Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CHD5	26038	broad.mit.edu	37	1	6189033	6189033	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6189033C>A	uc001amb.1	-	23	3584	c.3484G>T	c.(3484-3486)GCC>TCC	p.A1162S	CHD5_uc001alz.1_Missense_Mutation_p.A19S|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1162	Helicase C-terminal.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TTGCGCTTGGCCACCTGCGTG	0.642													28	76	---	---	---	---	capture	Missense_Mutation	SNP	6189033	6189033	CHD5	1	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	3294	136
MRTO4	51154	broad.mit.edu	37	1	19584462	19584462	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19584462C>T	uc001bbs.2	+	6	732	c.477C>T	c.(475-477)CCC>CCT	p.P159P		NM_016183	NP_057267	Q9UKD2	MRT4_HUMAN	mRNA turnover 4 homolog	159					ribosome biogenesis	nuclear membrane|nucleolus					0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.87e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00301)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TGGGCCTGCCCACCGCCCTCA	0.592													23	98	---	---	---	---	capture	Silent	SNP	19584462	19584462	MRTO4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	9762	136
HPCAL4	51440	broad.mit.edu	37	1	40149794	40149794	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40149794C>T	uc001cdr.2	-	3	313	c.193G>A	c.(193-195)GCG>ACG	p.A65T	HPCAL4_uc010oix.1_Intron	NM_016257	NP_057341	Q9UM19	HPCL4_HUMAN	hippocalcin-like protein 4	65	EF-hand 2.				central nervous system development	intracellular	calcium ion binding			central_nervous_system(1)	1	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCGTGCTGCGCGAACTTGGAG	0.682													26	48	---	---	---	---	capture	Missense_Mutation	SNP	40149794	40149794	HPCAL4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7256	136
C1orf177	163747	broad.mit.edu	37	1	55277777	55277777	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55277777C>A	uc001cyb.3	+	6	731	c.677C>A	c.(676-678)GCA>GAA	p.A226E	C1orf177_uc001cya.3_Missense_Mutation_p.A226E	NM_001110533	NP_001104003	Q3ZCV2	CA177_HUMAN	hypothetical protein LOC163747 isoform 2	226											0						ACATATGTGGCACGATCCGTC	0.592													5	238	---	---	---	---	capture	Missense_Mutation	SNP	55277777	55277777	C1orf177	1	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	1999	136
GPSM2	29899	broad.mit.edu	37	1	109472462	109472462	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109472462G>C	uc010ovc.1	+	15	2451	c.1955G>C	c.(1954-1956)AGA>ACA	p.R652T	AKNAD1_uc010ovb.1_Intron|GPSM2_uc010ovd.1_Missense_Mutation_p.R652T|GPSM2_uc010ove.1_Missense_Mutation_p.R652T|CLCC1_uc001dwe.1_3'UTR|CLCC1_uc001dwf.1_3'UTR|CLCC1_uc001dwg.1_3'UTR	NM_013296	NP_037428	P81274	GPSM2_HUMAN	LGN protein	652					G-protein coupled receptor protein signaling pathway	cell cortex|nucleus	GTPase activator activity|identical protein binding			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		CTTTTACAAAGAGATCAAAAC	0.398													35	114	---	---	---	---	capture	Missense_Mutation	SNP	109472462	109472462	GPSM2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	6668	136
ZNF697	90874	broad.mit.edu	37	1	120165477	120165477	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120165477C>T	uc001ehy.1	-	3	1603	c.1489G>A	c.(1489-1491)GAG>AAG	p.E497K		NM_001080470	NP_001073939	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	497	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		TTGCCGCACTCGATGCACGTG	0.647													7	19	---	---	---	---	capture	Missense_Mutation	SNP	120165477	120165477	ZNF697	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17978	136
PDE4DIP	9659	broad.mit.edu	37	1	144886204	144886204	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144886204C>T	uc001elw.3	-	23	3321	c.3030G>A	c.(3028-3030)AGG>AGA	p.R1010R	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Silent_p.R1076R|PDE4DIP_uc001elv.3_Silent_p.R17R	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1010	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGAACTCAGCCCTCAGGTGGA	0.522			T	PDGFRB	MPD								46	330	---	---	---	---	capture	Silent	SNP	144886204	144886204	PDE4DIP	1	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	11546	136
LINGO4	339398	broad.mit.edu	37	1	151774395	151774395	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151774395G>A	uc001ezf.1	-	2	976	c.786C>T	c.(784-786)TGC>TGT	p.C262C		NM_001004432	NP_001004432	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	262	Extracellular (Potential).|LRR 8.					integral to membrane				large_intestine(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGCTCAGATTGCAGCGAGTGA	0.607													45	135	---	---	---	---	capture	Silent	SNP	151774395	151774395	LINGO4	1	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	8737	136
FLG2	388698	broad.mit.edu	37	1	152329096	152329096	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152329096T>G	uc001ezw.3	-	3	1239	c.1166A>C	c.(1165-1167)CAG>CCG	p.Q389P	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	389	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACTACAAGACTGGCTACCTCC	0.443													50	128	---	---	---	---	capture	Missense_Mutation	SNP	152329096	152329096	FLG2	1	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	5868	136
CRNN	49860	broad.mit.edu	37	1	152383181	152383181	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152383181G>A	uc001ezx.2	-	3	451	c.377C>T	c.(376-378)GCG>GTG	p.A126V		NM_016190	NP_057274	Q9UBG3	CRNN_HUMAN	cornulin	126					cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCTTTCCCCGCCCTTCCCAC	0.637													152	434	---	---	---	---	capture	Missense_Mutation	SNP	152383181	152383181	CRNN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3857	136
S100A7A	338324	broad.mit.edu	37	1	153390660	153390660	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153390660G>A	uc001fbt.1	+	2	159	c.102G>A	c.(100-102)ACG>ACA	p.T34T		NM_176823	NP_789793	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7-like 1	34	EF-hand 1.					cytoplasm	calcium ion binding			skin(1)	1	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCCTGCTGACGATGATGAAGG	0.483													45	192	---	---	---	---	capture	Silent	SNP	153390660	153390660	S100A7A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	13676	136
HMCN1	83872	broad.mit.edu	37	1	186052023	186052023	+	Silent	SNP	C	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186052023C>A	uc001grq.1	+	57	9043	c.8814C>A	c.(8812-8814)ATC>ATA	p.I2938I		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2938	Ig-like C2-type 27.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TAACAGATATCGGCAGGTATG	0.323													13	20	---	---	---	---	capture	Silent	SNP	186052023	186052023	HMCN1	1	C	A	A	A	1	0	0	0	0	0	0	0	1	395	31	4	4	7145	136
HHIPL2	79802	broad.mit.edu	37	1	222713493	222713493	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222713493G>A	uc001hnh.1	-	4	1367	c.1309C>T	c.(1309-1311)CGA>TGA	p.R437*		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	437					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		ATCCGGCCTCGGCCCTGGCGC	0.577													56	139	---	---	---	---	capture	Nonsense_Mutation	SNP	222713493	222713493	HHIPL2	1	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	7019	136
RYR2	6262	broad.mit.edu	37	1	237802413	237802413	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237802413C>T	uc001hyl.1	+	46	7147	c.7027C>T	c.(7027-7029)CTT>TTT	p.L2343F		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2343	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGGAATGGGCTTCTTGCAGC	0.498													16	39	---	---	---	---	capture	Missense_Mutation	SNP	237802413	237802413	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	13661	136
OR52D1	390066	broad.mit.edu	37	11	5510222	5510222	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5510222T>A	uc010qzg.1	+	1	286	c.286T>A	c.(286-288)TCC>ACC	p.S96T	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005163	NP_001005163	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGTGAGATTTCCTTTGGTGG	0.498													49	131	---	---	---	---	capture	Missense_Mutation	SNP	5510222	5510222	OR52D1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	11018	136
PRMT3	10196	broad.mit.edu	37	11	20448405	20448405	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:20448405G>A	uc001mqb.2	+	10	1204	c.987G>A	c.(985-987)GAG>GAA	p.E329E	PRMT3_uc001mqc.2_Silent_p.E252E|PRMT3_uc010rdn.1_Silent_p.E267E	NM_005788	NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3 isoform 1	329							zinc ion binding				0						TCATATCTGAGTGGATGGTGA	0.254													3	15	---	---	---	---	capture	Silent	SNP	20448405	20448405	PRMT3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	12434	136
TMPRSS4	56649	broad.mit.edu	37	11	117985881	117985881	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117985881G>A	uc010rxo.1	+	11	1329	c.1038G>A	c.(1036-1038)GCG>GCA	p.A346A	TMPRSS4_uc010rxp.1_Silent_p.A341A|TMPRSS4_uc010rxq.1_Silent_p.A199A|TMPRSS4_uc010rxr.1_Silent_p.A321A|TMPRSS4_uc010rxs.1_Silent_p.A306A|TMPRSS4_uc009yzu.2_Intron|TMPRSS4_uc010rxt.1_Silent_p.A321A	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1	346	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		TGCTGCAGGCGTCAGTCCAGG	0.552													8	20	---	---	---	---	capture	Silent	SNP	117985881	117985881	TMPRSS4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16132	136
TECTA	7007	broad.mit.edu	37	11	120998873	120998873	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120998873C>T	uc010rzo.1	+	8	2187	c.2187C>T	c.(2185-2187)TAC>TAT	p.Y729Y		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	729	VWFD 2.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GCGCCTCCTACGCCTTCCCCT	0.622													52	176	---	---	---	---	capture	Silent	SNP	120998873	120998873	TECTA	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15632	136
C12orf77	196415	broad.mit.edu	37	12	25148921	25148921	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:25148921C>T	uc001rgf.2	-	3	432	c.227G>A	c.(226-228)CGA>CAA	p.R76Q		NM_001101339	NP_001094809	C9JDV5	CL097_HUMAN	hypothetical protein LOC196415	76											0						AGGCATCCATCGTATGCTGTC	0.502													21	58	---	---	---	---	capture	Missense_Mutation	SNP	25148921	25148921	C12orf77	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1702	136
ACVRL1	94	broad.mit.edu	37	12	52309923	52309923	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52309923G>A	uc001rzj.2	+	8	1435	c.1152G>A	c.(1150-1152)CAG>CAA	p.Q384Q	ACVRL1_uc001rzk.2_Silent_p.Q384Q|ACVRL1_uc010snm.1_Silent_p.Q210Q	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor	384	Cytoplasmic (Potential).|Protein kinase.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	TGGACGAGCAGATCCGCACGG	0.602									Hereditary_Hemorrhagic_Telangiectasia				45	119	---	---	---	---	capture	Silent	SNP	52309923	52309923	ACVRL1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	225	136
ESPL1	9700	broad.mit.edu	37	12	53687195	53687195	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53687195C>T	uc001sck.2	+	31	6391	c.6300C>T	c.(6298-6300)CCC>CCT	p.P2100P	ESPL1_uc001scj.2_Silent_p.P1775P|PFDN5_uc001scl.2_5'Flank|PFDN5_uc001scm.2_5'Flank|PFDN5_uc001scn.2_5'Flank|PFDN5_uc001sco.2_5'Flank	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	2100					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						GCCAAGCTCCCCGACTCAAGT	0.567													15	69	---	---	---	---	capture	Silent	SNP	53687195	53687195	ESPL1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	5208	136
SRRM4	84530	broad.mit.edu	37	12	119568488	119568488	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:119568488G>A	uc001txa.1	+	8	912	c.620G>A	c.(619-621)CGC>CAC	p.R207H		NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein	207	Ser-rich.				cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding	p.R207H(1)		ovary(2)	2						CCCAGGCACCGCGGCCGGTCC	0.622													19	27	---	---	---	---	capture	Missense_Mutation	SNP	119568488	119568488	SRRM4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15063	136
CIT	11113	broad.mit.edu	37	12	120138625	120138625	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120138625C>T	uc001txi.1	-	43	5475	c.5422G>A	c.(5422-5424)GGA>AGA	p.G1808R	CIT_uc001txh.1_Missense_Mutation_p.G1327R|CIT_uc001txj.1_Missense_Mutation_p.G1850R	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1808	CNH.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		ACGAACACTCCAAATTCTGCA	0.547													21	59	---	---	---	---	capture	Missense_Mutation	SNP	120138625	120138625	CIT	12	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	3403	136
PAN3	255967	broad.mit.edu	37	13	28794510	28794510	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28794510C>T	uc001urz.2	+	5	565	c.557C>T	c.(556-558)GCG>GTG	p.A186V	PAN3_uc010tdo.1_Missense_Mutation_p.A332V|PAN3_uc001ury.2_5'UTR|PAN3_uc001urx.2_Missense_Mutation_p.A132V	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	332	Interaction with polyadenylate-binding protein.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GCTGGATTAGCGCCAGGTAAG	0.423													102	258	---	---	---	---	capture	Missense_Mutation	SNP	28794510	28794510	PAN3	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11319	136
TRIP11	9321	broad.mit.edu	37	14	92470681	92470681	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:92470681C>T	uc001xzy.2	-	11	4427	c.3639G>A	c.(3637-3639)AAG>AAA	p.K1213K	TRIP11_uc010auf.1_Silent_p.K949K	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1213	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity	p.K1213N(1)		ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		GCTGTTTTAACTTGTCACGTT	0.428			T	PDGFRB	AML								34	105	---	---	---	---	capture	Silent	SNP	92470681	92470681	TRIP11	14	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	16438	136
PRIMA1	145270	broad.mit.edu	37	14	94203651	94203651	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94203651C>T	uc001ybw.1	-	4	337	c.295G>A	c.(295-297)GTA>ATA	p.V99I	PRIMA1_uc001ybx.1_RNA	NM_178013	NP_821092	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1 precursor	99	Helical; (Potential).				neurotransmitter catabolic process	cell junction|integral to membrane|synapse				large_intestine(1)|skin(1)	2		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		GCACAGCATACGGCAATGATG	0.532													19	68	---	---	---	---	capture	Missense_Mutation	SNP	94203651	94203651	PRIMA1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12388	136
AKT1	207	broad.mit.edu	37	14	105241276	105241276	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105241276G>A	uc001ypk.2	-	7	1186	c.632C>T	c.(631-633)ACA>ATA	p.T211I	INF2_uc010tyi.1_Intron|AKT1_uc001ypl.2_Missense_Mutation_p.T211I|AKT1_uc010axa.2_Missense_Mutation_p.T211I|AKT1_uc001ypm.2_Missense_Mutation_p.T211I|AKT1_uc001ypn.2_Missense_Mutation_p.T211I|AKT1_uc010tyk.1_Missense_Mutation_p.T149I	NM_005163	NP_005154	P31749	AKT1_HUMAN	AKT1 kinase	211	Protein kinase.				activation of pro-apoptotic gene products|activation-induced cell death of T cells|endocrine pancreas development|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen biosynthetic process|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|mRNA metabolic process|negative regulation of fatty acid beta-oxidation|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|nitric oxide biosynthetic process|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of blood vessel endothelial cell migration|positive regulation of cell growth|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of establishment of protein localization in plasma membrane|positive regulation of fat cell differentiation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|positive regulation of nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein autophosphorylation|protein import into nucleus, translocation|regulation of neuron projection development|regulation of translation|response to fluid shear stress|response to heat|response to UV-A|T cell costimulation	cytosol|nucleoplasm|plasma membrane	enzyme binding|identical protein binding|nitric-oxide synthase regulator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein serine/threonine kinase activity			breast(86)|urinary_tract(12)|thyroid(10)|lung(7)|endometrium(5)|large_intestine(4)|skin(4)|prostate(3)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|NS(1)	134		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	CCCACTCACTGTGAGGAAGGG	0.647		1	Mis		breast|colorectal|ovarian|NSCLC								32	90	---	---	---	---	capture	Missense_Mutation	SNP	105241276	105241276	AKT1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	478	136
GABRB3	2562	broad.mit.edu	37	15	26793162	26793162	+	Silent	SNP	G	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26793162G>T	uc001zaz.2	-	9	1342	c.1200C>A	c.(1198-1200)ATC>ATA	p.I400I	GABRB3_uc010uae.1_Silent_p.I315I|GABRB3_uc001zba.2_Silent_p.I400I|GABRB3_uc001zbb.2_Silent_p.I456I	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	400	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TCCTGTACTGGATTCCTGAGT	0.512													55	162	---	---	---	---	capture	Silent	SNP	26793162	26793162	GABRB3	15	G	T	T	T	1	0	0	0	0	0	0	0	1	525	41	4	4	6110	136
OTUD7A	161725	broad.mit.edu	37	15	31776752	31776752	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:31776752C>T	uc001zfq.2	-	11	1619	c.1526G>A	c.(1525-1527)CGC>CAC	p.R509H	OTUD7A_uc001zfr.2_Missense_Mutation_p.R516H	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A	509	Nuclear localization signal (Potential).					cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GGAGTCGGCGCGCGTcttgtc	0.483													23	39	---	---	---	---	capture	Missense_Mutation	SNP	31776752	31776752	OTUD7A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11222	136
RYR3	6263	broad.mit.edu	37	15	33765674	33765674	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33765674T>A	uc001zhi.2	+	2	176	c.106T>A	c.(106-108)TTC>ATC	p.F36I	RYR3_uc010bar.2_Missense_Mutation_p.F36I	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	36	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCAGAGGAAGTTCTGCCTGGC	0.547													38	122	---	---	---	---	capture	Missense_Mutation	SNP	33765674	33765674	RYR3	15	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	13662	136
CKMT1A	548596	broad.mit.edu	37	15	43991225	43991225	+	Missense_Mutation	SNP	C	T	T	rs148934583		TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43991225C>T	uc001zsn.2	+	10	1584	c.1192C>T	c.(1192-1194)CGG>TGG	p.R398W	CKMT1A_uc010uea.1_Missense_Mutation_p.R429W|CKMT1A_uc001zso.3_Missense_Mutation_p.R398W	NM_001015001	NP_001015001	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1A precursor	398	Phosphagen kinase C-terminal.				creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	TGATTGTGAACGGCGTCTGGA	0.493													70	180	---	---	---	---	capture	Missense_Mutation	SNP	43991225	43991225	CKMT1A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	3414	136
DUOX2	50506	broad.mit.edu	37	15	45386398	45386398	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45386398C>T	uc010bea.2	-	34	4800	c.4597G>A	c.(4597-4599)GTC>ATC	p.V1533I	DUOX2_uc001zun.2_Missense_Mutation_p.V1533I	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	1533	Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TGCCTGTTGACGAGCTGACAG	0.572													26	77	---	---	---	---	capture	Missense_Mutation	SNP	45386398	45386398	DUOX2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4756	136
CACNA1H	8912	broad.mit.edu	37	16	1262094	1262094	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1262094G>A	uc002cks.2	+	25	4963	c.4715G>A	c.(4714-4716)CGG>CAG	p.R1572Q	CACNA1H_uc002ckt.2_Missense_Mutation_p.R1572Q|CACNA1H_uc002cku.2_Missense_Mutation_p.R278Q|CACNA1H_uc010brj.2_Missense_Mutation_p.R278Q|CACNA1H_uc002ckv.2_Missense_Mutation_p.R278Q	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	1572	Cytoplasmic (Potential).				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	GAGGCGCGGCGGCGAGAGGAG	0.682													28	71	---	---	---	---	capture	Missense_Mutation	SNP	1262094	1262094	CACNA1H	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2521	136
PAQR4	124222	broad.mit.edu	37	16	3021625	3021625	+	Silent	SNP	C	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3021625C>A	uc002csj.3	+	3	832	c.498C>A	c.(496-498)ACC>ACA	p.T166T	PAQR4_uc002csk.3_Silent_p.T127T|PAQR4_uc002csl.3_Silent_p.T92T|PAQR4_uc010uwm.1_Silent_p.T97T	NM_152341	NP_689554	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	166	Helical; (Potential).					integral to membrane	receptor activity				0						GTGCTCTCACCGCCCCCTCCA	0.697													4	143	---	---	---	---	capture	Silent	SNP	3021625	3021625	PAQR4	16	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	11341	136
ZP2	7783	broad.mit.edu	37	16	21213466	21213466	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21213466G>A	uc002dii.2	-	11	1246	c.1246C>T	c.(1246-1248)CGG>TGG	p.R416W	ZP2_uc010bwn.1_Missense_Mutation_p.R455W	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein	416	Extracellular (Potential).|ZP.				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(48;0.0573)		ATGTGGAACCGTACCAGCCCC	0.507													21	65	---	---	---	---	capture	Missense_Mutation	SNP	21213466	21213466	ZP2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	18092	136
NF1	4763	broad.mit.edu	37	17	29556481	29556481	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29556481C>T	uc002hgg.2	+	21	3181	c.2848C>T	c.(2848-2850)CAG>TAG	p.Q950*	NF1_uc002hgh.2_Nonsense_Mutation_p.Q950*|NF1_uc010csn.1_Nonsense_Mutation_p.Q810*|NF1_uc002hgi.1_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	950					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTCCCAAGGACAGGTAAAGTG	0.348			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			49	136	---	---	---	---	capture	Nonsense_Mutation	SNP	29556481	29556481	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	221	17	5	2	10263	136
MARCH10	162333	broad.mit.edu	37	17	60865912	60865912	+	Missense_Mutation	SNP	G	A	A	rs146312903	byFrequency;by1000genomes	TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60865912G>A	uc010ddr.2	-	3	377	c.139C>T	c.(139-141)CGC>TGC	p.R47C	MARCH10_uc002jag.3_Missense_Mutation_p.R47C|MARCH10_uc010dds.2_Missense_Mutation_p.R47C|MARCH10_uc002jah.2_Missense_Mutation_p.R47C	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190	47							ligase activity|zinc ion binding				0						AACTGATCGCGTTTCTTCTCA	0.443													45	115	---	---	---	---	capture	Missense_Mutation	SNP	60865912	60865912	MARCH10	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9212	136
POTEC	388468	broad.mit.edu	37	18	14542738	14542738	+	Silent	SNP	A	G	G			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14542738A>G	uc010dln.2	-	1	862	c.408T>C	c.(406-408)CGT>CGC	p.R136R	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	136										skin(3)	3						GATCTTCTCGACGGACGTGGT	0.607													62	254	---	---	---	---	capture	Silent	SNP	14542738	14542738	POTEC	18	A	G	G	G	1	0	0	0	0	0	0	0	1	119	10	3	3	12164	136
ZNF532	55205	broad.mit.edu	37	18	56587754	56587754	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56587754C>T	uc002lho.2	+	4	2782	c.2235C>T	c.(2233-2235)GAC>GAT	p.D745D	ZNF532_uc002lhp.2_Silent_p.D743D|ZNF532_uc010xeg.1_Silent_p.D743D|ZNF532_uc002lhr.2_Silent_p.D743D|ZNF532_uc002lhs.2_Silent_p.D743D	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	745					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						TAGATGAAGACCCCTCCAAAC	0.483													19	63	---	---	---	---	capture	Silent	SNP	56587754	56587754	ZNF532	18	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	17851	136
ZNF516	9658	broad.mit.edu	37	18	74154336	74154336	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74154336G>A	uc010dqx.1	-	2	910	c.675C>T	c.(673-675)ACC>ACT	p.T225T	ZNF516_uc002lme.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	225					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GCCCCTGCGCGGTGATGTGGT	0.697													13	46	---	---	---	---	capture	Silent	SNP	74154336	74154336	ZNF516	18	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17839	136
ACTL9	284382	broad.mit.edu	37	19	8807821	8807821	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8807821C>T	uc002mkl.2	-	1	1352	c.1231G>A	c.(1231-1233)GTG>ATG	p.V411M		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	411						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3						TTGCGGTACACGATATAGGGA	0.632													51	236	---	---	---	---	capture	Missense_Mutation	SNP	8807821	8807821	ACTL9	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	203	136
LDLR	3949	broad.mit.edu	37	19	11224366	11224366	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11224366G>C	uc002mqk.3	+	10	1682	c.1514G>C	c.(1513-1515)GGC>GCC	p.G505A	LDLR_uc010xlk.1_Missense_Mutation_p.G505A|LDLR_uc010xll.1_Missense_Mutation_p.G464A|LDLR_uc010xlm.1_Missense_Mutation_p.G358A|LDLR_uc010xln.1_Missense_Mutation_p.G378A|LDLR_uc010xlo.1_Missense_Mutation_p.G337A	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	505	Extracellular (Potential).|LDL-receptor class B 3.				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	GATACCAAGGGCGTGAAGAGG	0.592													29	139	---	---	---	---	capture	Missense_Mutation	SNP	11224366	11224366	LDLR	19	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	8624	136
ZNF709	163051	broad.mit.edu	37	19	12575498	12575498	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12575498G>A	uc002mtv.3	-	4	1399	c.1238C>T	c.(1237-1239)ACT>ATT	p.T413I	ZNF709_uc002mtw.3_Missense_Mutation_p.T381I|ZNF709_uc002mtx.3_Missense_Mutation_p.T413I	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a	413	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCCAGTGTGAGTTCTTTCATG	0.418													5	310	---	---	---	---	capture	Missense_Mutation	SNP	12575498	12575498	ZNF709	19	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	17989	136
GIPC1	10755	broad.mit.edu	37	19	14591540	14591540	+	Silent	SNP	C	G	G			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14591540C>G	uc002myt.2	-	5	609	c.339G>C	c.(337-339)CTG>CTC	p.L113L	GIPC1_uc002myu.2_Silent_p.L113L|GIPC1_uc002myv.2_Silent_p.L16L|GIPC1_uc002myw.2_Silent_p.L16L|GIPC1_uc002myx.2_Silent_p.L113L|GIPC1_uc002myy.2_Silent_p.L16L	NM_005716	NP_005707	O14908	GIPC1_HUMAN	regulator of G-protein signalling 19 interacting	113					endothelial cell migration|G-protein coupled receptor protein signaling pathway|glutamate secretion|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|protein targeting|regulation of protein stability|regulation of synaptic plasticity|synaptic transmission	cell cortex|dendritic shaft|dendritic spine|membrane fraction|soluble fraction|synaptic vesicle|vesicle membrane	actin binding|myosin binding|protein homodimerization activity|receptor binding				0						TCTGGCCCCCCAGGAGCTTGT	0.612											OREG0025316	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	47	243	---	---	---	---	capture	Silent	SNP	14591540	14591540	GIPC1	19	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	6331	136
LRP3	4037	broad.mit.edu	37	19	33695616	33695616	+	Silent	SNP	A	C	C			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33695616A>C	uc010edh.2	+	4	426	c.333A>C	c.(331-333)CCA>CCC	p.P111P	LRP3_uc010xrp.1_5'UTR|LRP3_uc002nuk.3_5'UTR	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	111	Extracellular (Potential).|CUB 1.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					CAGCAGCCCCACCCCGCCAGG	0.662													11	107	---	---	---	---	capture	Silent	SNP	33695616	33695616	LRP3	19	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	8874	136
TSKS	60385	broad.mit.edu	37	19	50243159	50243159	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50243159G>A	uc002ppm.2	-	11	1664	c.1653C>T	c.(1651-1653)CAC>CAT	p.H551H		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	551							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		ACATCTTCAAGTGTAGATGGT	0.592													47	199	---	---	---	---	capture	Silent	SNP	50243159	50243159	TSKS	19	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	16509	136
ZNF534	147658	broad.mit.edu	37	19	52942411	52942411	+	Silent	SNP	G	A	A	rs113700997		TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52942411G>A	uc002pzk.2	+	4	1798	c.1737G>A	c.(1735-1737)GCG>GCA	p.A579A	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Silent_p.A566A	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	579	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACACCTTGCGCGACATAGGA	0.443													4	36	---	---	---	---	capture	Silent	SNP	52942411	52942411	ZNF534	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17852	136
FCAR	2204	broad.mit.edu	37	19	55385635	55385635	+	Translation_Start_Site	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55385635C>T	uc002qhr.1	+	1	87	c.-110C>T	c.(-112--108)GACGA>GATGA		FCAR_uc002qhq.2_Translation_Start_Site|FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Translation_Start_Site|FCAR_uc010esi.1_Translation_Start_Site|FCAR_uc002qhu.1_Translation_Start_Site|FCAR_uc002qhv.1_Translation_Start_Site|FCAR_uc002qhw.1_Translation_Start_Site|FCAR_uc002qhx.1_Translation_Start_Site|FCAR_uc002qhy.1_Translation_Start_Site|FCAR_uc002qhz.1_Translation_Start_Site|FCAR_uc002qia.1_Translation_Start_Site	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor						immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		AATTCCCTGACGAGGGGCTCT	0.498													16	78	---	---	---	---	capture	Translation_Start_Site	SNP	55385635	55385635	FCAR	19	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	5719	136
PLB1	151056	broad.mit.edu	37	2	28761204	28761204	+	Missense_Mutation	SNP	G	A	A	rs149462466		TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:28761204G>A	uc002rmb.1	+	10	574	c.574G>A	c.(574-576)GGC>AGC	p.G192S	PLB1_uc010ezj.1_Missense_Mutation_p.G203S	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	192	4 X 308-326 AA approximate repeats.|Extracellular (Potential).|1.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					TGCGGCGGGCGGCGTGGATGA	0.642													13	40	---	---	---	---	capture	Missense_Mutation	SNP	28761204	28761204	PLB1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11927	136
LRP1B	53353	broad.mit.edu	37	2	141081530	141081530	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141081530T>C	uc002tvj.1	-	81	13418	c.12446A>G	c.(12445-12447)GAG>GGG	p.E4149G		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4149	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	p.E4149*(1)		lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGCTAAGTACTCTACTGAACC	0.289										TSP Lung(27;0.18)			22	57	---	---	---	---	capture	Missense_Mutation	SNP	141081530	141081530	LRP1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	8871	136
SGOL2	151246	broad.mit.edu	37	2	201437974	201437974	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201437974G>A	uc002uvw.2	+	7	3018	c.2905G>A	c.(2905-2907)GAA>AAA	p.E969K	SGOL2_uc010zhd.1_Missense_Mutation_p.E969K|SGOL2_uc010zhe.1_Missense_Mutation_p.E969K	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	969					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						CAACAGTAATGAAAAGGAAAG	0.274													15	45	---	---	---	---	capture	Missense_Mutation	SNP	201437974	201437974	SGOL2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	14110	136
SP140	11262	broad.mit.edu	37	2	231109774	231109774	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:231109774A>T	uc002vql.2	+	6	758	c.643A>T	c.(643-645)AGC>TGC	p.S215C	SP140_uc010zma.1_RNA|SP140_uc002vqk.2_Missense_Mutation_p.S215C|SP140_uc002vqn.2_Missense_Mutation_p.S215C|SP140_uc002vqm.2_Missense_Mutation_p.S215C|SP140_uc010fxl.2_Missense_Mutation_p.S215C	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1	215					defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AGATGCACCCAGCCTACTACC	0.443													23	82	---	---	---	---	capture	Missense_Mutation	SNP	231109774	231109774	SP140	2	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	14854	136
UGT1A10	54575	broad.mit.edu	37	2	234545195	234545195	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234545195C>T	uc002vur.2	+	1	73	c.27C>T	c.(25-27)CCC>CCT	p.P9P	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Silent_p.P9P	NM_019075	NP_061948	Q9HAW8	UD110_HUMAN	UDP glycosyltransferase 1 family, polypeptide	9				MARAGWTSPVPLCVCLLLTCGFA -> MAPRRVDQPRSFMC VSTADLWLC (in Ref. 1).	flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding			ovary(2)|skin(1)	3		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)		GGACCAGCCCCGTTCCTTTAT	0.572													38	113	---	---	---	---	capture	Silent	SNP	234545195	234545195	UGT1A10	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16827	136
PTPRA	5786	broad.mit.edu	37	20	2969091	2969091	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2969091G>A	uc010zqd.1	+	8	1059	c.742G>A	c.(742-744)GAC>AAC	p.D248N	PTPRA_uc002whj.2_Missense_Mutation_p.D237N|PTPRA_uc010zqc.1_Missense_Mutation_p.D122N|PTPRA_uc002whk.2_Missense_Mutation_p.D228N|PTPRA_uc002whl.2_Missense_Mutation_p.D228N|PTPRA_uc002whm.2_Missense_Mutation_p.D4N|PTPRA_uc002whn.2_Missense_Mutation_p.D228N|PTPRA_uc002who.2_5'UTR	NM_002836	NP_002827	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	237	Cytoplasmic (Potential).				axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						AATGGCAGACGACAATAAGCT	0.507													34	100	---	---	---	---	capture	Missense_Mutation	SNP	2969091	2969091	PTPRA	20	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12690	136
RBPJL	11317	broad.mit.edu	37	20	43936814	43936814	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43936814C>A	uc002xns.2	+	2	126	c.54C>A	c.(52-54)CAC>CAA	p.H18Q	MATN4_uc002xnn.2_Intron|MATN4_uc002xno.2_Intron|MATN4_uc002xnp.2_Intron|MATN4_uc010zwr.1_5'Flank|MATN4_uc002xnr.1_Splice_Site|RBPJL_uc002xnt.2_Missense_Mutation_p.H18Q	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L	18					signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				CTTTGACTCACCTGAGCCTGC	0.627													36	118	---	---	---	---	capture	Missense_Mutation	SNP	43936814	43936814	RBPJL	20	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	13057	136
NCOA5	57727	broad.mit.edu	37	20	44698964	44698964	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44698964C>T	uc002xrd.2	-	2	778	c.250G>A	c.(250-252)GTG>ATG	p.V84M	NCOA5_uc002xrc.2_Translation_Start_Site|NCOA5_uc002xre.2_Missense_Mutation_p.V84M	NM_020967	NP_066018	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	84	Arg/Asp-rich (mixed charge).|Transcription repression.				regulation of transcription, DNA-dependent|transcription, DNA-dependent|translation	nucleus	aminoacyl-tRNA ligase activity|ATP binding			central_nervous_system(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				AGATCCCTCACGTCCCGAACG	0.532													64	154	---	---	---	---	capture	Missense_Mutation	SNP	44698964	44698964	NCOA5	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10139	136
CHL1	10752	broad.mit.edu	37	3	405060	405060	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:405060A>T	uc003bou.2	+	13	1802	c.1531A>T	c.(1531-1533)ATT>TTT	p.I511F	CHL1_uc003bot.2_Missense_Mutation_p.I527F|CHL1_uc003bow.1_Missense_Mutation_p.I511F|CHL1_uc011asi.1_Missense_Mutation_p.I527F|uc003box.1_RNA	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	511	Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CAATTTGGATATTAGAAGTAT	0.378													29	92	---	---	---	---	capture	Missense_Mutation	SNP	405060	405060	CHL1	3	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	3314	136
CACNA2D3	55799	broad.mit.edu	37	3	54930849	54930849	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:54930849G>A	uc003dhf.2	+	26	2368	c.2320G>A	c.(2320-2322)GCT>ACT	p.A774T	CACNA2D3_uc003dhg.1_Missense_Mutation_p.A680T|CACNA2D3_uc003dhh.1_RNA|uc003dhk.1_RNA	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	774	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity	p.A774T(1)		large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CCGAAGAGCCGCTGAGCAGAT	0.537													47	146	---	---	---	---	capture	Missense_Mutation	SNP	54930849	54930849	CACNA2D3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2526	136
PIK3CB	5291	broad.mit.edu	37	3	138417859	138417859	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138417859C>T	uc011bmq.1	-	11	1660	c.1660G>A	c.(1660-1662)GAA>AAA	p.E554K	PIK3CB_uc011bmn.1_Missense_Mutation_p.E66K|PIK3CB_uc011bmo.1_5'UTR|PIK3CB_uc011bmp.1_Missense_Mutation_p.E141K	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	554	PI3K helical.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						AGATCCATTTCATTTTCACAC	0.383													52	128	---	---	---	---	capture	Missense_Mutation	SNP	138417859	138417859	PIK3CB	3	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	11817	136
IDUA	3425	broad.mit.edu	37	4	995507	995507	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:995507C>T	uc003gby.2	+	6	718	c.630C>T	c.(628-630)CGC>CGT	p.R210R	IDUA_uc003gbz.2_RNA|IDUA_uc003gca.2_Silent_p.R163R	NM_000203	NP_000194	P35475	IDUA_HUMAN	alpha-L-iduronidase precursor	210					disaccharide metabolic process	lysosome	cation binding|L-iduronidase activity				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)		Laronidase(DB00090)	AGGGTCTGCGCGCCGCCAGCC	0.716													5	17	---	---	---	---	capture	Silent	SNP	995507	995507	IDUA	4	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7429	136
TLR10	81793	broad.mit.edu	37	4	38777060	38777060	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38777060G>A	uc003gti.2	-	2	531	c.152C>T	c.(151-153)ACG>ATG	p.T51M	TLR10_uc003gtj.2_Missense_Mutation_p.T51M|TLR10_uc003gtk.2_Missense_Mutation_p.T51M	NM_030956	NP_112218	Q9BXR5	TLR10_HUMAN	toll-like receptor 10 precursor	51	Extracellular (Potential).|LRR 2.				inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane	transmembrane receptor activity			lung(1)|breast(1)	2						ATCCAGTGTCGTTGTGGCTGG	0.448													30	84	---	---	---	---	capture	Missense_Mutation	SNP	38777060	38777060	TLR10	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15835	136
CCDC158	339965	broad.mit.edu	37	4	77304876	77304876	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77304876C>T	uc003hkb.3	-	6	895	c.742G>A	c.(742-744)GAA>AAA	p.E248K	CCDC158_uc003hkd.2_Missense_Mutation_p.E248K	NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	248	Potential.									skin(3)|ovary(2)|pancreas(1)	6						TTCAGTGCTTCAAGTTGATCC	0.368													32	95	---	---	---	---	capture	Missense_Mutation	SNP	77304876	77304876	CCDC158	4	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	2764	136
SPARCL1	8404	broad.mit.edu	37	4	88420673	88420673	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88420673C>T	uc010ikm.2	-	3	626	c.54G>A	c.(52-54)CCG>CCA	p.P18P	SPARCL1_uc011cdc.1_Intron|SPARCL1_uc003hqs.3_Silent_p.P18P|SPARCL1_uc011cdd.1_5'UTR|SPARCL1_uc003hqt.2_Silent_p.P18P	NM_001128310	NP_001121782	Q14515	SPRL1_HUMAN	SPARC-like 1 precursor	18					signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		GGAAATTTACCGGGATTGCAG	0.363													4	126	---	---	---	---	capture	Silent	SNP	88420673	88420673	SPARCL1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14888	136
FGA	2243	broad.mit.edu	37	4	155507297	155507297	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155507297G>T	uc003iod.1	-	5	1342	c.1284C>A	c.(1282-1284)TAC>TAA	p.Y428*	FGA_uc003ioe.1_Nonsense_Mutation_p.Y428*|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	428	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TTTCTGTGTGGTACTCTCTCC	0.512													102	355	---	---	---	---	capture	Nonsense_Mutation	SNP	155507297	155507297	FGA	4	G	T	T	T	1	0	0	0	0	0	1	0	0	568	44	5	4	5776	136
THBS4	7060	broad.mit.edu	37	5	79378941	79378941	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79378941A>G	uc003kgh.2	+	23	3186	c.2863A>G	c.(2863-2865)AAT>GAT	p.N955D	uc003kgi.3_Intron	NM_003248	NP_003239	P35443	TSP4_HUMAN	thrombospondin 4 precursor	955					endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity				0		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		TCAAACCCAGAATTTCGACCG	0.453											OREG0016685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	107	---	---	---	---	capture	Missense_Mutation	SNP	79378941	79378941	THBS4	5	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	15741	136
HARS	3035	broad.mit.edu	37	5	140053903	140053903	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140053903C>T	uc003lgv.2	-	13	1551	c.1469G>A	c.(1468-1470)CGA>CAA	p.R490Q	DND1_uc003lgt.2_5'Flank|HARS_uc003lgu.2_Missense_Mutation_p.R421Q|HARS_uc011czm.1_Missense_Mutation_p.R450Q|HARS_uc003lgw.2_Missense_Mutation_p.R470Q|HARS_uc011czn.1_Missense_Mutation_p.R430Q|HARS_uc010jfu.2_Missense_Mutation_p.R402Q|HARS_uc011czo.1_Missense_Mutation_p.R416Q|HARS_uc011czp.1_Missense_Mutation_p.R376Q	NM_002109	NP_002100	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	490					histidyl-tRNA aminoacylation	cytosol	ATP binding|histidine-tRNA ligase activity			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	GTCTTCTCTTCGGACATCCAC	0.522													18	82	---	---	---	---	capture	Missense_Mutation	SNP	140053903	140053903	HARS	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6886	136
PCDHA2	56146	broad.mit.edu	37	5	140174750	140174750	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140174750G>A	uc003lhd.2	+	1	307	c.201G>A	c.(199-201)GCG>GCA	p.A67A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.A67A|PCDHA2_uc011czy.1_Silent_p.A67A	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	67	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCGGGTGGCGTCCAAAAGAC	0.647													81	217	---	---	---	---	capture	Silent	SNP	140174750	140174750	PCDHA2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11427	136
PCDHB4	56131	broad.mit.edu	37	5	140503471	140503471	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140503471G>A	uc003lip.1	+	1	1891	c.1891G>A	c.(1891-1893)GAG>AAG	p.E631K		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	631	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGCTGAGCGAGCGCGACGC	0.687													37	79	---	---	---	---	capture	Missense_Mutation	SNP	140503471	140503471	PCDHB4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11447	136
PRRT1	80863	broad.mit.edu	37	6	32118160	32118160	+	Silent	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32118160G>A	uc003nzt.2	-	2	659	c.543C>T	c.(541-543)GTC>GTT	p.V181V	PRRT1_uc003nzs.2_Silent_p.V222V|PRRT1_uc003nzu.2_Silent_p.L74L	NM_030651	NP_085154	Q99946	PRRT1_HUMAN	NG5 protein	181					response to biotic stimulus	integral to membrane				breast(1)	1						CCACCGGGTAGACCGGCACGT	0.667													19	60	---	---	---	---	capture	Silent	SNP	32118160	32118160	PRRT1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	418	33	2	2	12504	136
ITPR3	3710	broad.mit.edu	37	6	33633622	33633622	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33633622C>T	uc011drk.1	+	14	1639	c.1420C>T	c.(1420-1422)CAG>TAG	p.Q474*		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	474	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						GTTTGTCATCCAGCTGCTGGA	0.572													24	77	---	---	---	---	capture	Nonsense_Mutation	SNP	33633622	33633622	ITPR3	6	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	7845	136
VEGFA	7422	broad.mit.edu	37	6	43748479	43748479	+	Nonsense_Mutation	SNP	C	T	T	rs45533131		TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43748479C>T	uc003owh.2	+	6	1464	c.973C>T	c.(973-975)CGA>TGA	p.R325*	VEGFA_uc003owd.2_Intron|VEGFA_uc003owf.2_Nonsense_Mutation_p.R325*|VEGFA_uc003owe.2_Intron|VEGFA_uc003owg.2_Nonsense_Mutation_p.R325*|VEGFA_uc003owi.2_Intron|VEGFA_uc003owj.2_Intron|VEGFA_uc010jyx.2_Intron|VEGFA_uc003owk.2_Intron	NM_001025366	NP_001020537	P15692	VEGFA_HUMAN	vascular endothelial growth factor A isoform a	145					basophil chemotaxis|cellular response to hypoxia|induction of positive chemotaxis|induction of positive chemotaxis|platelet activation|platelet degranulation|platelet-derived growth factor receptor signaling pathway|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of cell adhesion|positive regulation of cell division|positive regulation of endothelial cell proliferation|positive regulation of leukocyte migration|positive regulation of mast cell chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|positive regulation of vascular permeability|regulation of cell shape|vascular endothelial growth factor receptor signaling pathway|vasculogenesis	cell surface|extracellular space|membrane|platelet alpha granule lumen	cell surface binding|chemoattractant activity|cytokine activity|fibronectin binding|growth factor activity|heparin binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity|vascular endothelial growth factor receptor 1 binding|vascular endothelial growth factor receptor 2 binding|vascular endothelial growth factor receptor binding			ovary(1)|breast(1)	2	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Atorvastatin(DB01076)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Simvastatin(DB00641)	AAAATCAGTTCGAGGAAAGGG	0.532													43	135	---	---	---	---	capture	Nonsense_Mutation	SNP	43748479	43748479	VEGFA	6	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	17032	136
GPRC6A	222545	broad.mit.edu	37	6	117128089	117128089	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117128089C>T	uc003pxj.1	-	3	801	c.779G>A	c.(778-780)CGG>CAG	p.R260Q	GPRC6A_uc003pxk.1_Missense_Mutation_p.R260Q|GPRC6A_uc003pxl.1_Missense_Mutation_p.R260Q	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,	260	Extracellular (Potential).				response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		CTTCAGTGTCCGATTGATTCT	0.363													37	124	---	---	---	---	capture	Missense_Mutation	SNP	117128089	117128089	GPRC6A	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6661	136
LPA	4018	broad.mit.edu	37	6	161020531	161020531	+	Splice_Site	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161020531C>T	uc003qtl.2	-	21	3407	c.3287_splice	c.e21+1	p.A1096_splice		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAAAGACGTACGCATTTGGGT	0.483													151	548	---	---	---	---	capture	Splice_Site	SNP	161020531	161020531	LPA	6	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	8819	136
EGFR	1956	broad.mit.edu	37	7	55238870	55238870	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55238870G>A	uc003tqk.2	+	16	2129	c.1883G>A	c.(1882-1884)TGC>TAC	p.C628Y	EGFR_uc010kzg.1_Missense_Mutation_p.C583Y|EGFR_uc011kco.1_Missense_Mutation_p.C575Y|EGFR_uc011kcp.1_RNA|EGFR_uc011kcq.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	628	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TCCTACAGATGCACTGGGCCA	0.393		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			82	793	---	---	---	---	capture	Missense_Mutation	SNP	55238870	55238870	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	136
CALN1	83698	broad.mit.edu	37	7	71252851	71252851	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71252851C>T	uc003twa.3	-	6	1096	c.569G>A	c.(568-570)CGG>CAG	p.R190Q	CALN1_uc003twb.3_Missense_Mutation_p.R232Q|CALN1_uc003twc.3_Missense_Mutation_p.R190Q	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	190	Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GAGGCTCTTCCGGACGCAGGT	0.552													27	112	---	---	---	---	capture	Missense_Mutation	SNP	71252851	71252851	CALN1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2567	136
GRM3	2913	broad.mit.edu	37	7	86415655	86415655	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86415655C>T	uc003uid.2	+	3	1646	c.547C>T	c.(547-549)CGC>TGC	p.R183C	GRM3_uc010lef.2_Missense_Mutation_p.R181C|GRM3_uc010leg.2_Missense_Mutation_p.R55C|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	183	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	TGATAAGTCGCGCTATGATTA	0.562													99	311	---	---	---	---	capture	Missense_Mutation	SNP	86415655	86415655	GRM3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6731	136
ABCB4	5244	broad.mit.edu	37	7	87092144	87092144	+	Silent	SNP	G	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87092144G>T	uc003uiv.1	-	4	292	c.216C>A	c.(214-216)CCC>CCA	p.P72P	ABCB4_uc003uiw.1_Silent_p.P72P|ABCB4_uc003uix.1_Silent_p.P72P|ABCB4_uc003uiy.2_Silent_p.P72P	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	72	ABC transmembrane type-1 1.|Helical; (By similarity).			IMAIAHGSGLP -> RGSSRVDLQAC (in Ref. 5; CAA84542).	cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					TCATCATGAGGGGGAGACCTG	0.383													21	92	---	---	---	---	capture	Silent	SNP	87092144	87092144	ABCB4	7	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	43	136
AZGP1	563	broad.mit.edu	37	7	99569626	99569626	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99569626C>T	uc003ush.2	-	2	124	c.80G>A	c.(79-81)CGT>CAT	p.R27H		NM_001185	NP_001176	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc	27					antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CAGAGAGTAACGACCTGCAAA	0.527													31	125	---	---	---	---	capture	Missense_Mutation	SNP	99569626	99569626	AZGP1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1229	136
ASB15	142685	broad.mit.edu	37	7	123269046	123269046	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123269046A>G	uc003vku.1	+	10	1290	c.998A>G	c.(997-999)GAT>GGT	p.D333G	ASB15_uc003vkw.1_Missense_Mutation_p.D333G	NM_080928	NP_563616	Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box-containing 15	333	ANK 6.				intracellular signal transduction					skin(2)|lung(1)	3						AATGGTTTTGATGTCAACACT	0.418													61	232	---	---	---	---	capture	Missense_Mutation	SNP	123269046	123269046	ASB15	7	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	1010	136
ALDH1A1	216	broad.mit.edu	37	9	75567900	75567900	+	Missense_Mutation	SNP	G	A	A	rs144704960		TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:75567900G>A	uc004ajd.2	-	1	70	c.17C>T	c.(16-18)ACG>ATG	p.T6M	ALDH1A1_uc011lsh.1_Intron	NM_000689	NP_000680	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1A1	6					cellular aldehyde metabolic process|ethanol oxidation|xenobiotic metabolic process	cytosol	aldehyde dehydrogenase (NAD) activity|androgen binding|Ras GTPase activator activity|retinal dehydrogenase activity			ovary(3)|lung(1)	4					NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TAAGTCTGGCGTGCCTGAGGA	0.418													24	75	---	---	---	---	capture	Missense_Mutation	SNP	75567900	75567900	ALDH1A1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	490	136
OLFML2A	169611	broad.mit.edu	37	9	127566377	127566377	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:127566377C>T	uc004bov.2	+	6	1037	c.924C>T	c.(922-924)AAC>AAT	p.N308N	OLFML2A_uc010mwr.1_Silent_p.N272N|OLFML2A_uc004bow.2_Silent_p.N94N	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor	308											0						CTGCAGACAACACCCTCCAGG	0.637													17	50	---	---	---	---	capture	Silent	SNP	127566377	127566377	OLFML2A	9	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	10762	136
DBH	1621	broad.mit.edu	37	9	136507481	136507481	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136507481C>T	uc004cel.2	+	3	648	c.639C>T	c.(637-639)ACC>ACT	p.T213T		NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta hydroxylase precursor	213	Intragranular (Potential).				hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)	ACGCGTGCACCATGGAGGTCC	0.592													20	55	---	---	---	---	capture	Silent	SNP	136507481	136507481	DBH	9	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	4209	136
TLR7	51284	broad.mit.edu	37	X	12904281	12904281	+	Silent	SNP	C	T	T			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12904281C>T	uc004cvc.2	+	3	793	c.654C>T	c.(652-654)GCC>GCT	p.A218A		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	218	Extracellular (Potential).|LRR 7.				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	ATGTCACAGCCGTCCCTACTG	0.343													31	39	---	---	---	---	capture	Silent	SNP	12904281	12904281	TLR7	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15841	136
ZRSR2	8233	broad.mit.edu	37	X	15840971	15840971	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15840971G>A	uc004cxg.3	+	11	1100	c.1055G>A	c.(1054-1056)CGG>CAG	p.R352Q		NM_005089	NP_005080	Q15696	U2AFM_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 2	352					spliceosome assembly	U12-type spliceosomal complex	nucleotide binding|pre-mRNA 3'-splice site binding|protein binding|zinc ion binding			breast(3)	3	Hepatocellular(33;0.183)					TCTCCAGATCGGACTGGCTCC	0.502													44	48	---	---	---	---	capture	Missense_Mutation	SNP	15840971	15840971	ZRSR2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	18101	136
POF1B	79983	broad.mit.edu	37	X	84634327	84634327	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:84634327T>G	uc004eer.2	-	2	279	c.133A>C	c.(133-135)AAA>CAA	p.K45Q	POF1B_uc004ees.2_Missense_Mutation_p.K45Q	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	45							actin binding				0						ACTACATTTTTTTCTGGAGGC	0.577													20	26	---	---	---	---	capture	Missense_Mutation	SNP	84634327	84634327	POF1B	23	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	12085	136
ZNF546	339327	broad.mit.edu	37	19	40521654	40521656	+	In_Frame_Del	DEL	ATC	-	-			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40521654_40521656delATC	uc002oms.2	+	7	2733_2735	c.2477_2479delATC	c.(2476-2481)AATCAT>AAT	p.H827del	ZNF546_uc002omt.2_In_Frame_Del_p.H801del	NM_178544	NP_848639	Q86UE3	ZN546_HUMAN	zinc finger protein 546	827	C2H2-type 22.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CATCAGAGAAATCATATTAGTGA	0.330													21	86	---	---	---	---	capture_indel	In_Frame_Del	DEL	40521654	40521656	ZNF546	19	ATC	-	-	-	1	0	1	0	1	0	0	0	0	52	4	5	5	17857	136
RAD51AP2	729475	broad.mit.edu	37	2	17698942	17698942	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:17698942delT	uc002rcl.1	-	1	765	c.741delA	c.(739-741)AAAfs	p.K247fs	RAD51AP2_uc010exn.1_Frame_Shift_Del_p.K238fs	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	247										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AATAGCTAGGTTTGGCAATTT	0.353													41	117	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	17698942	17698942	RAD51AP2	2	T	-	-	-	1	0	1	0	1	0	0	0	0	777	60	5	5	12882	136
ADCY3	109	broad.mit.edu	37	2	25095488	25095489	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:25095488_25095489insG	uc002rfs.3	-	2	974_975	c.775_776insC	c.(775-777)CGCfs	p.R259fs	ADCY3_uc010ykm.1_Frame_Shift_Ins_p.R259fs	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	259					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CAGCGACTGGCGGGCCTCCAGG	0.634													7	386	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	25095488	25095489	ADCY3	2	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	295	136
THOC2	57187	broad.mit.edu	37	X	122748018	122748020	+	In_Frame_Del	DEL	GGA	-	-			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122748018_122748020delGGA	uc004etu.2	-	34	4364_4366	c.4332_4334delTCC	c.(4330-4335)CCTCCA>CCA	p.1444_1445PP>P	THOC2_uc010nqt.1_RNA|THOC2_uc004etw.1_In_Frame_Del_p.265_266PP>P	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1444_1445	Lys-rich.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						GGACAGTGGTGGAGGAGTATGAT	0.355													24	36	---	---	---	---	capture_indel	In_Frame_Del	DEL	122748018	122748020	THOC2	23	GGA	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	15750	136
STAG2	10735	broad.mit.edu	37	X	123176470	123176471	+	Frame_Shift_Ins	INS	-	A	A			TCGA-14-0789-01	TCGA-14-0789-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123176470_123176471insA	uc004etz.3	+	6	776_777	c.437_438insA	c.(436-438)CGAfs	p.R146fs	STAG2_uc004eua.2_Frame_Shift_Ins_p.R146fs|STAG2_uc004eub.2_Frame_Shift_Ins_p.R146fs|STAG2_uc004euc.2_Frame_Shift_Ins_p.R146fs|STAG2_uc004eud.2_Frame_Shift_Ins_p.R146fs|STAG2_uc004eue.2_Frame_Shift_Ins_p.R146fs	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	146					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						GAGATAATTCGAAAAATGACTG	0.287													35	43	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	123176470	123176471	STAG2	23	-	A	A	A	1	0	1	1	0	0	0	0	0	481	37	5	5	15133	136
