Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
RPL5	6125	broad.mit.edu	37	1	93300358	93300358	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93300358G>A	uc001doz.2	+	4	290	c.212G>A	c.(211-213)GGG>GAG	p.G71E	FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_RNA|RPL5_uc001dpb.2_Missense_Mutation_p.G21E|RPL5_uc001dpd.2_5'Flank|SNORD21_uc001dpe.2_5'Flank	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5	71					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		CGTATAGAGGGGGATATGATA	0.413													24	155	---	---	---	---	capture	Missense_Mutation	SNP	93300358	93300358	RPL5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	13489	137
BCAR3	8412	broad.mit.edu	37	1	94032953	94032953	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94032953C>T	uc001dpz.2	-	11	2457	c.2182G>A	c.(2182-2184)GAC>AAC	p.D728N	BCAR3_uc001dqa.2_Missense_Mutation_p.D728N|BCAR3_uc001dqb.2_Missense_Mutation_p.D728N|BCAR3_uc001dpx.3_Missense_Mutation_p.D404N|BCAR3_uc001dpy.2_Missense_Mutation_p.D637N	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3	728	Ras-GEF.				response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		TCCCACATGTCGGTTCCTTCA	0.512													59	71	---	---	---	---	capture	Missense_Mutation	SNP	94032953	94032953	BCAR3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1338	137
CD58	965	broad.mit.edu	37	1	117078713	117078713	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117078713G>A	uc001egm.2	-	3	623	c.502C>T	c.(502-504)CGT>TGT	p.R168C	CD58_uc001egn.2_RNA|CD58_uc010owy.1_Missense_Mutation_p.R168C|CD58_uc001ego.1_Intron|CD58_uc001egp.3_Missense_Mutation_p.R168C	NM_001779	NP_001770	P19256	LFA3_HUMAN	CD58 molecule isoform 1	168	Extracellular (Potential).|Ig-like C2-type.				blood coagulation|cell-cell adhesion|leukocyte migration	anchored to membrane|integral to plasma membrane	protein binding				0	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		GTTGAGTTACGTTTACATTGC	0.343													75	96	---	---	---	---	capture	Missense_Mutation	SNP	117078713	117078713	CD58	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2996	137
SPAG17	200162	broad.mit.edu	37	1	118623774	118623774	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118623774A>T	uc001ehk.2	-	15	2227	c.2159T>A	c.(2158-2160)CTG>CAG	p.L720Q		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	720						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTGCTCTAACAGCTGTCTATT	0.363													133	162	---	---	---	---	capture	Missense_Mutation	SNP	118623774	118623774	SPAG17	1	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	14871	137
SPAG17	200162	broad.mit.edu	37	1	118628591	118628591	+	Silent	SNP	A	C	C			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118628591A>C	uc001ehk.2	-	13	1784	c.1716T>G	c.(1714-1716)ACT>ACG	p.T572T		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	572						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTAGACGTTTAGTGTTGTTCC	0.388													87	104	---	---	---	---	capture	Silent	SNP	118628591	118628591	SPAG17	1	A	C	C	C	1	0	0	0	0	0	0	0	1	184	15	4	4	14871	137
SPTA1	6708	broad.mit.edu	37	1	158655079	158655079	+	Missense_Mutation	SNP	C	T	T	rs121918641		TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158655079C>T	uc001fst.1	-	2	282	c.83G>A	c.(82-84)CGT>CAT	p.R28H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	28	Spectrin 1.		R -> C (in EL2).|R -> L (in EL2).		actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CACTTCCTGACGCCTCTCCTG	0.348													68	107	---	---	---	---	capture	Missense_Mutation	SNP	158655079	158655079	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15008	137
LEFTY2	7044	broad.mit.edu	37	1	226127121	226127121	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226127121G>A	uc001hpt.1	-	3	757	c.677C>T	c.(676-678)GCG>GTG	p.A226V	LEFTY2_uc010pvk.1_Missense_Mutation_p.A192V|LEFTY2_uc009xek.1_Intron	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	226					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					CCCGGCTGGCGCCCCCTGCGA	0.701													15	10	---	---	---	---	capture	Missense_Mutation	SNP	226127121	226127121	LEFTY2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8636	137
RTKN2	219790	broad.mit.edu	37	10	63957757	63957757	+	Silent	SNP	G	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:63957757G>T	uc001jlw.2	-	12	1837	c.1740C>A	c.(1738-1740)ACC>ACA	p.T580T	RTKN2_uc009xpf.1_Intron|RTKN2_uc001jlv.2_Silent_p.T234T	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	580					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					CTTCAAAATTGGTTTTAGTGT	0.448													50	11	---	---	---	---	capture	Silent	SNP	63957757	63957757	RTKN2	10	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	13615	137
CHUK	1147	broad.mit.edu	37	10	101981868	101981868	+	Splice_Site	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:101981868C>T	uc001kqp.2	-	4	440	c.385_splice	c.e4+1	p.G129_splice		NM_001278	NP_001269	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase						I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)		CTGATACGTACCTATATCACT	0.313													17	6	---	---	---	---	capture	Splice_Site	SNP	101981868	101981868	CHUK	10	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	3381	137
LGR4	55366	broad.mit.edu	37	11	27390538	27390538	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:27390538C>T	uc001mrj.3	-	18	2217	c.1732G>A	c.(1732-1734)GGC>AGC	p.G578S	LGR4_uc001mrk.3_Missense_Mutation_p.G554S	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled	578	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1						GAAATCAAGCCTATAAACAAT	0.378													49	62	---	---	---	---	capture	Missense_Mutation	SNP	27390538	27390538	LGR4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	8676	137
HARBI1	283254	broad.mit.edu	37	11	46637480	46637480	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46637480C>T	uc001ncy.2	-	2	556	c.308G>A	c.(307-309)TGT>TAT	p.C103Y	KIAA0652_uc009yld.2_5'Flank|KIAA0652_uc001nda.2_5'Flank|KIAA0652_uc001ndb.2_5'Flank|KIAA0652_uc001ncz.2_5'Flank|KIAA0652_uc001ndc.2_5'Flank|KIAA0652_uc010rgv.1_5'Flank	NM_173811	NP_776172	Q96MB7	HARB1_HUMAN	harbinger transposase derived 1	103						cytoplasm|nucleus	metal ion binding|nuclease activity				0						ATTGGCAACACAACGACTCAT	0.488													112	141	---	---	---	---	capture	Missense_Mutation	SNP	46637480	46637480	HARBI1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	6885	137
VWF	7450	broad.mit.edu	37	12	6091103	6091103	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6091103C>T	uc001qnn.1	-	42	7386	c.7136G>A	c.(7135-7137)CGT>CAT	p.R2379H	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2379					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	GGTGGGCAAACGGTGCGGGGG	0.612													59	120	---	---	---	---	capture	Missense_Mutation	SNP	6091103	6091103	VWF	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17128	137
KRT3	3850	broad.mit.edu	37	12	53185580	53185580	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53185580C>T	uc001say.2	-	6	1275	c.1209G>A	c.(1207-1209)ACG>ACA	p.T403T		NM_057088	NP_476429	P12035	K2C3_HUMAN	keratin 3	403	Rod.|Coil 2.				epithelial cell differentiation|intermediate filament cytoskeleton organization	keratin filament	structural molecule activity				0						GCCTGCCAGCCGTGGTCTGCA	0.527													36	54	---	---	---	---	capture	Silent	SNP	53185580	53185580	KRT3	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8386	137
OR6C4	341418	broad.mit.edu	37	12	55945614	55945614	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55945614G>A	uc010spp.1	+	1	604	c.604G>A	c.(604-606)GTT>ATT	p.V202I		NM_001005494	NP_001005494	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C,	202	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCTCTTGGCCGTTGTGACTCT	0.483													59	146	---	---	---	---	capture	Missense_Mutation	SNP	55945614	55945614	OR6C4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11097	137
GLIPR1	11010	broad.mit.edu	37	12	75874782	75874782	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:75874782A>G	uc001sxs.2	+	1	270	c.122A>G	c.(121-123)CAT>CGT	p.H41R	GLIPR1_uc009zsb.1_Missense_Mutation_p.H41R	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor	41					cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3						GTTCGAATCCATAACAAGTTC	0.378													53	111	---	---	---	---	capture	Missense_Mutation	SNP	75874782	75874782	GLIPR1	12	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	6377	137
MGAT4C	25834	broad.mit.edu	37	12	86373908	86373908	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:86373908C>T	uc001tai.3	-	8	1846	c.596G>A	c.(595-597)CGT>CAT	p.R199H	MGAT4C_uc001tal.3_Missense_Mutation_p.R199H|MGAT4C_uc001taj.3_Missense_Mutation_p.R199H|MGAT4C_uc001tak.3_Missense_Mutation_p.R199H|MGAT4C_uc010sum.1_Missense_Mutation_p.R223H|MGAT4C_uc001tah.3_Missense_Mutation_p.R199H	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	199	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						TTGCTTGGAACGAAATTTGAC	0.338													7	393	---	---	---	---	capture	Missense_Mutation	SNP	86373908	86373908	MGAT4C	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9459	137
UHRF1BP1L	23074	broad.mit.edu	37	12	100453163	100453163	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100453163T>C	uc001tgq.2	-	14	2121	c.1892A>G	c.(1891-1893)AAA>AGA	p.K631R	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.K281R	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	631										ovary(2)	2						ATCACAATCTTTAAAGTCTTG	0.353													23	203	---	---	---	---	capture	Missense_Mutation	SNP	100453163	100453163	UHRF1BP1L	12	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	16851	137
SBNO1	55206	broad.mit.edu	37	12	123794339	123794339	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123794339C>T	uc010tap.1	-	25	3360	c.3360G>A	c.(3358-3360)GCG>GCA	p.A1120A	SBNO1_uc009zxv.2_RNA|SBNO1_uc010tao.1_Silent_p.A1119A|SBNO1_uc010taq.1_Silent_p.A71A|SBNO1_uc001ues.1_Silent_p.A71A	NM_018183	NP_060653	A3KN83	SBNO1_HUMAN	sno, strawberry notch homolog 1	1120							ATP binding|DNA binding|hydrolase activity			breast(5)|skin(2)|ovary(1)|kidney(1)	9	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		ACTGAAATAACGCATTCTGCT	0.328													144	211	---	---	---	---	capture	Silent	SNP	123794339	123794339	SBNO1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	13754	137
CDADC1	81602	broad.mit.edu	37	13	49865831	49865831	+	Silent	SNP	A	C	C			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49865831A>C	uc001vcu.2	+	10	1559	c.1483A>C	c.(1483-1485)AGA>CGA	p.R495R	CDADC1_uc010tgk.1_Silent_p.R297R|CDADC1_uc001vcv.2_RNA	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	495							hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		TGGTGTGTTGAGACCTGTCCC	0.488													77	118	---	---	---	---	capture	Silent	SNP	49865831	49865831	CDADC1	13	A	C	C	C	1	0	0	0	0	0	0	0	1	140	11	4	4	3024	137
C13orf39	196541	broad.mit.edu	37	13	103343256	103343256	+	Silent	SNP	G	A	A	rs140891650		TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:103343256G>A	uc001vpj.2	-	2	195	c.189C>T	c.(187-189)TAC>TAT	p.Y63Y	C13orf39_uc001vpk.2_Silent_p.Y63Y	NM_001010977	NP_001010977	Q5VZV1	MT21C_HUMAN	hypothetical protein LOC196541	63							methyltransferase activity				0						TGTAGCTGGCGTAATCTGTAG	0.443													106	118	---	---	---	---	capture	Silent	SNP	103343256	103343256	C13orf39	13	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1718	137
OR4N2	390429	broad.mit.edu	37	14	20295720	20295720	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20295720T>C	uc010tkv.1	+	1	113	c.113T>C	c.(112-114)ATC>ACC	p.I38T		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TACTTCATCATCCTCCCTGGA	0.438													11	476	---	---	---	---	capture	Missense_Mutation	SNP	20295720	20295720	OR4N2	14	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	10981	137
RNASE11	122651	broad.mit.edu	37	14	21052495	21052495	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21052495G>T	uc010ahv.2	-	2	324	c.139C>A	c.(139-141)CAG>AAG	p.Q47K	RNASE11_uc010ahx.2_Missense_Mutation_p.Q47K|RNASE11_uc010ahw.2_Missense_Mutation_p.Q47K|RNASE11_uc001vxs.2_Missense_Mutation_p.Q47K	NM_145250	NP_660293	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	47						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			ovary(3)	3	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		TCAATGGTCTGTTTTTCTTGG	0.378													204	286	---	---	---	---	capture	Missense_Mutation	SNP	21052495	21052495	RNASE11	14	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	13293	137
ARID4A	5926	broad.mit.edu	37	14	58831848	58831848	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:58831848A>G	uc001xdp.2	+	20	3295	c.3041A>G	c.(3040-3042)GAT>GGT	p.D1014G	ARID4A_uc001xdo.2_Missense_Mutation_p.D1014G|ARID4A_uc001xdq.2_Missense_Mutation_p.D1014G|ARID4A_uc010apg.1_Missense_Mutation_p.D692G	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	1014					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						CTTAGTCAAGATGAGTCTCGA	0.413													101	156	---	---	---	---	capture	Missense_Mutation	SNP	58831848	58831848	ARID4A	14	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	912	137
AHNAK2	113146	broad.mit.edu	37	14	105408457	105408457	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105408457C>T	uc010axc.1	-	7	13451	c.13331G>A	c.(13330-13332)CGG>CAG	p.R4444Q	AHNAK2_uc001ypx.2_Missense_Mutation_p.R4344Q	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4444						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCCTCCAGCCGCGTACTGTC	0.587													137	134	---	---	---	---	capture	Missense_Mutation	SNP	105408457	105408457	AHNAK2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	415	137
PLCB2	5330	broad.mit.edu	37	15	40583002	40583002	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40583002G>C	uc001zld.2	-	28	3374	c.3073C>G	c.(3073-3075)CAG>GAG	p.Q1025E	PLCB2_uc001zlc.2_Missense_Mutation_p.Q9E|PLCB2_uc010bbo.2_Missense_Mutation_p.Q1021E|PLCB2_uc010ucm.1_Missense_Mutation_p.Q1010E	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	1025	Potential.				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TCTGCCGCCTGTTTCTCTCTG	0.587													18	22	---	---	---	---	capture	Missense_Mutation	SNP	40583002	40583002	PLCB2	15	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	11931	137
VPS39	23339	broad.mit.edu	37	15	42457929	42457929	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42457929G>A	uc001zpd.2	-	18	1950	c.1799C>T	c.(1798-1800)GCT>GTT	p.A600V	VPS39_uc001zpc.2_Missense_Mutation_p.A589V|VPS39_uc001zpb.2_5'UTR	NM_015289	NP_056104	Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39	600					protein transport	HOPS complex|late endosome membrane|lysosomal membrane	small GTPase regulator activity			ovary(1)|pancreas(1)|skin(1)	3		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		ATAAGGAATAGCCAGACCCTT	0.443													73	83	---	---	---	---	capture	Missense_Mutation	SNP	42457929	42457929	VPS39	15	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	17091	137
SLC27A2	11001	broad.mit.edu	37	15	50518260	50518260	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50518260G>A	uc001zxw.2	+	6	1475	c.1243G>A	c.(1243-1245)GTC>ATC	p.V415I	SLC27A2_uc010bes.2_Missense_Mutation_p.V362I|SLC27A2_uc001zxx.2_Missense_Mutation_p.V180I	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	415	Cytoplasmic (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		TGGATATTGCGTCAGAGTTCC	0.353													63	79	---	---	---	---	capture	Missense_Mutation	SNP	50518260	50518260	SLC27A2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14418	137
ACAN	176	broad.mit.edu	37	15	89395102	89395102	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89395102G>A	uc010upo.1	+	11	2478	c.2104G>A	c.(2104-2106)GTG>ATG	p.V702M	ACAN_uc010upp.1_Missense_Mutation_p.V702M|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	702					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GGAGTGGATCGTGACCCAAGT	0.567													11	15	---	---	---	---	capture	Missense_Mutation	SNP	89395102	89395102	ACAN	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	117	137
GRIN2A	2903	broad.mit.edu	37	16	9858195	9858195	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9858195G>A	uc002czo.3	-	13	3754	c.3206C>T	c.(3205-3207)ACG>ATG	p.T1069M	GRIN2A_uc010uym.1_Missense_Mutation_p.T1069M|GRIN2A_uc010uyn.1_Missense_Mutation_p.T912M|GRIN2A_uc002czr.3_Missense_Mutation_p.T1069M	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1069	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CCTGTGGCACGTGGCCCGATT	0.502													144	174	---	---	---	---	capture	Missense_Mutation	SNP	9858195	9858195	GRIN2A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6712	137
IL4R	3566	broad.mit.edu	37	16	27373745	27373745	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27373745G>A	uc002don.2	+	11	1314	c.1072G>A	c.(1072-1074)GTG>ATG	p.V358M	IL4R_uc002dop.3_Missense_Mutation_p.V343M|IL4R_uc010bxy.2_Missense_Mutation_p.V358M|IL4R_uc002doo.2_Missense_Mutation_p.V198M	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	358	Cytoplasmic (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						GAGCATCAGCGTGGTGCGATG	0.562													52	46	---	---	---	---	capture	Missense_Mutation	SNP	27373745	27373745	IL4R	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7621	137
CDH8	1006	broad.mit.edu	37	16	61687974	61687974	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:61687974C>T	uc002eog.1	-	12	2190	c.1938G>A	c.(1936-1938)CGG>CGA	p.R646R		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	646	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.R646Q(1)		ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CATTTTTATGCCGCCGTAGAG	0.388													4	173	---	---	---	---	capture	Silent	SNP	61687974	61687974	CDH8	16	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	3087	137
C16orf7	9605	broad.mit.edu	37	16	89782935	89782935	+	Silent	SNP	G	C	C			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89782935G>C	uc002fom.1	-	4	491	c.366C>G	c.(364-366)CTC>CTG	p.L122L	C16orf7_uc002fol.1_Silent_p.L52L|uc002fon.1_RNA|uc002foo.1_5'Flank	NM_004913	NP_004904	Q9Y2B5	CP007_HUMAN	chromosome 16 open reading frame 7	122					ATP synthesis coupled proton transport		GTPase activator activity|transporter activity				0		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		GAAAAGGAGAGAGCTTTCCTC	0.567													234	293	---	---	---	---	capture	Silent	SNP	89782935	89782935	C16orf7	16	G	C	C	C	1	0	0	0	0	0	0	0	1	418	33	4	4	1814	137
PRPF8	10594	broad.mit.edu	37	17	1577046	1577046	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1577046A>G	uc002fte.2	-	22	3554	c.3440T>C	c.(3439-3441)GTT>GCT	p.V1147A		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1147						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TCACAAGTTAACATCATGTTT	0.537													62	93	---	---	---	---	capture	Missense_Mutation	SNP	1577046	1577046	PRPF8	17	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	12471	137
SPDYE4	388333	broad.mit.edu	37	17	8658859	8658859	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8658859C>T	uc010cnz.1	-	4	641	c.464G>A	c.(463-465)CGC>CAC	p.R155H		NM_001128076	NP_001121548	A6NLX3	SPDE4_HUMAN	speedy homolog E4	155											0						GAAATGAATGCGTTGGTATTG	0.493													105	124	---	---	---	---	capture	Missense_Mutation	SNP	8658859	8658859	SPDYE4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14923	137
MYH4	4622	broad.mit.edu	37	17	10369590	10369590	+	Silent	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10369590G>A	uc002gmn.2	-	4	459	c.348C>T	c.(346-348)TAC>TAT	p.Y116Y	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	116	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GGGTGCTCACGTAGATCATCC	0.433													61	78	---	---	---	---	capture	Silent	SNP	10369590	10369590	MYH4	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9947	137
ACCN1	40	broad.mit.edu	37	17	31351022	31351022	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:31351022C>T	uc002hhu.2	-	6	1327	c.1053G>A	c.(1051-1053)GCG>GCA	p.A351A	ACCN1_uc002hht.2_Silent_p.A402A	NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	351	Extracellular (By similarity).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	TGTCCTTTTCCGCCAACAGAC	0.532													97	132	---	---	---	---	capture	Silent	SNP	31351022	31351022	ACCN1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	128	137
C17orf53	78995	broad.mit.edu	37	17	42225478	42225478	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42225478C>T	uc002ifi.1	+	3	492	c.307C>T	c.(307-309)CCT>TCT	p.P103S	C17orf53_uc010czq.1_Missense_Mutation_p.P103S|C17orf53_uc002ifj.1_Missense_Mutation_p.P103S|C17orf53_uc002ifk.1_RNA	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995	103											0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TCCCCTAAGGCCTGTCTCTAC	0.577													67	98	---	---	---	---	capture	Missense_Mutation	SNP	42225478	42225478	C17orf53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1847	137
CTDP1	9150	broad.mit.edu	37	18	77513692	77513692	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77513692G>A	uc002lnh.1	+	13	2935	c.2788G>A	c.(2788-2790)GAG>AAG	p.E930K	CTDP1_uc002lni.1_3'UTR|CTDP1_uc010drd.1_3'UTR	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	930					positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CGCCGCCAGCGAGTCCAGCAG	0.617													21	19	---	---	---	---	capture	Missense_Mutation	SNP	77513692	77513692	CTDP1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3966	137
MATK	4145	broad.mit.edu	37	19	3783948	3783948	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3783948G>T	uc002lyt.2	-	6	846	c.446C>A	c.(445-447)TCC>TAC	p.S149Y	MATK_uc002lyv.2_Missense_Mutation_p.S150Y|MATK_uc002lyu.2_Missense_Mutation_p.S108Y|MATK_uc010dtq.2_Missense_Mutation_p.S149Y	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform	149	SH2.				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGCGCGCGGACTCCCGCAC	0.682													8	28	---	---	---	---	capture	Missense_Mutation	SNP	3783948	3783948	MATK	19	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	9245	137
NCAN	1463	broad.mit.edu	37	19	19351446	19351446	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19351446C>T	uc002nlz.2	+	12	3543	c.3444C>T	c.(3442-3444)AAC>AAT	p.N1148N	NCAN_uc002nma.2_Translation_Start_Site	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	1148	C-type lectin.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			TCGGCCTGAACGACAGGATCG	0.637													8	130	---	---	---	---	capture	Silent	SNP	19351446	19351446	NCAN	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10111	137
KIR2DL1	3802	broad.mit.edu	37	19	55284915	55284915	+	Silent	SNP	C	T	T	rs144426670	byFrequency	TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55284915C>T	uc002qhb.1	+	3	239	c.201C>T	c.(199-201)AAC>AAT	p.N67N	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron|KIR2DL1_uc010erz.1_Silent_p.N67N	NM_014218	NP_055033	P43626	KI2L1_HUMAN	killer cell immunoglobulin-like receptor, two	67	Extracellular (Potential).|Ig-like C2-type 1.				immune response|natural killer cell inhibitory signaling pathway	integral to plasma membrane	protein binding|receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		GGATGTTTAACGACACTTTGC	0.517													123	229	---	---	---	---	capture	Silent	SNP	55284915	55284915	KIR2DL1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8238	137
ZSCAN1	284312	broad.mit.edu	37	19	58565272	58565272	+	Silent	SNP	C	T	T	rs144381428		TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58565272C>T	uc002qrc.1	+	6	1327	c.1080C>T	c.(1078-1080)TCC>TCT	p.S360S		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	360					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCCGGGAGTCCGTCCCACCCA	0.662													25	39	---	---	---	---	capture	Silent	SNP	58565272	58565272	ZSCAN1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	18102	137
KIDINS220	57498	broad.mit.edu	37	2	8943255	8943255	+	Silent	SNP	A	G	G			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:8943255A>G	uc002qzc.2	-	8	788	c.606T>C	c.(604-606)AAT>AAC	p.N202N	KIDINS220_uc010yiv.1_Silent_p.N11N|KIDINS220_uc002qzd.2_Silent_p.N160N|KIDINS220_uc010yiw.1_Silent_p.N203N	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	202	ANK 7.|Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CAGTCATTGAATTCTAAAAAC	0.299													27	23	---	---	---	---	capture	Silent	SNP	8943255	8943255	KIDINS220	2	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	8193	137
IL18RAP	8807	broad.mit.edu	37	2	103068411	103068411	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103068411C>T	uc002tbx.2	+	12	2054	c.1570C>T	c.(1570-1572)CCT>TCT	p.P524S	IL18RAP_uc010fiz.2_Missense_Mutation_p.P382S	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	524	TIR.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						AGAGTCTCTACCTCATCTCGT	0.418													39	240	---	---	---	---	capture	Missense_Mutation	SNP	103068411	103068411	IL18RAP	2	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	7571	137
LIMS1	3987	broad.mit.edu	37	2	109292448	109292448	+	Silent	SNP	C	T	T	rs111779374		TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109292448C>T	uc002teg.2	+	6	728	c.609C>T	c.(607-609)CGC>CGT	p.R203R	LIMS1_uc002tef.2_Silent_p.R215R|LIMS1_uc002teh.2_Silent_p.R203R|LIMS1_uc002tei.2_Silent_p.R203R|LIMS1_uc002tej.2_Silent_p.R240R|LIMS1_uc002tek.3_Silent_p.R265R	NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1	203	LIM zinc-binding 4.				cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						TCGAAGGGCGCGTGGTGAACG	0.537													33	24	---	---	---	---	capture	Silent	SNP	109292448	109292448	LIMS1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8723	137
DPP10	57628	broad.mit.edu	37	2	116447456	116447456	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116447456G>A	uc002tla.1	+	7	992	c.535G>A	c.(535-537)GTC>ATC	p.V179I	DPP10_uc002tlb.1_Missense_Mutation_p.V129I|DPP10_uc002tlc.1_Missense_Mutation_p.V175I|DPP10_uc002tle.2_Missense_Mutation_p.V183I|DPP10_uc002tlf.1_Missense_Mutation_p.V172I	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	179	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AGAGGACTCCGTCTTGCAGTA	0.438													50	55	---	---	---	---	capture	Missense_Mutation	SNP	116447456	116447456	DPP10	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4682	137
CRYBB2	1415	broad.mit.edu	37	22	25627599	25627599	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:25627599C>T	uc003abp.1	+	6	526	c.478C>T	c.(478-480)CGT>TGT	p.R160C		NM_000496	NP_000487	P43320	CRBB2_HUMAN	crystallin, beta B2	160	Beta/gamma crystallin 'Greek key' 4.				response to stimulus|visual perception		structural constituent of eye lens				0						CCCCGGCTACCGTGGGCTGCA	0.473													68	117	---	---	---	---	capture	Missense_Mutation	SNP	25627599	25627599	CRYBB2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3876	137
CYP8B1	1582	broad.mit.edu	37	3	42916850	42916850	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42916850C>T	uc003cmh.2	-	1	784	c.459G>A	c.(457-459)ACG>ACA	p.T153T	CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Silent_p.T153T	NM_004391	NP_004382	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B,	153					bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity|electron carrier activity|heme binding|oxygen binding|sterol 12-alpha-hydroxylase activity			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		AGCCTTTGGACGTCAGCATTA	0.512													51	77	---	---	---	---	capture	Silent	SNP	42916850	42916850	CYP8B1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4158	137
MYLK	4638	broad.mit.edu	37	3	123376130	123376130	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123376130C>T	uc003ego.2	-	24	4413	c.4131G>A	c.(4129-4131)ACG>ACA	p.T1377T	MYLK_uc010hrr.2_Translation_Start_Site|MYLK_uc011bjv.1_Silent_p.T177T|MYLK_uc011bjw.1_Silent_p.T1377T|MYLK_uc003egp.2_Silent_p.T1308T|MYLK_uc003egq.2_Silent_p.T1377T|MYLK_uc003egr.2_Silent_p.T1308T|MYLK_uc003egs.2_Silent_p.T1201T	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1377	Actin-binding (calcium/calmodulin- insensitive) (By similarity).|Fibronectin type-III.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GTTCCTTCCACGTCTTGTTGG	0.542													51	53	---	---	---	---	capture	Silent	SNP	123376130	123376130	MYLK	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	9966	137
RTP1	132112	broad.mit.edu	37	3	186917604	186917604	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186917604C>T	uc003frg.2	+	2	568	c.538C>T	c.(538-540)CGC>TGC	p.R180C		NM_153708	NP_714919	P59025	RTP1_HUMAN	receptor transporting protein 1	180	Cytoplasmic (Potential).				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding			ovary(2)|breast(1)	3	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		CGTGGCCAGCCGCCAGGACAA	0.682													13	9	---	---	---	---	capture	Missense_Mutation	SNP	186917604	186917604	RTP1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13625	137
HPSE	10855	broad.mit.edu	37	4	84223384	84223384	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:84223384C>T	uc003hoj.3	-	10	1343	c.1244G>A	c.(1243-1245)GGC>GAC	p.G415D	HPSE_uc010ika.2_Missense_Mutation_p.G357D|HPSE_uc011ccq.1_RNA|HPSE_uc011ccr.1_RNA|HPSE_uc011ccs.1_Missense_Mutation_p.G158D|HPSE_uc011cct.1_Missense_Mutation_p.G341D|HPSE_uc003hok.3_Missense_Mutation_p.G415D	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor	415					carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	CACCTTGGTGCCCACCAATTT	0.403													89	84	---	---	---	---	capture	Missense_Mutation	SNP	84223384	84223384	HPSE	4	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7269	137
ZFP42	132625	broad.mit.edu	37	4	188924752	188924752	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:188924752C>T	uc003izg.1	+	3	1036	c.791C>T	c.(790-792)ACG>ATG	p.T264M	ZFP42_uc003izh.1_Missense_Mutation_p.T264M|ZFP42_uc003izi.1_Missense_Mutation_p.T264M	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	264	C2H2-type 3.				female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		AATTTGCGTACGCACGTGCGC	0.483													40	50	---	---	---	---	capture	Missense_Mutation	SNP	188924752	188924752	ZFP42	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17530	137
AHRR	57491	broad.mit.edu	37	5	422883	422883	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:422883G>A	uc003jav.2	+	6	537	c.493G>A	c.(493-495)GTG>ATG	p.V165M	AHRR_uc003jaw.2_Missense_Mutation_p.V161M|AHRR_uc010isy.2_Missense_Mutation_p.V11M|AHRR_uc010isz.2_Missense_Mutation_p.V161M|AHRR_uc003jax.2_Translation_Start_Site|AHRR_uc003jay.2_Missense_Mutation_p.V21M	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor	165	PAS.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			CTACATCCACGTGGACGACCG	0.547													41	32	---	---	---	---	capture	Missense_Mutation	SNP	422883	422883	AHRR	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	417	137
MAP3K1	4214	broad.mit.edu	37	5	56160697	56160697	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56160697C>T	uc003jqw.3	+	4	1472	c.971C>T	c.(970-972)CCT>CTT	p.P324L		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	324					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAGATAGGGCCTAACTCTTTC	0.468													4	114	---	---	---	---	capture	Missense_Mutation	SNP	56160697	56160697	MAP3K1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	9157	137
PIK3R1	5295	broad.mit.edu	37	5	67576379	67576379	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67576379A>T	uc003jva.2	+	6	1218	c.658A>T	c.(658-660)ATT>TTT	p.I220F	PIK3R1_uc003jvb.2_Missense_Mutation_p.I220F	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	220	Rho-GAP.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CGAAGAATATATTCAGCTATT	0.343			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			137	188	---	---	---	---	capture	Missense_Mutation	SNP	67576379	67576379	PIK3R1	5	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	11821	137
ZNF608	57507	broad.mit.edu	37	5	123984804	123984804	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:123984804C>A	uc003ktq.1	-	4	1396	c.1273G>T	c.(1273-1275)GAC>TAC	p.D425Y	ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_Missense_Mutation_p.D425Y|ZNF608_uc003ktt.1_Missense_Mutation_p.D425Y	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	425						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		ATCTCCAGGTCACTTGTCGGT	0.552													36	36	---	---	---	---	capture	Missense_Mutation	SNP	123984804	123984804	ZNF608	5	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	17912	137
FBXO38	81545	broad.mit.edu	37	5	147781654	147781654	+	Silent	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147781654G>A	uc003lpf.1	+	4	492	c.372G>A	c.(370-372)GAG>GAA	p.E124E	FBXO38_uc003lpg.1_Silent_p.E124E|FBXO38_uc003lph.2_Silent_p.E124E	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	124						cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGCCATGAGGCTTTTAGCA	0.448													97	112	---	---	---	---	capture	Silent	SNP	147781654	147781654	FBXO38	5	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	5692	137
NDUFAF4	29078	broad.mit.edu	37	6	97344693	97344693	+	Missense_Mutation	SNP	C	T	T	rs142963790		TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:97344693C>T	uc003pow.2	-	2	257	c.167G>A	c.(166-168)CGT>CAT	p.R56H	NDUFAF4_uc003pov.2_RNA	NM_014165	NP_054884	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	56					mitochondrial respiratory chain complex I assembly	mitochondrial membrane	calmodulin binding			ovary(1)	1						TTCATCTTTACGAGCAATCTC	0.333													7	210	---	---	---	---	capture	Missense_Mutation	SNP	97344693	97344693	NDUFAF4	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10184	137
GRM1	2911	broad.mit.edu	37	6	146755476	146755476	+	Silent	SNP	C	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146755476C>A	uc010khw.1	+	9	3599	c.3129C>A	c.(3127-3129)ACC>ACA	p.T1043T	GRM1_uc010khv.1_3'UTR|GRM1_uc003qll.2_3'UTR|GRM1_uc011edz.1_3'UTR|GRM1_uc011eea.1_3'UTR	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	1043	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	ACTTCAGTACCGCGATCCCGG	0.672													46	62	---	---	---	---	capture	Silent	SNP	146755476	146755476	GRM1	6	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	6729	137
TIAM2	26230	broad.mit.edu	37	6	155566797	155566797	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155566797C>T	uc003qqb.2	+	21	4857	c.3584C>T	c.(3583-3585)GCG>GTG	p.A1195V	TIAM2_uc003qqe.2_Missense_Mutation_p.A1195V|TIAM2_uc010kjj.2_Missense_Mutation_p.A728V|TIAM2_uc003qqf.2_Missense_Mutation_p.A571V|TIAM2_uc011efl.1_Missense_Mutation_p.A531V|TIAM2_uc003qqg.2_Missense_Mutation_p.A507V|TIAM2_uc003qqh.2_Missense_Mutation_p.A120V	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1195	DH.				apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CTTTATTACGCGGACCACTTT	0.403													172	318	---	---	---	---	capture	Missense_Mutation	SNP	155566797	155566797	TIAM2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15776	137
ZPBP	11055	broad.mit.edu	37	7	50097645	50097645	+	Missense_Mutation	SNP	C	T	T	rs148913753		TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50097645C>T	uc003tou.2	-	4	497	c.427G>A	c.(427-429)GAA>AAA	p.E143K	ZPBP_uc011kci.1_Missense_Mutation_p.E69K|ZPBP_uc010kyw.2_Missense_Mutation_p.E142K	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	143					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					GGTTTATATTCGAGGAAACAT	0.328													71	171	---	---	---	---	capture	Missense_Mutation	SNP	50097645	50097645	ZPBP	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	18095	137
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			891	50	---	---	---	---	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	137
TYW1B	441250	broad.mit.edu	37	7	72093896	72093896	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72093896C>T	uc011kej.1	-	15	1752	c.1593G>A	c.(1591-1593)GGG>GGA	p.G531G	TYW1B_uc011keh.1_Silent_p.G369G|TYW1B_uc011kei.1_Silent_p.G157G	NM_001145440	NP_001138912	Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B isoform	531					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity				0						AGTCAGGATTCCCCAGGGACA	0.537													3	25	---	---	---	---	capture	Silent	SNP	72093896	72093896	TYW1B	7	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	16701	137
EPO	2056	broad.mit.edu	37	7	100319586	100319586	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100319586C>T	uc003uwi.2	+	3	342	c.161C>T	c.(160-162)ACG>ATG	p.T54M	EPO_uc011kkc.1_Missense_Mutation_p.T54M	NM_000799	NP_000790	P01588	EPO_HUMAN	erythropoietin precursor	54					blood circulation|cellular hyperosmotic response|erythrocyte maturation|negative regulation of apoptosis|negative regulation of ion transmembrane transporter activity|negative regulation of sodium ion transport|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat5 protein|signal transduction	extracellular space	erythropoietin receptor binding|eukaryotic cell surface binding|hormone activity			central_nervous_system(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)	GCATTTCAGACGGGCTGTGCT	0.532													44	144	---	---	---	---	capture	Missense_Mutation	SNP	100319586	100319586	EPO	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5143	137
LAMB1	3912	broad.mit.edu	37	7	107575937	107575937	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107575937G>A	uc003vew.2	-	27	4446	c.4111C>T	c.(4111-4113)CAA>TAA	p.Q1371*	LAMB1_uc003vev.2_Nonsense_Mutation_p.Q1395*	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	1371	Potential.|Domain II.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGCTCCTCTTGTTTTTCCTTG	0.532													11	729	---	---	---	---	capture	Nonsense_Mutation	SNP	107575937	107575937	LAMB1	7	G	A	A	A	1	0	0	0	0	0	1	0	0	624	48	5	2	8530	137
ASZ1	136991	broad.mit.edu	37	7	117024875	117024875	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117024875C>G	uc003vjb.2	-	6	655	c.592G>C	c.(592-594)GTT>CTT	p.V198L	ASZ1_uc011kno.1_Missense_Mutation_p.V198L|ASZ1_uc011knp.1_5'UTR	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper	198	ANK 5.				cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			AACTTCAAAACTATATTTTTA	0.383													96	112	---	---	---	---	capture	Missense_Mutation	SNP	117024875	117024875	ASZ1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	1060	137
IFNA10	3446	broad.mit.edu	37	9	21206859	21206859	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21206859G>A	uc003zoq.1	-	1	284	c.238C>T	c.(238-240)CTC>TTC	p.L80F	IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor	80					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		ATCTCATGGAGGACAGAGATG	0.483													4	62	---	---	---	---	capture	Missense_Mutation	SNP	21206859	21206859	IFNA10	9	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	7457	137
IFNA10	3446	broad.mit.edu	37	9	21206861	21206861	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21206861A>G	uc003zoq.1	-	1	282	c.236T>C	c.(235-237)GTC>GCC	p.V79A	IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor	79					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		CTCATGGAGGACAGAGATGGC	0.488													4	62	---	---	---	---	capture	Missense_Mutation	SNP	21206861	21206861	IFNA10	9	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	7457	137
ZNF618	114991	broad.mit.edu	37	9	116750724	116750724	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116750724C>T	uc004bid.2	+	3	300	c.201C>T	c.(199-201)CCC>CCT	p.P67P	ZNF618_uc004bib.1_Silent_p.P67P|ZNF618_uc004bic.2_Silent_p.P67P|ZNF618_uc011lxi.1_Silent_p.P67P|ZNF618_uc011lxj.1_Silent_p.P67P	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	67					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGAGCTGCCCGATGACTACA	0.632													29	17	---	---	---	---	capture	Silent	SNP	116750724	116750724	ZNF618	9	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17920	137
NOXA1	10811	broad.mit.edu	37	9	140325755	140325755	+	Missense_Mutation	SNP	G	A	A	rs141558298		TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140325755G>A	uc004cmv.2	+	8	901	c.766G>A	c.(766-768)GGT>AGT	p.G256S	C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Missense_Mutation_p.G256S|NOXA1_uc010nch.2_Missense_Mutation_p.G200S	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1	256					regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		GACAGAGGTCGGTGCTGACCG	0.672													9	137	---	---	---	---	capture	Missense_Mutation	SNP	140325755	140325755	NOXA1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10467	137
ARHGAP6	395	broad.mit.edu	37	X	11160414	11160414	+	Silent	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11160414G>A	uc004cup.1	-	12	3069	c.2196C>T	c.(2194-2196)TTC>TTT	p.F732F	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cum.1_Silent_p.F529F|ARHGAP6_uc004cun.1_Silent_p.F552F	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	732					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						CCCAGATATCGAAAGGCTCCT	0.318													136	145	---	---	---	---	capture	Silent	SNP	11160414	11160414	ARHGAP6	23	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	880	137
SCML2	10389	broad.mit.edu	37	X	18348708	18348708	+	Silent	SNP	C	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18348708C>T	uc004cyl.2	-	3	247	c.90G>A	c.(88-90)AGG>AGA	p.R30R	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Silent_p.R30R|SCML2_uc011miz.1_Intron	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	30					anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					AAAACCTACCCCTTTGTACAG	0.308													30	55	---	---	---	---	capture	Silent	SNP	18348708	18348708	SCML2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	13803	137
DCAF8L2	347442	broad.mit.edu	37	X	27765650	27765650	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:27765650C>A	uc011mjy.1	+	1	725	c.638C>A	c.(637-639)GCC>GAC	p.A213D		NM_001136533	NP_001130005			DDB1 and CUL4 associated factor 8-like 2											central_nervous_system(1)|pancreas(1)	2						GGGGCAAGAGCCTTTGTGCAG	0.592													6	8	---	---	---	---	capture	Missense_Mutation	SNP	27765650	27765650	DCAF8L2	23	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	4237	137
FAM47C	442444	broad.mit.edu	37	X	37028542	37028542	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37028542G>A	uc004ddl.1	+	1	2073	c.2059G>A	c.(2059-2061)GTA>ATA	p.V687I		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	687										ovary(3)	3						AGAGACTCGCGTATCTCATCT	0.657													49	59	---	---	---	---	capture	Missense_Mutation	SNP	37028542	37028542	FAM47C	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5519	137
BCORL1	63035	broad.mit.edu	37	X	129149265	129149265	+	Silent	SNP	G	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129149265G>A	uc004evb.1	+	4	2631	c.2517G>A	c.(2515-2517)GCG>GCA	p.A839A	BCORL1_uc010nrd.1_Silent_p.A741A	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	839					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						ACCACCAGGCGTCTCTGCTTT	0.607													90	123	---	---	---	---	capture	Silent	SNP	129149265	129149265	BCORL1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	1376	137
GPR112	139378	broad.mit.edu	37	X	135485475	135485475	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135485475C>A	uc004ezu.1	+	22	8939	c.8648C>A	c.(8647-8649)ACT>AAT	p.T2883N	GPR112_uc010nsb.1_Missense_Mutation_p.T2678N	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2883	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					AGCCCAACAACTCCGTTGTAA	0.498													44	50	---	---	---	---	capture	Missense_Mutation	SNP	135485475	135485475	GPR112	23	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	6563	137
RBMX	27316	broad.mit.edu	37	X	135961572	135961572	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135961572A>T	uc004fae.1	-	2	225	c.15T>A	c.(13-15)GAT>GAA	p.D5E	RBMX_uc011mwf.1_Missense_Mutation_p.D5E|RBMX_uc004fad.1_Missense_Mutation_p.D5E|RBMX_uc011mwg.1_5'UTR|RBMX_uc004faf.1_5'UTR|RBMX_uc010nsf.1_Intron|RBMX_uc004fag.1_Intron|SNORD61_uc004fah.1_5'Flank	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	5						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TTCCTGGGCGATCTGCTTCAA	0.403													7	270	---	---	---	---	capture	Missense_Mutation	SNP	135961572	135961572	RBMX	23	A	T	T	T	1	0	0	0	0	1	0	0	0	154	12	4	4	13046	137
ZCCHC17	51538	broad.mit.edu	37	1	31810124	31810125	+	Splice_Site	INS	-	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:31810124_31810125insA	uc001bsp.1	+	4	361	c.225_splice	c.e4+2	p.E75_splice	ZCCHC17_uc001bsq.1_Splice_Site_p.E67_splice|ZCCHC17_uc010ogf.1_Splice_Site_p.E51_splice|ZCCHC17_uc009vtu.1_Splice_Site_p.E51_splice|ZCCHC17_uc001bsr.1_Splice_Site_p.E75_splice|ZCCHC17_uc009vtv.1_Splice_Site_p.E51_splice	NM_016505	NP_057589	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17							nucleolus	RNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		GGCCGAGAGGTAAAGTTCTGTG	0.426													7	236	---	---	---	---	capture_indel	Splice_Site	INS	31810124	31810125	ZCCHC17	1	-	A	A	A	1	0	1	1	0	0	0	1	0	741	57	5	5	17465	137
S1PR1	1901	broad.mit.edu	37	1	101705315	101705317	+	In_Frame_Del	DEL	ATT	-	-			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:101705315_101705317delATT	uc001dud.2	+	2	1289_1291	c.775_777delATT	c.(775-777)ATTdel	p.I260del	S1PR1_uc009weg.2_In_Frame_Del_p.I260del	NM_001400	NP_001391	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	260	Helical; Name=6; (By similarity).				cell adhesion	integral to membrane	lysosphingolipid and lysophosphatidic acid receptor activity			ovary(2)|lung(1)	3						CAAGACCGTAATTATCGTCCTGA	0.591													117	165	---	---	---	---	capture_indel	In_Frame_Del	DEL	101705315	101705317	S1PR1	1	ATT	-	-	-	1	0	1	0	1	0	0	0	0	52	4	5	5	13685	137
SFRS8	6433	broad.mit.edu	37	12	132281734	132281736	+	In_Frame_Del	DEL	AGA	-	-			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132281734_132281736delAGA	uc001uja.1	+	16	2686_2688	c.2546_2548delAGA	c.(2545-2550)GAGAAG>GAG	p.K853del	SFRS8_uc010tbn.1_In_Frame_Del_p.K905del	NM_004592	NP_004583	Q12872	SFSWA_HUMAN	splicing factor, arginine/serine-rich 8	853	Poly-Lys.|Arg/Ser-rich (RS domain).				mRNA splice site selection|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|RNA binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.44e-07)|Epithelial(86;2.94e-06)|all cancers(50;4.82e-05)		AGTCCCCACGAGAAGAAGAAGAA	0.493													8	487	---	---	---	---	capture_indel	In_Frame_Del	DEL	132281734	132281736	SFRS8	12	AGA	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	14076	137
NR1H2	7376	broad.mit.edu	37	19	50882422	50882423	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50882422_50882423insG	uc010enw.2	+	8	1190_1191	c.914_915insG	c.(913-915)AAGfs	p.K305fs	NR1H2_uc002prv.3_RNA|NR1H2_uc002prz.3_Frame_Shift_Ins_p.K260fs|NR1H2_uc002psa.3_Frame_Shift_Ins_p.K207fs	NM_007121	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	304	Ligand-binding (Potential).				negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of pinocytosis|negative regulation of transcription, DNA-dependent|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		GCCCTCCTGAAGGCATCCACTA	0.574													51	196	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	50882422	50882423	NR1H2	19	-	G	G	G	1	0	1	1	0	0	0	0	0	39	3	5	5	10524	137
SNAPC4	6621	broad.mit.edu	37	9	139282191	139282192	+	Splice_Site	INS	-	A	A			TCGA-14-0790-01	TCGA-14-0790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139282191_139282192insA	uc004chh.2	-	11	1239	c.1230_splice	c.e11+1	p.A410_splice		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,						snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CCCGCACACTTACAGCATCTTC	0.579													63	67	---	---	---	---	capture_indel	Splice_Site	INS	139282191	139282192	SNAPC4	9	-	A	A	A	1	0	1	1	0	0	0	1	0	781	61	5	5	14729	137
