Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MRTO4	51154	broad.mit.edu	37	1	19584431	19584431	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19584431T>G	uc001bbs.2	+	6	701	c.446T>G	c.(445-447)ATG>AGG	p.M149R		NM_016183	NP_057267	Q9UKD2	MRT4_HUMAN	mRNA turnover 4 homolog	149					ribosome biogenesis	nuclear membrane|nucleolus					0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.87e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00301)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCACTCCATGGAGCCACAG	0.597													9	160	---	---	---	---	capture	Missense_Mutation	SNP	19584431	19584431	MRTO4	1	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	9762	135
SF3A3	10946	broad.mit.edu	37	1	38435290	38435290	+	Nonsense_Mutation	SNP	C	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38435290C>A	uc001cci.2	-	13	1247	c.1123G>T	c.(1123-1125)GAG>TAG	p.E375*	SF3A3_uc010oik.1_Nonsense_Mutation_p.E322*	NM_006802	NP_006793	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3	375					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nuclear speck	nucleic acid binding|protein binding|zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TAAATGATCTCGTTCTCTTCA	0.468													36	73	---	---	---	---	capture	Nonsense_Mutation	SNP	38435290	38435290	SF3A3	1	C	A	A	A	1	0	0	0	0	0	1	0	0	403	31	5	4	14041	135
HMCN1	83872	broad.mit.edu	37	1	186099788	186099788	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186099788C>T	uc001grq.1	+	85	13418	c.13189C>T	c.(13189-13191)CGG>TGG	p.R4397W	HMCN1_uc001grs.1_5'UTR	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4397	Ig-like C2-type 43.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CCACAGAATCCGGCAACTGGG	0.507													37	82	---	---	---	---	capture	Missense_Mutation	SNP	186099788	186099788	HMCN1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	7145	135
DENND1B	163486	broad.mit.edu	37	1	197522236	197522236	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197522236C>T	uc001guf.3	-	16	1494	c.1156G>A	c.(1156-1158)GAT>AAT	p.D386N	DENND1B_uc010ppe.1_Missense_Mutation_p.D366N|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Missense_Mutation_p.D356N	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2	386	dDENN.					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						AGTCGACCATCGATAAACTAG	0.303													11	69	---	---	---	---	capture	Missense_Mutation	SNP	197522236	197522236	DENND1B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4385	135
RYR2	6262	broad.mit.edu	37	1	237791221	237791221	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237791221G>A	uc001hyl.1	+	41	6401	c.6281G>A	c.(6280-6282)GGC>GAC	p.G2094D		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2094	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGTATGACGGCATTGGGGGT	0.557													32	43	---	---	---	---	capture	Missense_Mutation	SNP	237791221	237791221	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13661	135
KCNK18	338567	broad.mit.edu	37	10	118957199	118957199	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118957199G>T	uc010qsr.1	+	1	200	c.200G>T	c.(199-201)AGA>ATA	p.R67I		NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	67						integral to membrane|plasma membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;0.19)		all cancers(201;0.0211)		GAGCTCTGCAGAATCTTGAAC	0.582													46	16	---	---	---	---	capture	Missense_Mutation	SNP	118957199	118957199	KCNK18	10	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	7987	135
KRTAP5-4	387267	broad.mit.edu	37	11	1642817	1642817	+	Silent	SNP	A	G	G			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1642817A>G	uc009ycy.1	-	4	732	c.645T>C	c.(643-645)GGT>GGC	p.G215G		NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	229	9 X 4 AA repeats of C-C-X-P.					keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ATGACCCACAACCTGAGGAGG	0.612													5	177	---	---	---	---	capture	Silent	SNP	1642817	1642817	KRTAP5-4	11	A	G	G	G	1	0	0	0	0	0	0	0	1	15	2	3	3	8483	135
KRTAP5-4	387267	broad.mit.edu	37	11	1642827	1642827	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1642827G>C	uc009ycy.1	-	4	722	c.635C>G	c.(634-636)TCC>TGC	p.S212C		NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	226	9 X 4 AA repeats of C-C-X-P.					keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACCTGAGGAGGAGCAGCAGGG	0.607													5	177	---	---	---	---	capture	Missense_Mutation	SNP	1642827	1642827	KRTAP5-4	11	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	8483	135
DCHS1	8642	broad.mit.edu	37	11	6647232	6647232	+	Missense_Mutation	SNP	C	T	T	rs149822394		TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6647232C>T	uc001mem.1	-	17	7060	c.6650G>A	c.(6649-6651)CGT>CAT	p.R2217H		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	2217	Extracellular (Potential).|Cadherin 21.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAACAATCCACGTGCCGGCTG	0.602													16	17	---	---	---	---	capture	Missense_Mutation	SNP	6647232	6647232	DCHS1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4246	135
OR8J3	81168	broad.mit.edu	37	11	55904448	55904448	+	Silent	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55904448C>T	uc010riz.1	-	1	747	c.747G>A	c.(745-747)ACG>ACA	p.T249T		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					CATAGAAAACCGTGACTGCTA	0.398													47	76	---	---	---	---	capture	Silent	SNP	55904448	55904448	OR8J3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11146	135
GIF	2694	broad.mit.edu	37	11	59610023	59610023	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59610023G>T	uc001noi.2	-	4	452	c.404C>A	c.(403-405)CCC>CAC	p.P135H	GIF_uc010rkz.1_3'UTR	NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	135					cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						CGCTAGACTGGGCCCATAGAA	0.562													41	100	---	---	---	---	capture	Missense_Mutation	SNP	59610023	59610023	GIF	11	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	6315	135
SCNN1A	6337	broad.mit.edu	37	12	6464465	6464465	+	Silent	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6464465G>A	uc001qnx.2	-	6	1405	c.1116C>T	c.(1114-1116)GGC>GGT	p.G372G	SCNN1A_uc001qnv.2_Silent_p.G72G|SCNN1A_uc001qnw.2_Silent_p.G431G|SCNN1A_uc010sfb.1_Silent_p.G395G	NM_001038	NP_001029	P37088	SCNNA_HUMAN	sodium channel, nonvoltage-gated 1 alpha isoform	372	Extracellular (By similarity).				excretion|response to stimulus|sensory perception of taste	apical plasma membrane	WW domain binding				0					Amiloride(DB00594)|Triamterene(DB00384)	AGGTCTCCACGCCAGGCCGCA	0.612													16	25	---	---	---	---	capture	Silent	SNP	6464465	6464465	SCNN1A	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13820	135
MYO1A	4640	broad.mit.edu	37	12	57424856	57424856	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57424856G>C	uc001smw.3	-	23	2695	c.2452C>G	c.(2452-2454)CAG>GAG	p.Q818E	MYO1A_uc010sqz.1_Missense_Mutation_p.Q656E|MYO1A_uc009zpd.2_Missense_Mutation_p.Q818E	NM_005379	NP_005370	Q9UBC5	MYO1A_HUMAN	myosin IA	818					sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|urinary_tract(1)	7						TGCAGCTCCTGATTTGCTGTG	0.517													35	53	---	---	---	---	capture	Missense_Mutation	SNP	57424856	57424856	MYO1A	12	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	9978	135
NAV3	89795	broad.mit.edu	37	12	78574731	78574731	+	Silent	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:78574731G>A	uc001syp.2	+	30	5771	c.5598G>A	c.(5596-5598)CCG>CCA	p.P1866P	NAV3_uc001syo.2_Silent_p.P1844P|NAV3_uc010sub.1_Silent_p.P1323P|NAV3_uc009zsf.2_Silent_p.P675P	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1866						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CTCGGCCACCGTCAGAATCCT	0.433										HNSCC(70;0.22)			19	31	---	---	---	---	capture	Silent	SNP	78574731	78574731	NAV3	12	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10092	135
OR4N2	390429	broad.mit.edu	37	14	20296487	20296487	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20296487G>A	uc010tkv.1	+	1	880	c.880G>A	c.(880-882)GTG>ATG	p.V294M		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	294	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CAACCAGGAAGTGAAAGCTTC	0.383													35	214	---	---	---	---	capture	Missense_Mutation	SNP	20296487	20296487	OR4N2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	10981	135
CLEC14A	161198	broad.mit.edu	37	14	38723845	38723845	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38723845G>T	uc001wum.1	-	1	1730	c.1383C>A	c.(1381-1383)AAC>AAA	p.N461K		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	461	Cytoplasmic (Potential).					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TCACCCCATTGTTTGTGCAAT	0.607													113	132	---	---	---	---	capture	Missense_Mutation	SNP	38723845	38723845	CLEC14A	14	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	3464	135
PYGL	5836	broad.mit.edu	37	14	51387718	51387718	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:51387718C>T	uc001wyu.2	-	6	855	c.728G>A	c.(727-729)CGC>CAC	p.R243H	PYGL_uc010tqq.1_Missense_Mutation_p.R209H|PYGL_uc001wyv.2_5'UTR|PYGL_uc010anz.1_Missense_Mutation_p.R46H	NM_002863	NP_002854	P06737	PYGL_HUMAN	liver glycogen phosphorylase isoform 1	243					glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding			skin(1)	1	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)|Pyridoxal Phosphate(DB00114)|Riboflavin(DB00140)	AGACCAGAGGCGCATGGTGTT	0.502													42	81	---	---	---	---	capture	Missense_Mutation	SNP	51387718	51387718	PYGL	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12756	135
SMOC1	64093	broad.mit.edu	37	14	70442486	70442486	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:70442486C>A	uc001xls.1	+	4	686	c.433C>A	c.(433-435)CCC>ACC	p.P145T	SMOC1_uc001xlt.1_Missense_Mutation_p.P145T	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1	145	Thyroglobulin type-1 1.				cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		GGATGGGAAGCCCATCAGTGG	0.517													67	88	---	---	---	---	capture	Missense_Mutation	SNP	70442486	70442486	SMOC1	14	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	14693	135
C15orf2	23742	broad.mit.edu	37	15	24921536	24921536	+	Silent	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24921536C>T	uc001ywo.2	+	1	996	c.522C>T	c.(520-522)GAC>GAT	p.D174D		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	174					cell differentiation|multicellular organismal development|spermatogenesis			p.D174D(1)		ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		GGGAGGATGACGAGAAAAGGA	0.622													44	59	---	---	---	---	capture	Silent	SNP	24921536	24921536	C15orf2	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1770	135
SEC14L5	9717	broad.mit.edu	37	16	5046964	5046964	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:5046964G>A	uc002cye.2	+	8	1069	c.889G>A	c.(889-891)GTG>ATG	p.V297M		NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5	297						integral to membrane|intracellular	transporter activity				0						GCAGCACCAGGTGGATCTCCT	0.612													17	34	---	---	---	---	capture	Missense_Mutation	SNP	5046964	5046964	SEC14L5	16	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	13878	135
ZFP90	146198	broad.mit.edu	37	16	68596966	68596966	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:68596966A>T	uc010cff.2	+	5	568	c.276A>T	c.(274-276)GAA>GAT	p.E92D	ZFP90_uc002ewb.2_Translation_Start_Site|ZFP90_uc002ewc.2_Translation_Start_Site|ZFP90_uc002ewd.2_Missense_Mutation_p.E92D|ZFP90_uc002ewe.2_Missense_Mutation_p.E92D	NM_133458	NP_597715	Q8TF47	ZFP90_HUMAN	zinc finger protein 90	92					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		CCAGGCCTGAAGTCAAATCAT	0.423													3	32	---	---	---	---	capture	Missense_Mutation	SNP	68596966	68596966	ZFP90	16	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	17534	135
GPR179	440435	broad.mit.edu	37	17	36486234	36486234	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36486234T>C	uc002hpz.2	-	11	3239	c.3218A>G	c.(3217-3219)CAC>CGC	p.H1073R		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	1073	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTTGAGGCTGTGGGATTTAGG	0.567													52	45	---	---	---	---	capture	Missense_Mutation	SNP	36486234	36486234	GPR179	17	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	6608	135
CDH7	1005	broad.mit.edu	37	18	63476948	63476948	+	Silent	SNP	T	C	C			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:63476948T>C	uc002ljz.2	+	3	544	c.219T>C	c.(217-219)TCT>TCC	p.S73S	CDH7_uc002lka.2_Silent_p.S73S|CDH7_uc002lkb.2_Silent_p.S73S	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	73	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				AGCTTCACTCTGATGTTGATA	0.378													3	152	---	---	---	---	capture	Silent	SNP	63476948	63476948	CDH7	18	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	3086	135
NFIC	4782	broad.mit.edu	37	19	3449019	3449019	+	Silent	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3449019G>A	uc010xhi.1	+	7	1028	c.966G>A	c.(964-966)TCG>TCA	p.S322S	NFIC_uc002lxo.2_Silent_p.S313S|NFIC_uc010xhh.1_Silent_p.S313S|NFIC_uc002lxp.2_Silent_p.S322S|NFIC_uc010xhj.1_Silent_p.S322S	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2	322					DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CAGGCATCTCGTCCCCGGTGA	0.632													37	185	---	---	---	---	capture	Silent	SNP	3449019	3449019	NFIC	19	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10279	135
TYK2	7297	broad.mit.edu	37	19	10467283	10467283	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10467283G>A	uc002moc.3	-	18	2956	c.2578C>T	c.(2578-2580)CGC>TGC	p.R860C	TYK2_uc010dxe.2_Missense_Mutation_p.R675C	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	860	Protein kinase 1.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			AGGATGGTGCGGAATGATGGC	0.662													37	9	---	---	---	---	capture	Missense_Mutation	SNP	10467283	10467283	TYK2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16692	135
ZNF610	162963	broad.mit.edu	37	19	52869863	52869863	+	Missense_Mutation	SNP	G	A	A	rs150692972		TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52869863G>A	uc002pyx.3	+	6	1638	c.1232G>A	c.(1231-1233)CGC>CAC	p.R411H	ZNF610_uc002pyy.3_Missense_Mutation_p.R411H|ZNF610_uc002pyz.3_Missense_Mutation_p.R368H|ZNF610_uc002pza.2_Missense_Mutation_p.R411H	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	411	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GTCTTTGGGCGCAAATTATAC	0.423													4	113	---	---	---	---	capture	Missense_Mutation	SNP	52869863	52869863	ZNF610	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17914	135
KIR2DL1	3802	broad.mit.edu	37	19	55284986	55284986	+	Missense_Mutation	SNP	C	T	T	rs117204680	byFrequency	TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55284986C>T	uc002qhb.1	+	3	310	c.272C>T	c.(271-273)ACG>ATG	p.T91M	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron|KIR2DL1_uc010erz.1_Missense_Mutation_p.T91M	NM_014218	NP_055033	P43626	KI2L1_HUMAN	killer cell immunoglobulin-like receptor, two	91	Extracellular (Potential).|Ig-like C2-type 1.				immune response|natural killer cell inhibitory signaling pathway	integral to plasma membrane	protein binding|receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		AGTCGCATGACGCAAGACCTG	0.532													155	44	---	---	---	---	capture	Missense_Mutation	SNP	55284986	55284986	KIR2DL1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8238	135
VPS54	51542	broad.mit.edu	37	2	64147109	64147109	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:64147109C>T	uc002scq.2	-	15	2235	c.2072G>A	c.(2071-2073)CGC>CAC	p.R691H	VPS54_uc002scp.2_Missense_Mutation_p.R679H|VPS54_uc002scn.2_5'UTR|VPS54_uc002sco.2_Missense_Mutation_p.R176H|VPS54_uc010fct.2_Missense_Mutation_p.R538H	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1	691					protein transport|retrograde transport, endosome to Golgi						0						TTGCTTCCAGCGCTCATTGTC	0.393													17	19	---	---	---	---	capture	Missense_Mutation	SNP	64147109	64147109	VPS54	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17098	135
RGPD3	653489	broad.mit.edu	37	2	107049631	107049631	+	Silent	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107049631C>T	uc010ywi.1	-	16	2373	c.2316G>A	c.(2314-2316)GCG>GCA	p.A772A		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					intracellular transport		binding			ovary(1)	1						TTTCTGAATCCGCATTTCGCA	0.373													6	430	---	---	---	---	capture	Silent	SNP	107049631	107049631	RGPD3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13180	135
RGPD4	285190	broad.mit.edu	37	2	108455386	108455386	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108455386T>A	uc010ywk.1	+	4	453	c.371T>A	c.(370-372)CTT>CAT	p.L124H	RGPD4_uc002tdu.2_5'UTR	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	124					intracellular transport		binding			skin(2)	2						GCAGCAAAACTTTTCCCAGGA	0.333													60	84	---	---	---	---	capture	Missense_Mutation	SNP	108455386	108455386	RGPD4	2	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	13181	135
GTDC1	79712	broad.mit.edu	37	2	144765034	144765034	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:144765034A>T	uc002tvp.2	-	7	869	c.590T>A	c.(589-591)GTT>GAT	p.V197D	GTDC1_uc002tvo.2_Missense_Mutation_p.V197D|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Missense_Mutation_p.V197D|GTDC1_uc010fnn.2_Missense_Mutation_p.V197D|GTDC1_uc002tvs.2_Missense_Mutation_p.V165D|GTDC1_uc010fno.2_Missense_Mutation_p.V68D|GTDC1_uc002tvt.1_Missense_Mutation_p.V197D	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	197					biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		CATGGACAGAACCGCACCGCC	0.403													35	72	---	---	---	---	capture	Missense_Mutation	SNP	144765034	144765034	GTDC1	2	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	6781	135
ALS2CR11	151254	broad.mit.edu	37	2	202401017	202401017	+	Silent	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202401017G>A	uc002uye.2	-	13	1281	c.1233C>T	c.(1231-1233)GGC>GGT	p.G411G	ALS2CR11_uc002uyf.2_Silent_p.G411G|ALS2CR11_uc010fti.2_Intron	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	411										large_intestine(1)|ovary(1)|skin(1)	3						GTATAGTCAGGCCTTTCTCAG	0.338													12	14	---	---	---	---	capture	Silent	SNP	202401017	202401017	ALS2CR11	2	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	552	135
ALS2CR11	151254	broad.mit.edu	37	2	202483675	202483675	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202483675G>A	uc002uye.2	-	1	227	c.179C>T	c.(178-180)ACG>ATG	p.T60M	ALS2CR11_uc002uyf.2_Missense_Mutation_p.T60M|ALS2CR11_uc010fti.2_Missense_Mutation_p.T60M	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	60										large_intestine(1)|ovary(1)|skin(1)	3						AGGCAGGGCCGTCGTGCCCTG	0.642													58	82	---	---	---	---	capture	Missense_Mutation	SNP	202483675	202483675	ALS2CR11	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	552	135
FAM124B	79843	broad.mit.edu	37	2	225266256	225266256	+	Missense_Mutation	SNP	G	A	A	rs149161165	by1000genomes	TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:225266256G>A	uc002vnx.2	-	1	456	c.230C>T	c.(229-231)CCG>CTG	p.P77L	FAM124B_uc002vnw.2_Missense_Mutation_p.P77L	NM_001122779	NP_001116251	Q9H5Z6	F124B_HUMAN	hypothetical protein LOC79843 isoform a	77							protein binding			ovary(2)	2		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		ATCCTCTCCCGGGCTTTCGTG	0.572													39	52	---	---	---	---	capture	Missense_Mutation	SNP	225266256	225266256	FAM124B	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5380	135
ANO7	50636	broad.mit.edu	37	2	242142864	242142864	+	Silent	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242142864C>T	uc002wax.2	+	9	1105	c.1002C>T	c.(1000-1002)CAC>CAT	p.H334H		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	334	Cytoplasmic (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						CCCTGGACCACGTGCGCAGGT	0.692													9	9	---	---	---	---	capture	Silent	SNP	242142864	242142864	ANO7	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	696	135
APOBEC3A	200315	broad.mit.edu	37	22	39357613	39357613	+	Silent	SNP	C	T	T	rs141631289		TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39357613C>T	uc003awn.2	+	3	566	c.396C>T	c.(394-396)TAC>TAT	p.Y132Y	APOBEC3A_uc011aob.1_Silent_p.Y114Y|APOBEC3A_uc011aoc.1_Silent_p.Y132Y	NM_145699	NP_663745	P31941	ABC3A_HUMAN	phorbolin 1	132					cellular response to xenobiotic stimulus|defense response to virus|DNA cytosine deamination|DNA demethylation|innate immune response|negative regulation of transposition|negative regulation of viral genome replication	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					TCTATGATTACGACCCCCTAT	0.572													33	9	---	---	---	---	capture	Silent	SNP	39357613	39357613	APOBEC3A	22	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	782	135
FRYL	285527	broad.mit.edu	37	4	48569356	48569356	+	Silent	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48569356C>T	uc003gyh.1	-	28	3683	c.3078G>A	c.(3076-3078)CTG>CTA	p.L1026L	FRYL_uc003gyk.2_Silent_p.L1026L|FRYL_uc003gyi.1_5'Flank	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1026					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TTTCTGCTTCCAGGAGTTGTC	0.343													30	42	---	---	---	---	capture	Silent	SNP	48569356	48569356	FRYL	4	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	6007	135
USO1	8615	broad.mit.edu	37	4	76722293	76722293	+	Silent	SNP	A	G	G			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76722293A>G	uc003hiu.2	+	16	2101	c.1926A>G	c.(1924-1926)AAA>AAG	p.K642K	USO1_uc003hiv.2_Silent_p.K484K|USO1_uc003hiw.2_Silent_p.K477K	NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein	642	Potential.				intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AAGAGGTGAAAAAAACATTAG	0.294													18	21	---	---	---	---	capture	Silent	SNP	76722293	76722293	USO1	4	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	16921	135
CCDC125	202243	broad.mit.edu	37	5	68590723	68590723	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:68590723G>A	uc003jvv.1	-	8	864	c.821C>T	c.(820-822)GCG>GTG	p.A274V	CCDC125_uc003jvx.1_Missense_Mutation_p.A273V|CCDC125_uc003jvy.1_RNA|CCDC125_uc003jvw.2_Missense_Mutation_p.A149V	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	274						cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TCCGAGGACCGCAAGCTTTAA	0.488													5	270	---	---	---	---	capture	Missense_Mutation	SNP	68590723	68590723	CCDC125	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2735	135
VCAN	1462	broad.mit.edu	37	5	82849273	82849273	+	Missense_Mutation	SNP	G	A	A	rs145625752		TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:82849273G>A	uc003kii.3	+	11	9940	c.9584G>A	c.(9583-9585)CGG>CAG	p.R3195Q	VCAN_uc003kij.3_Missense_Mutation_p.R2208Q|VCAN_uc010jau.2_Missense_Mutation_p.R1441Q|VCAN_uc003kik.3_Missense_Mutation_p.R454Q|VCAN_uc003kil.3_Missense_Mutation_p.R1859Q	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3195	C-type lectin.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		GCAGCTGAACGGGAATGCCGT	0.473													31	237	---	---	---	---	capture	Missense_Mutation	SNP	82849273	82849273	VCAN	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17020	135
FAT2	2196	broad.mit.edu	37	5	150922879	150922879	+	Silent	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150922879C>T	uc003lue.3	-	9	7822	c.7809G>A	c.(7807-7809)CCG>CCA	p.P2603P	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2603	Cadherin 23.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTGGATAACCGGAGAGTCTT	0.443													165	231	---	---	---	---	capture	Silent	SNP	150922879	150922879	FAT2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5636	135
HK3	3101	broad.mit.edu	37	5	176314737	176314737	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176314737C>T	uc003mfa.2	-	11	1407	c.1315G>A	c.(1315-1317)GTC>ATC	p.V439I	HK3_uc003mez.2_5'UTR	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3	439	Regulatory.			V -> I (in Ref. 4; AAC50422).	glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCTGCAGGACGCTGCAGAAC	0.622													27	51	---	---	---	---	capture	Missense_Mutation	SNP	176314737	176314737	HK3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7117	135
CARD11	84433	broad.mit.edu	37	7	2963984	2963984	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2963984C>T	uc003smv.2	-	15	2227	c.1823G>A	c.(1822-1824)CGC>CAC	p.R608H		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	608					positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GAAGGAGTAGCGTTCGTGACT	0.642			Mis		DLBCL								28	79	---	---	---	---	capture	Missense_Mutation	SNP	2963984	2963984	CARD11	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2621	135
PON3	5446	broad.mit.edu	37	7	95019499	95019499	+	Silent	SNP	A	G	G			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95019499A>G	uc003unt.2	-	3	193	c.168T>C	c.(166-168)GAT>GAC	p.D56D	PON1_uc011kih.1_Intron|PON3_uc011kii.1_Silent_p.D56D	NM_000940	NP_000931	Q15166	PON3_HUMAN	paraoxonase 3	56					aromatic compound catabolic process|carboxylic acid catabolic process|response to external stimulus	extracellular space	aryldialkylphosphatase activity|arylesterase activity|metal ion binding|protein homodimerization activity			ovary(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)			TAGGAAGTATATCAATATCTT	0.378													7	554	---	---	---	---	capture	Silent	SNP	95019499	95019499	PON3	7	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	12152	135
PLXNA4	91584	broad.mit.edu	37	7	131872361	131872361	+	Silent	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131872361C>T	uc003vra.3	-	15	3091	c.2862G>A	c.(2860-2862)CTG>CTA	p.L954L		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	954	IPT/TIG 2.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						CTGAGAGAGTCAGTGTCTGTG	0.617													8	572	---	---	---	---	capture	Silent	SNP	131872361	131872361	PLXNA4	7	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	12025	135
SSPO	23145	broad.mit.edu	37	7	149493732	149493732	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149493732G>T	uc010lpk.2	+	46	6728	c.6728G>T	c.(6727-6729)AGT>ATT	p.S2243I		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2243	LDL-receptor class A 8.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGCTGTGCCAGTGGTGAGTGT	0.652													9	27	---	---	---	---	capture	Missense_Mutation	SNP	149493732	149493732	SSPO	7	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	15081	135
WDR67	93594	broad.mit.edu	37	8	124109565	124109565	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124109565C>T	uc003ypp.1	+	6	805	c.715C>T	c.(715-717)CAT>TAT	p.H239Y	WDR67_uc011lig.1_Missense_Mutation_p.H239Y|WDR67_uc011lih.1_Missense_Mutation_p.H129Y|WDR67_uc003ypq.1_RNA|WDR67_uc003ypo.1_Missense_Mutation_p.H239Y|WDR67_uc003ypr.2_RNA	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1	239	WD 4.					centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AAATCATCTTCATTTGTGGTG	0.398													54	94	---	---	---	---	capture	Missense_Mutation	SNP	124109565	124109565	WDR67	8	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	17199	135
INPP5E	56623	broad.mit.edu	37	9	139327520	139327520	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139327520C>G	uc004cho.2	-	5	1552	c.1167G>C	c.(1165-1167)GAG>GAC	p.E389D	INPP5E_uc010nbm.2_Missense_Mutation_p.E389D	NM_019892	NP_063945	Q9NRR6	INP5E_HUMAN	inositol polyphosphate-5-phosphatase E	389						cilium axoneme|cytoskeleton|Golgi cisterna membrane	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity			skin(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		CCGTGGAGCACTCCACCTCTG	0.627													11	75	---	---	---	---	capture	Missense_Mutation	SNP	139327520	139327520	INPP5E	9	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	7680	135
RLIM	51132	broad.mit.edu	37	X	73811411	73811411	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:73811411C>T	uc004ebu.2	-	5	2029	c.1739G>A	c.(1738-1740)GGC>GAC	p.G580D	RLIM_uc004ebw.2_Missense_Mutation_p.G580D	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	580	RING-type.				random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						AAGTTTGTTGCCTTCTGTATA	0.408													68	16	---	---	---	---	capture	Missense_Mutation	SNP	73811411	73811411	RLIM	23	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13282	135
TIAL1	7073	broad.mit.edu	37	10	121341480	121341480	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:121341480delT	uc001lei.1	-	5	889	c.325delA	c.(325-327)ACAfs	p.T109fs	TIAL1_uc001leh.1_Frame_Shift_Del_p.T87fs|TIAL1_uc001lej.1_Frame_Shift_Del_p.T126fs|TIAL1_uc001lek.1_5'UTR|TIAL1_uc009xzi.1_5'UTR|TIAL1_uc010qtb.1_5'UTR	NM_003252	NP_003243	Q01085	TIAR_HUMAN	TIA-1 related protein isoform 1	109	RRM 2.				apoptosis|defense response|induction of apoptosis|regulation of transcription from RNA polymerase II promoter	lysosome|nucleus|stress granule	nucleotide binding|RNA binding			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		TCTTCTGTTGTAATTTCTGGA	0.348													25	5	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	121341480	121341480	TIAL1	10	T	-	-	-	1	0	1	0	1	0	0	0	0	741	57	5	5	15774	135
SARS2	54938	broad.mit.edu	37	19	39408365	39408365	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-0787-01	TCGA-14-0787-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39408365delG	uc002oka.2	-	12	1319	c.1159delC	c.(1159-1161)CGGfs	p.R387fs	SARS2_uc002ojz.2_Frame_Shift_Del_p.R197fs|SARS2_uc010xup.1_Frame_Shift_Del_p.R389fs|SARS2_uc002okb.2_Frame_Shift_Del_p.R387fs|SARS2_uc010xuq.1_Frame_Shift_Del_p.R387fs|SARS2_uc010xur.1_RNA	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor	387					seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TCTCCACACCGGAAGTGCAAG	0.637													42	104	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	39408365	39408365	SARS2	19	G	-	-	-	1	0	1	0	1	0	0	0	0	506	39	5	5	13737	135
