p.T718K|NLGN4X_uc010ndj.2_Missense_Mutation_p.T718K	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	718	Cytoplasmic (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						GATATCATTTGTGGTGTTTCT	0.522													48	89	---	---	---	---	capture	Missense_Mutation	SNP	5811156	5811156	NLGN4X	23	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	10371	134
SSX3	10214	broad.mit.edu	37	X	48209558	48209558	+	Splice_Site	SNP	C	T	T			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48209558C>T	uc004djd.1	-	6	425	c.331_splice	c.e6-1	p.I111_splice	SSX3_uc004dje.2_Splice_Site_p.I111_splice	NM_021014	NP_066294	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						TGGGCATGATCTTTATAATGT	0.323													223	311	---	---	---	---	capture	Splice_Site	SNP	48209558	48209558	SSX3	23	C	T	T	T	1	0	0	0	0	0	0	1	0	416	32	5	2	15097	134
KCND1	3750	broad.mit.edu	37	X	48822565	48822565	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48822565G>A	uc004dlx.1	-	5	3188	c.1615C>T	c.(1615-1617)CGC>TGC	p.R539C	KCND1_uc004dlw.1_Missense_Mutation_p.R162C	NM_004979	NP_004970	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related	539	Cytoplasmic (Potential).					voltage-gated potassium channel complex	metal ion binding|voltage-gated potassium channel activity			ovary(2)|lung(1)	3						ATGGCGCGGCGCTTGGCCCTG	0.682													14	26	---	---	---	---	capture	Missense_Mutation	SNP	48822565	48822565	KCND1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7940	134
KIAA1210	57481	broad.mit.edu	37	X	118222577	118222577	+	Silent	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118222577G>A	uc004era.3	-	11	2616	c.2616C>T	c.(2614-2616)GAC>GAT	p.D872D		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	872										ovary(4)|skin(1)	5						TGAGAGGCAGGTCTTCCTCTG	0.448													25	52	---	---	---	---	capture	Silent	SNP	118222577	118222577	KIAA1210	23	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	8136	134
MAGEC2	51438	broad.mit.edu	37	X	141291256	141291256	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:141291256T>G	uc004fbu.1	-	3	866	c.518A>C	c.(517-519)AAG>ACG	p.K173T		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	173	MAGE.					cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					ATCTTTGTACTTGATGACAAT	0.478										HNSCC(46;0.14)			201	312	---	---	---	---	capture	Missense_Mutation	SNP	141291256	141291256	MAGEC2	23	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	9095	134
MAGEA6	4105	broad.mit.edu	37	X	151870086	151870086	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151870086G>A	uc004ffq.1	+	3	970	c.776G>A	c.(775-777)CGG>CAG	p.R259Q	MAGEA6_uc004ffr.1_Missense_Mutation_p.R259Q|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	259	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGAGTACCGGCAGGTCCCC	0.522													7	285	---	---	---	---	capture	Missense_Mutation	SNP	151870086	151870086	MAGEA6	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9084	134
SFRS2IP	9169	broad.mit.edu	37	12	46320707	46320708	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:46320707_46320708delTC	uc001rox.2	-	11	3063_3064	c.2776_2777delGA	c.(2776-2778)GAAfs	p.E926fs	SFRS2IP_uc001row.2_Frame_Shift_Del_p.E611fs|SFRS2IP_uc001roy.1_Frame_Shift_Del_p.E1000fs	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	926	Arg-rich.				spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		GGTTCTCCTTTCTCTCTCTCTC	0.446													7	437	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	46320707	46320708	SFRS2IP	12	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	14070	134
C22orf43	51233	broad.mit.edu	37	22	23959767	23959769	+	In_Frame_Del	DEL	CAT	-	-			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:23959767_23959769delCAT	uc002zxf.2	-	7	789_791	c.512_514delATG	c.(511-516)GATGCC>GCC	p.D171del		NM_016449	NP_057533	Q6PGQ1	CV043_HUMAN	hypothetical protein LOC51233	171	Asp-rich.									skin(1)	1						CTTACCTGGGcatcatcatcatc	0.261													7	131	---	---	---	---	capture_indel	In_Frame_Del	DEL	23959767	23959769	C22orf43	22	CAT	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	2130	134
ALPK1	80216	broad.mit.edu	37	4	113353098	113353098	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-0786-01	TCGA-14-0786-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113353098delC	uc003iap.3	+	11	2674	c.2395delC	c.(2395-2397)CCCfs	p.P799fs	ALPK1_uc003ian.3_Frame_Shift_Del_p.P799fs|ALPK1_uc011cfx.1_Frame_Shift_Del_p.P721fs|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Frame_Shift_Del_p.P627fs	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	799							ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TGAAGATGCACCCTTAGACTT	0.488													49	64	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	113353098	113353098	ALPK1	4	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	544	134
