Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ACOT11	26027	broad.mit.edu	37	1	55096492	55096492	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55096492G>A	uc001cxm.1	+	16	1797	c.1715G>A	c.(1714-1716)CGC>CAC	p.R572H		NM_015547	NP_056362	Q8WXI4	ACO11_HUMAN	thioesterase, adipose associated isoform BFIT1	572	START.				fatty acid metabolic process|intracellular signal transduction|response to cold		acyl-CoA thioesterase activity|carboxylesterase activity			central_nervous_system(1)	1						tcaaagggtcgcaggagcgac	0.000													8	19	---	---	---	---	capture	Missense_Mutation	SNP	55096492	55096492	ACOT11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	149	144
PGM1	5236	broad.mit.edu	37	1	64100595	64100595	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:64100595C>T	uc001dbh.2	+	5	991	c.778C>T	c.(778-780)CAC>TAC	p.H260Y	PGM1_uc010ooy.1_Missense_Mutation_p.H63Y|PGM1_uc010ooz.1_Missense_Mutation_p.H278Y	NM_002633	NP_002624	P36871	PGM1_HUMAN	phosphoglucomutase 1	260					cellular calcium ion homeostasis|galactose catabolic process|glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity			ovary(2)|kidney(1)	3						CTTTGGAGGCCACCACCCTGA	0.547													6	231	---	---	---	---	capture	Missense_Mutation	SNP	64100595	64100595	PGM1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	11700	144
HMCN1	83872	broad.mit.edu	37	1	185956668	185956668	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185956668T>C	uc001grq.1	+	20	3269	c.3040T>C	c.(3040-3042)TGG>CGG	p.W1014R	HMCN1_uc001grr.1_Missense_Mutation_p.W355R	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1014	Ig-like C2-type 7.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GTCTGTCATCTGGTCCAAGGT	0.453													20	171	---	---	---	---	capture	Missense_Mutation	SNP	185956668	185956668	HMCN1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	7145	144
CFHR5	81494	broad.mit.edu	37	1	196964877	196964877	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196964877A>T	uc001gts.3	+	5	766	c.638A>T	c.(637-639)CAA>CTA	p.Q213L		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	213	Sushi 4.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						CCACCTCCTCAACTCTCCAAT	0.333													46	45	---	---	---	---	capture	Missense_Mutation	SNP	196964877	196964877	CFHR5	1	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	3254	144
OBSCN	84033	broad.mit.edu	37	1	228400217	228400217	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228400217C>T	uc009xez.1	+	2	777	c.733C>T	c.(733-735)CGC>TGC	p.R245C	OBSCN_uc001hsn.2_Missense_Mutation_p.R245C|uc001hsm.1_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	245	Ig-like 3.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CACCGGCACGCGCACCTGCAC	0.746													12	35	---	---	---	---	capture	Missense_Mutation	SNP	228400217	228400217	OBSCN	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10717	144
KIAA1804	84451	broad.mit.edu	37	1	233511808	233511808	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:233511808G>C	uc001hvt.3	+	7	2083	c.1822G>C	c.(1822-1824)GAA>CAA	p.E608Q	KIAA1804_uc001hvu.3_Missense_Mutation_p.E54Q	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4	608					activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				AGATTGCAAAGAAAGGTACGT	0.348													14	19	---	---	---	---	capture	Missense_Mutation	SNP	233511808	233511808	KIAA1804	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	8181	144
TARBP1	6894	broad.mit.edu	37	1	234541656	234541656	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:234541656C>T	uc001hwd.2	-	24	3982	c.3982G>A	c.(3982-3984)GGA>AGA	p.G1328R		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	1328					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TACCCTGCTCCGTGCATGCTT	0.532													22	38	---	---	---	---	capture	Missense_Mutation	SNP	234541656	234541656	TARBP1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15443	144
SORCS3	22986	broad.mit.edu	37	10	106960921	106960921	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:106960921G>A	uc001kyi.1	+	16	2398	c.2171G>A	c.(2170-2172)CGT>CAT	p.R724H	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	724	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TTCAAGAAACGTAAGCCAGGA	0.468													37	2	---	---	---	---	capture	Missense_Mutation	SNP	106960921	106960921	SORCS3	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14824	144
OR51G1	79324	broad.mit.edu	37	11	4944755	4944755	+	Missense_Mutation	SNP	C	T	T	rs146006146	by1000genomes	TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4944755C>T	uc010qyr.1	-	1	815	c.815G>A	c.(814-816)CGC>CAC	p.R272H		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	272	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGTACAACGCGGGGCAGATG	0.502													46	63	---	---	---	---	capture	Missense_Mutation	SNP	4944755	4944755	OR51G1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11002	144
LPXN	9404	broad.mit.edu	37	11	58338166	58338166	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58338166C>T	uc001nmw.2	-	2	179	c.34G>A	c.(34-36)GAA>AAA	p.E12K	LPXN_uc009ymp.2_5'UTR|LPXN_uc010rkj.1_Missense_Mutation_p.E17K|LPXN_uc010rkk.1_Nonsense_Mutation_p.W7*	NM_004811	NP_004802	O60711	LPXN_HUMAN	leupaxin isoform 2	12	LD motif 1.				cell adhesion|protein complex assembly|signal transduction	cytoplasm	zinc ion binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				GTGGAGCGTTCCAGTTCCTCC	0.433													23	24	---	---	---	---	capture	Missense_Mutation	SNP	58338166	58338166	LPXN	11	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8845	144
DAGLA	747	broad.mit.edu	37	11	61511463	61511463	+	Silent	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61511463C>T	uc001nsa.2	+	20	2742	c.2631C>T	c.(2629-2631)GAC>GAT	p.D877D		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	877	Cytoplasmic (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		CGGCCAATGACGAGGAGGAAG	0.726													23	36	---	---	---	---	capture	Silent	SNP	61511463	61511463	DAGLA	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4185	144
TRIM49	57093	broad.mit.edu	37	11	89531775	89531775	+	Silent	SNP	T	C	C			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89531775T>C	uc001pdb.2	-	8	1211	c.882A>G	c.(880-882)GAA>GAG	p.E294E		NM_020358	NP_065091	P0CI25	TRI49_HUMAN	ring finger protein 18	294	B30.2/SPRY.					intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TGTTGGCTTCTTCATGATGCA	0.313													13	49	---	---	---	---	capture	Silent	SNP	89531775	89531775	TRIM49	11	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	16407	144
BARX2	8538	broad.mit.edu	37	11	129306839	129306839	+	Silent	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:129306839G>A	uc001qfc.3	+	2	431	c.381G>A	c.(379-381)ACG>ACA	p.T127T		NM_003658	NP_003649	Q9UMQ3	BARX2_HUMAN	BarH-like homeobox 2	127											0	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		AACAGCCCACGCCCCGACAGA	0.637													14	13	---	---	---	---	capture	Silent	SNP	129306839	129306839	BARX2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1305	144
SLC38A4	55089	broad.mit.edu	37	12	47186771	47186771	+	Silent	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:47186771G>A	uc001rpi.2	-	3	483	c.84C>T	c.(82-84)ATC>ATT	p.I28I	SLC38A4_uc001rpj.2_Silent_p.I28I|SLC38A4_uc009zkl.2_Silent_p.I28I	NM_018018	NP_060488	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	28	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Lung SC(27;0.192)|Renal(347;0.236)					TTCCTATCCCGATGTAGCTAT	0.438													100	122	---	---	---	---	capture	Silent	SNP	47186771	47186771	SLC38A4	12	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	14498	144
TRHDE	29953	broad.mit.edu	37	12	73046870	73046870	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:73046870G>A	uc001sxa.2	+	17	2813	c.2783G>A	c.(2782-2784)CGA>CAA	p.R928Q		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	928	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						CATGTAGCTCGAAATCCACAT	0.353													22	38	---	---	---	---	capture	Missense_Mutation	SNP	73046870	73046870	TRHDE	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16362	144
SLC5A8	160728	broad.mit.edu	37	12	101588904	101588904	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101588904G>A	uc001thz.3	-	4	896	c.506C>T	c.(505-507)ACG>ATG	p.T169M		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	169	Helical; (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						GACCACCCCCGTTGCCACTAC	0.398													20	31	---	---	---	---	capture	Missense_Mutation	SNP	101588904	101588904	SLC5A8	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14563	144
TMEM132D	121256	broad.mit.edu	37	12	130185158	130185158	+	Silent	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130185158G>A	uc009zyl.1	-	2	493	c.165C>T	c.(163-165)AAC>AAT	p.N55N		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	55	Extracellular (Potential).					integral to membrane		p.N55T(1)		ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGACGTCCGCGTTGTTGATGT	0.547													21	26	---	---	---	---	capture	Silent	SNP	130185158	130185158	TMEM132D	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15931	144
MTUS2	23281	broad.mit.edu	37	13	29599206	29599206	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:29599206C>T	uc001usl.3	+	1	459	c.401C>T	c.(400-402)ACG>ATG	p.T134M		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	124						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						CTGCAGACCACGCGGAGTATT	0.502													13	86	---	---	---	---	capture	Missense_Mutation	SNP	29599206	29599206	MTUS2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9876	144
KIF26A	26153	broad.mit.edu	37	14	104641823	104641823	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:104641823C>T	uc001yos.3	+	12	2698	c.2698C>T	c.(2698-2700)CGA>TGA	p.R900*		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	900					blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CAGCACCCCTCGAGGCAGTTC	0.692													6	15	---	---	---	---	capture	Nonsense_Mutation	SNP	104641823	104641823	KIF26A	14	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	8216	144
CA12	771	broad.mit.edu	37	15	63618489	63618489	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63618489C>T	uc002amc.2	-	11	1216	c.1060G>A	c.(1060-1062)GCT>ACT	p.A354T	CA12_uc002amd.2_Missense_Mutation_p.A343T|CA12_uc002ame.2_Missense_Mutation_p.A283T	NM_001218	NP_001209	O43570	CAH12_HUMAN	carbonic anhydrase XII isoform 1 precursor	354	Cytoplasmic (Potential).				one-carbon metabolic process	integral to membrane	carbonate dehydratase activity|zinc ion binding			ovary(1)	1					Acetazolamide(DB00819)	GGACCTCAAGCGTGGGCCTCA	0.507													43	49	---	---	---	---	capture	Missense_Mutation	SNP	63618489	63618489	CA12	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2489	144
GOLGA6B	55889	broad.mit.edu	37	15	72954612	72954612	+	Silent	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72954612G>A	uc010uks.1	+	11	908	c.867G>A	c.(865-867)GCG>GCA	p.A289A		NM_018652	NP_061122	A6NDN3	GOG6B_HUMAN	golgi autoantigen, golgin subfamily a, 6B	289	Potential.										0						CATCCCTGGCGCCCCCAGCAG	0.537													4	94	---	---	---	---	capture	Silent	SNP	72954612	72954612	GOLGA6B	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6494	144
C16orf61	56942	broad.mit.edu	37	16	81015432	81015432	+	Silent	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81015432C>T	uc002ffu.2	-	3	331	c.132G>A	c.(130-132)TTG>TTA	p.L44L	C16orf61_uc002ffv.2_Intron	NM_020188	NP_064573	Q9NRP2	CP061_HUMAN	hypothetical protein LOC56942	44											0						GGCATTTTCTCAACTCCCGAT	0.323													27	31	---	---	---	---	capture	Silent	SNP	81015432	81015432	C16orf61	16	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	1810	144
AURKB	9212	broad.mit.edu	37	17	8108652	8108652	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8108652C>T	uc002gkm.2	-	8	804	c.743G>A	c.(742-744)CGC>CAC	p.R248H	AURKB_uc010cnu.2_Missense_Mutation_p.R68H|AURKB_uc002gkn.2_Missense_Mutation_p.R249H|AURKB_uc010vuu.1_Missense_Mutation_p.R207H|AURKB_uc002gko.2_RNA	NM_004217	NP_004208	Q96GD4	AURKB_HUMAN	aurora kinase B	248	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|mitotic prometaphase|protein localization to kinetochore	chromosome passenger complex|condensed nuclear chromosome, centromeric region|cytosol|spindle	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(1)|central_nervous_system(1)	4						ATTGTGCATGCGCCCCTCAAT	0.572													4	95	---	---	---	---	capture	Missense_Mutation	SNP	8108652	8108652	AURKB	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1213	144
KRT20	54474	broad.mit.edu	37	17	39041110	39041110	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39041110C>T	uc002hvl.2	-	1	370	c.328G>A	c.(328-330)GCC>ACC	p.A110T		NM_019010	NP_061883	P35900	K1C20_HUMAN	keratin 20	110	Rod.|Linker 1.				apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton			large_intestine(1)|kidney(1)|skin(1)	3		Breast(137;0.000301)|Ovarian(249;0.15)				GCCCTCGGGGCGTTGGTTTCG	0.498													31	34	---	---	---	---	capture	Missense_Mutation	SNP	39041110	39041110	KRT20	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8378	144
PLEKHH3	79990	broad.mit.edu	37	17	40823101	40823101	+	Silent	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40823101G>A	uc002iau.2	-	9	1799	c.1332C>T	c.(1330-1332)AAC>AAT	p.N444N	PLEKHH3_uc010cyl.1_Intron|PLEKHH3_uc002iat.1_RNA|PLEKHH3_uc002iav.2_RNA|PLEKHH3_uc010cym.1_Intron|PLEKHH3_uc002iaw.2_Silent_p.N444N	NM_024927	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H	444	FERM.				signal transduction	cytoskeleton				large_intestine(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GCGCGAATGCGTTGCGGCTCC	0.657													31	28	---	---	---	---	capture	Silent	SNP	40823101	40823101	PLEKHH3	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11981	144
ST8SIA5	29906	broad.mit.edu	37	18	44260326	44260326	+	Silent	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44260326C>T	uc002lcj.1	-	7	1378	c.810G>A	c.(808-810)TCG>TCA	p.S270S	ST8SIA5_uc002lci.1_Silent_p.S117S|ST8SIA5_uc010xcy.1_Silent_p.S306S|ST8SIA5_uc010xcz.1_Silent_p.S239S	NM_013305	NP_037437	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide	270	Lumenal (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						CAGCTTGCGGCGATTCGAAGT	0.617													15	16	---	---	---	---	capture	Silent	SNP	44260326	44260326	ST8SIA5	18	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15125	144
HOOK2	29911	broad.mit.edu	37	19	12874555	12874555	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12874555G>A	uc002muy.2	-	21	2036	c.1865C>T	c.(1864-1866)GCG>GTG	p.A622V	HOOK2_uc010xmq.1_Missense_Mutation_p.A27V|HOOK2_uc002muz.2_Missense_Mutation_p.A620V	NM_013312	NP_037444	Q96ED9	HOOK2_HUMAN	hook homolog 2 isoform 1	622	Sufficient for interaction with CEP110.|Required for localization to the centrosome and induction of aggresome formation.				early endosome to late endosome transport|endocytosis|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|protein transport	centrosome|FHF complex|microtubule	identical protein binding|microtubule binding			ovary(1)|breast(1)|skin(1)	3						AGGTGCCCCCGCAGCTGGCCG	0.602													19	38	---	---	---	---	capture	Missense_Mutation	SNP	12874555	12874555	HOOK2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7208	144
MAST3	23031	broad.mit.edu	37	19	18255858	18255858	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18255858C>G	uc002nhz.3	+	23	2771	c.2771C>G	c.(2770-2772)TCT>TGT	p.S924C		NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase	924	Ser-rich.						ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						TCCCCGCGCTCTCTGTCCTCG	0.682													21	30	---	---	---	---	capture	Missense_Mutation	SNP	18255858	18255858	MAST3	19	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	9239	144
ZNF569	148266	broad.mit.edu	37	19	37903536	37903536	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37903536G>A	uc002ogi.2	-	6	2582	c.2024C>T	c.(2023-2025)TCG>TTG	p.S675L	ZNF569_uc002ogh.2_Missense_Mutation_p.S516L|ZNF569_uc002ogj.2_Missense_Mutation_p.S699L	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	675	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AACAAGGTGCGACTTTTGGCT	0.413													35	71	---	---	---	---	capture	Missense_Mutation	SNP	37903536	37903536	ZNF569	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17879	144
MED29	55588	broad.mit.edu	37	19	39883120	39883120	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39883120C>T	uc002olf.2	+	2	333	c.296C>T	c.(295-297)GCG>GTG	p.A99V	PAF1_uc002old.2_5'Flank|PAF1_uc002ole.1_5'Flank|PAF1_uc010xuv.1_5'Flank|MED29_uc010xuw.1_Missense_Mutation_p.A99V|MED29_uc010xux.1_Intron	NM_017592	NP_060062	Q9NX70	MED29_HUMAN	mediator complex subunit 29	78	Gln-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	protein binding			ovary(1)|pancreas(1)	2	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			ATGAAGGTTGCGGCCCAAAAC	0.418													5	276	---	---	---	---	capture	Missense_Mutation	SNP	39883120	39883120	MED29	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9360	144
ZNF229	7772	broad.mit.edu	37	19	44932748	44932748	+	Silent	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44932748G>A	uc002oze.1	-	6	2642	c.2208C>T	c.(2206-2208)GGC>GGT	p.G736G	ZNF229_uc010ejk.1_Silent_p.G390G|ZNF229_uc010ejl.1_Silent_p.G730G	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	736					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				ATGGCTTCTCGCCAGTGTGCA	0.488													20	45	---	---	---	---	capture	Silent	SNP	44932748	44932748	ZNF229	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17662	144
HIF3A	64344	broad.mit.edu	37	19	46825102	46825102	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46825102A>C	uc002peh.2	+	10	1243	c.1214A>C	c.(1213-1215)GAC>GCC	p.D405A	HIF3A_uc002peg.3_Missense_Mutation_p.D405A|HIF3A_uc010xxx.1_RNA|HIF3A_uc002pei.3_Missense_Mutation_p.D349A|HIF3A_uc002pej.1_Missense_Mutation_p.D336A|HIF3A_uc002pek.2_Missense_Mutation_p.D349A|HIF3A_uc010xxy.1_Missense_Mutation_p.D336A|HIF3A_uc002pel.2_Missense_Mutation_p.D403A|HIF3A_uc010xxz.1_Missense_Mutation_p.D354A	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	405					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		CTGGCCGCTGACCCCCGCCGT	0.692													6	52	---	---	---	---	capture	Missense_Mutation	SNP	46825102	46825102	HIF3A	19	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	7030	144
GRIN2D	2906	broad.mit.edu	37	19	48919313	48919313	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48919313C>T	uc002pjc.3	+	7	1724	c.1636C>T	c.(1636-1638)CGC>TGC	p.R546C		NM_000836	NP_000827	O15399	NMDE4_HUMAN	N-methyl-D-aspartate receptor subunit 2D	546	Extracellular (Potential).					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)	CAACGAGGAGCGCTCCGAGAT	0.672													49	61	---	---	---	---	capture	Missense_Mutation	SNP	48919313	48919313	GRIN2D	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6715	144
ZNF320	162967	broad.mit.edu	37	19	53384360	53384360	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53384360C>T	uc002qag.2	-	4	1210	c.1019G>A	c.(1018-1020)CGC>CAC	p.R340H	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.R286H|ZNF320_uc002qai.2_Missense_Mutation_p.R340H	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	340	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		ATGTGATTTGCGACTGAAAAC	0.428													4	113	---	---	---	---	capture	Missense_Mutation	SNP	53384360	53384360	ZNF320	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17719	144
ZNF677	342926	broad.mit.edu	37	19	53741592	53741592	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53741592G>T	uc002qbf.1	-	5	573	c.388C>A	c.(388-390)CAC>AAC	p.H130N	ZNF677_uc002qbg.1_Missense_Mutation_p.H130N	NM_182609	NP_872415	Q86XU0	ZN677_HUMAN	zinc finger protein 677	130					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00352)		TCTTTTCTGTGAGTGAGATTT	0.353													21	86	---	---	---	---	capture	Missense_Mutation	SNP	53741592	53741592	ZNF677	19	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	17962	144
ABCB11	8647	broad.mit.edu	37	2	169783711	169783711	+	Silent	SNP	A	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:169783711A>T	uc002ueo.1	-	26	3699	c.3573T>A	c.(3571-3573)GCT>GCA	p.A1191A	ABCB11_uc010zda.1_Silent_p.A609A|ABCB11_uc010zdb.1_Silent_p.A667A	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	1191	Cytoplasmic (Potential).|ABC transporter 2.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	CCTGTTTTGCAGCTGCTATGA	0.453													39	170	---	---	---	---	capture	Silent	SNP	169783711	169783711	ABCB11	2	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	42	144
MFSD6	54842	broad.mit.edu	37	2	191301881	191301881	+	Missense_Mutation	SNP	G	T	T	rs147647208		TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:191301881G>T	uc002urz.2	+	3	1450	c.1126G>T	c.(1126-1128)GGC>TGC	p.G376C		NM_017694	NP_060164	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing	376	Helical; (Potential).				transmembrane transport	integral to membrane				ovary(2)	2						CATCGTCTTCGGCGTTCTCAT	0.517													22	26	---	---	---	---	capture	Missense_Mutation	SNP	191301881	191301881	MFSD6	2	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	9447	144
DNPEP	23549	broad.mit.edu	37	2	220246112	220246112	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220246112G>A	uc010zlg.1	-	13	1290	c.1208C>T	c.(1207-1209)GCG>GTG	p.A403V	DNPEP_uc010zlf.1_RNA|DNPEP_uc002vle.2_Missense_Mutation_p.A395V|DNPEP_uc002vlf.1_Missense_Mutation_p.A381V|DNPEP_uc002vlh.2_Missense_Mutation_p.A342V|DNPEP_uc002vli.1_Missense_Mutation_p.A342V	NM_012100	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	385					peptide metabolic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	L-Glutamic Acid(DB00142)	CTCTGACACCGCGTTTGAAGC	0.597													109	140	---	---	---	---	capture	Missense_Mutation	SNP	220246112	220246112	DNPEP	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4635	144
AGXT	189	broad.mit.edu	37	2	241808652	241808652	+	Silent	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241808652C>T	uc002waa.3	+	2	352	c.231C>T	c.(229-231)GTC>GTT	p.V77V	AGXT_uc010zoi.1_Silent_p.V77V	NM_000030	NP_000021	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	77					glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity				0		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	TCACACTGGTCATCTCTGGCT	0.607													34	54	---	---	---	---	capture	Silent	SNP	241808652	241808652	AGXT	2	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	404	144
TRPM2	7226	broad.mit.edu	37	21	45821664	45821664	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45821664G>A	uc002zet.1	+	17	2635	c.2422G>A	c.(2422-2424)GCC>ACC	p.A808T	TRPM2_uc002zeu.1_Missense_Mutation_p.A808T|TRPM2_uc002zew.1_Missense_Mutation_p.A808T|TRPM2_uc010gpt.1_Missense_Mutation_p.A808T|TRPM2_uc002zex.1_Missense_Mutation_p.A594T|TRPM2_uc002zey.1_Missense_Mutation_p.A321T	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	808	Helical; (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CTCCTACTTCGCCTTCCTCTG	0.632													107	126	---	---	---	---	capture	Missense_Mutation	SNP	45821664	45821664	TRPM2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16469	144
CABIN1	23523	broad.mit.edu	37	22	24483514	24483514	+	Missense_Mutation	SNP	G	A	A	rs148592192		TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24483514G>A	uc002zzi.1	+	23	3500	c.3373G>A	c.(3373-3375)GTC>ATC	p.V1125I	CABIN1_uc002zzj.1_Missense_Mutation_p.V1075I|CABIN1_uc002zzl.1_Missense_Mutation_p.V1125I	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1125	TPR 6.				cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						TGCCACGCCCGTCTTGAACTG	0.577													32	37	---	---	---	---	capture	Missense_Mutation	SNP	24483514	24483514	CABIN1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2504	144
SLC9A10	285335	broad.mit.edu	37	3	111918295	111918295	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111918295G>A	uc003dyu.2	-	20	2618	c.2396C>T	c.(2395-2397)CCA>CTA	p.P799L	SLC9A10_uc011bhu.1_Missense_Mutation_p.P62L|SLC9A10_uc010hqc.2_Missense_Mutation_p.P751L	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	799					cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						AGCAATTTCTGGGTGATCATA	0.279													25	29	---	---	---	---	capture	Missense_Mutation	SNP	111918295	111918295	SLC9A10	3	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	14602	144
LRRC31	79782	broad.mit.edu	37	3	169557943	169557943	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169557943G>A	uc003fgc.1	-	9	1563	c.1486C>T	c.(1486-1488)CGA>TGA	p.R496*	LRRC31_uc010hwp.1_Nonsense_Mutation_p.R440*	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	496										ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			CCACAATCTCGAAAATTTGAT	0.453													34	47	---	---	---	---	capture	Nonsense_Mutation	SNP	169557943	169557943	LRRC31	3	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	8902	144
CPN2	1370	broad.mit.edu	37	3	194061799	194061799	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194061799G>A	uc003fts.2	-	2	1723	c.1633C>T	c.(1633-1635)CCC>TCC	p.P545S		NM_001080513	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	545					protein stabilization	extracellular region	enzyme regulator activity			ovary(5)	5	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		TGCTACTAGGGCCCTGCTGCC	0.652													10	8	---	---	---	---	capture	Missense_Mutation	SNP	194061799	194061799	CPN2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3775	144
ZNF732	654254	broad.mit.edu	37	4	265913	265913	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:265913T>G	uc011buu.1	-	3	744	c.730A>C	c.(730-732)ACT>CCT	p.T244P	ZNF732_uc010ibb.1_Intron	NM_001137608	NP_001131080	B4DXR9	ZN732_HUMAN	zinc finger protein 732	245					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCTCTCCAGTATGAACTTTA	0.363													10	16	---	---	---	---	capture	Missense_Mutation	SNP	265913	265913	ZNF732	4	T	G	G	G	1	0	0	0	0	1	0	0	0	741	57	4	4	18000	144
ZNF732	654254	broad.mit.edu	37	4	265995	265995	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:265995A>T	uc011buu.1	-	3	662	c.648T>A	c.(646-648)CAT>CAA	p.H216Q	ZNF732_uc010ibb.1_Intron	NM_001137608	NP_001131080	B4DXR9	ZN732_HUMAN	zinc finger protein 732	217	C2H2-type 3; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCTCTCCAGTATGAATTATCT	0.348													15	13	---	---	---	---	capture	Missense_Mutation	SNP	265995	265995	ZNF732	4	A	T	T	T	1	0	0	0	0	1	0	0	0	206	16	4	4	18000	144
UGT2B4	7363	broad.mit.edu	37	4	70351001	70351001	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70351001G>A	uc003hek.3	-	5	1282	c.1235C>T	c.(1234-1236)GCT>GTT	p.A412V	UGT2B4_uc011cap.1_Missense_Mutation_p.A276V|UGT2B4_uc003hel.3_Intron	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	412					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						CAAACTAACAGCTGCTCCCTT	0.423													74	85	---	---	---	---	capture	Missense_Mutation	SNP	70351001	70351001	UGT2B4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	16843	144
SULT1B1	27284	broad.mit.edu	37	4	70620981	70620981	+	Splice_Site	SNP	T	C	C			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70620981T>C	uc003hen.2	-	2	255	c.-43_splice	c.e2-1			NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member						3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						ACAGTTGTTCTGGAGAAATAT	0.328													21	14	---	---	---	---	capture	Splice_Site	SNP	70620981	70620981	SULT1B1	4	T	C	C	C	1	0	0	0	0	0	0	1	0	715	55	5	3	15264	144
C4orf32	132720	broad.mit.edu	37	4	113107978	113107978	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113107978C>T	uc003iah.2	+	2	467	c.283C>T	c.(283-285)CGA>TGA	p.R95*	C4orf32_uc003iai.2_RNA	NM_152400	NP_689613	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32	95						integral to membrane					0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)		TTTTGGAGAACGAATAGTGGA	0.413													87	99	---	---	---	---	capture	Nonsense_Mutation	SNP	113107978	113107978	C4orf32	4	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	2240	144
CEP72	55722	broad.mit.edu	37	5	637858	637858	+	Silent	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:637858C>T	uc003jbf.2	+	7	1203	c.1131C>T	c.(1129-1131)AAC>AAT	p.N377N	CEP72_uc011clz.1_RNA	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa	377					G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			AAAGCAGGAACGGGAGGACCT	0.622													12	14	---	---	---	---	capture	Silent	SNP	637858	637858	CEP72	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3228	144
CDH18	1016	broad.mit.edu	37	5	19721516	19721516	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19721516C>T	uc003jgc.2	-	4	960	c.583G>A	c.(583-585)GCT>ACT	p.A195T	CDH18_uc003jgd.2_Missense_Mutation_p.A195T|CDH18_uc011cnm.1_Missense_Mutation_p.A195T	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	195	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.A195T(1)		ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ACCACCCGAGCGCTGTTTCCA	0.463													43	61	---	---	---	---	capture	Missense_Mutation	SNP	19721516	19721516	CDH18	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3074	144
PCDHB16	57717	broad.mit.edu	37	5	140564331	140564331	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140564331C>T	uc003liv.2	+	1	3352	c.2197C>T	c.(2197-2199)CCA>TCA	p.P733S	PCDHB9_uc003liw.1_5'Flank	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	733	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGCCCCTTTCCAGGGCGTCT	0.627													84	100	---	---	---	---	capture	Missense_Mutation	SNP	140564331	140564331	PCDHB16	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	11444	144
BAT1	7919	broad.mit.edu	37	6	31504459	31504459	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31504459A>C	uc003ntt.2	-	5	1065	c.434T>G	c.(433-435)GTT>GGT	p.V145G	BAT1_uc003ntr.2_5'Flank|BAT1_uc003nts.2_Missense_Mutation_p.V145G|BAT1_uc011dnn.1_Missense_Mutation_p.V67G|BAT1_uc003ntu.2_Missense_Mutation_p.V145G|BAT1_uc003ntv.2_Missense_Mutation_p.V145G|BAT1_uc003ntw.2_Missense_Mutation_p.V145G|BAT1_uc003ntx.2_Missense_Mutation_p.V145G|BAT1_uc011dno.1_Missense_Mutation_p.V98G|BAT1_uc011dnp.1_Missense_Mutation_p.V67G|SNORD117_uc003nty.1_5'Flank|BAT1_uc011dnq.1_RNA	NM_004640	NP_004631	Q13838	DX39B_HUMAN	HLA-B associated transcript 1	145	Helicase ATP-binding.				intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding				0						AAAAACAGCAACCTGCCGAGC	0.498													8	40	---	---	---	---	capture	Missense_Mutation	SNP	31504459	31504459	BAT1	6	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	1307	144
GABRR2	2570	broad.mit.edu	37	6	89975454	89975454	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:89975454G>A	uc003pnb.2	-	7	850	c.842C>T	c.(841-843)ACG>ATG	p.T281M	GABRR2_uc011dzx.1_Missense_Mutation_p.T157M	NM_002043	NP_002034	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 2	281	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity				0		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)		GCGACGCAACGTGAAGTTAAT	0.517													31	37	---	---	---	---	capture	Missense_Mutation	SNP	89975454	89975454	GABRR2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6119	144
ZBTB2	57621	broad.mit.edu	37	6	151687420	151687420	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151687420G>A	uc003qoh.2	-	3	916	c.781C>T	c.(781-783)CGG>TGG	p.R261W		NM_020861	NP_065912	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	261	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		GTGAAGCGCCGTCCACACAGG	0.557													52	55	---	---	---	---	capture	Missense_Mutation	SNP	151687420	151687420	ZBTB2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	17408	144
EGFR	1956	broad.mit.edu	37	7	55220295	55220295	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55220295A>T	uc003tqk.2	+	6	931	c.685A>T	c.(685-687)AGT>TGT	p.S229C	EGFR_uc003tqh.2_Missense_Mutation_p.S229C|EGFR_uc003tqi.2_Missense_Mutation_p.S229C|EGFR_uc003tqj.2_Missense_Mutation_p.S229C|EGFR_uc010kzg.1_Missense_Mutation_p.S184C|EGFR_uc011kco.1_Missense_Mutation_p.S176C|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	229	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAAGTCCCCCAGTGACTGCTG	0.617		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			717	201	---	---	---	---	capture	Missense_Mutation	SNP	55220295	55220295	EGFR	7	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	4922	144
MUC17	140453	broad.mit.edu	37	7	100677499	100677499	+	Silent	SNP	G	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100677499G>A	uc003uxp.1	+	3	2855	c.2802G>A	c.(2800-2802)ACG>ACA	p.T934T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	934	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|13.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACAGCACCACGCCGGTAGTCA	0.512													9	689	---	---	---	---	capture	Silent	SNP	100677499	100677499	MUC17	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9884	144
OR2F1	26211	broad.mit.edu	37	7	143657328	143657328	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143657328C>A	uc003wds.1	+	1	309	c.265C>A	c.(265-267)CAT>AAT	p.H89N		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	89	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)					TCTTGCAGAACATAAAGCCAT	0.512													75	245	---	---	---	---	capture	Missense_Mutation	SNP	143657328	143657328	OR2F1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	10900	144
EZH2	2146	broad.mit.edu	37	7	148512600	148512600	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148512600T>C	uc003wfd.1	-	13	1695	c.1529A>G	c.(1528-1530)AAG>AGG	p.K510R	EZH2_uc011kug.1_Missense_Mutation_p.K501R|EZH2_uc003wfb.1_Missense_Mutation_p.K515R|EZH2_uc003wfc.1_Missense_Mutation_p.K471R|EZH2_uc011kuh.1_Missense_Mutation_p.K501R	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	510					negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			ATGCTAACCCTTTTTCAGCTG	0.368			Mis		DLBCL								3	203	---	---	---	---	capture	Missense_Mutation	SNP	148512600	148512600	EZH2	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	5288	144
FAM75A6	389730	broad.mit.edu	37	9	43630642	43630642	+	Silent	SNP	G	A	A	rs2808959		TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:43630642G>A	uc011lrb.1	-	1	89	c.60C>T	c.(58-60)AGC>AGT	p.S20S		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	20						integral to membrane					0						ATGGTGTGGAGCTGGGGGCGT	0.473													3	4	---	---	---	---	capture	Silent	SNP	43630642	43630642	FAM75A6	9	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	5568	144
COL5A1	1289	broad.mit.edu	37	9	137676834	137676834	+	Splice_Site	SNP	G	T	T			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137676834G>T	uc004cfe.2	+	30	2867	c.2485_splice	c.e30-1	p.G829_splice		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CTGGCTTGCAGGGGGAGATCG	0.632													26	2	---	---	---	---	capture	Splice_Site	SNP	137676834	137676834	COL5A1	9	G	T	T	T	1	0	0	0	0	0	0	1	0	455	35	5	4	3661	144
MAGEC1	9947	broad.mit.edu	37	X	140994696	140994696	+	Silent	SNP	T	A	A			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140994696T>A	uc004fbt.2	+	4	1792	c.1506T>A	c.(1504-1506)ACT>ACA	p.T502T	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	502							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CTGAGTGTACTCAAAGTACTT	0.498										HNSCC(15;0.026)			123	15	---	---	---	---	capture	Silent	SNP	140994696	140994696	MAGEC1	23	T	A	A	A	1	0	0	0	0	0	0	0	1	691	54	4	4	9094	144
TCHH	7062	broad.mit.edu	37	1	152084715	152084735	+	In_Frame_Del	DEL	CTCCTGCTGCTCGCGCCTCTC	-	-			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152084715_152084735delCTCCTGCTGCTCGCGCCTCTC	uc001ezp.2	-	2	958_978	c.958_978delGAGAGGCGCGAGCAGCAGGAG	c.(958-978)GAGAGGCGCGAGCAGCAGGAGdel	p.ERREQQE320del	TCHH_uc009wne.1_In_Frame_Del_p.ERREQQE320del	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	320_326	5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.|1-1; approximate.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			gctcgcgcctctcctgctgctcgcgcctctcctcctgctgc	0.072													7	32	---	---	---	---	capture_indel	In_Frame_Del	DEL	152084715	152084735	TCHH	1	CTCCTGCTGCTCGCGCCTCTC	-	-	-	1	0	1	0	1	0	0	0	0	415	32	5	5	15585	144
CUBN	8029	broad.mit.edu	37	10	16994307	16994307	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:16994307delT	uc001ioo.2	-	33	4989	c.4937delA	c.(4936-4938)AACfs	p.N1646fs		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1646	CUB 11.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCAGCTGCAGTTCTGATTGTT	0.478													68	8	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	16994307	16994307	CUBN	10	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	4011	144
PTEN	5728	broad.mit.edu	37	10	89711928	89711928	+	Frame_Shift_Del	DEL	A	-	-			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711928delA	uc001kfb.2	+	7	1577	c.546delA	c.(544-546)TTAfs	p.L182fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	182	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.V166fs*17(3)|p.?(3)|p.G165fs*9(3)|p.L182fs*16(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G165_K342del(1)|p.G165_*404del(1)|p.K183fs*7(1)|p.L182F(1)|p.V175fs*3(1)|p.L182*(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GCTACCTGTTAAAGAATCATC	0.388		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			71	5	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89711928	89711928	PTEN	10	A	-	-	-	1	0	1	0	1	0	0	0	0	167	13	5	5	12633	144
NOX4	50507	broad.mit.edu	37	11	89106662	89106663	+	Splice_Site	INS	-	A	A	rs56022003		TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89106662_89106663insA	uc001pct.2	-	12	1314	c.1075_splice	c.e12-1	p.C359_splice	NOX4_uc009yvr.2_Splice_Site_p.C334_splice|NOX4_uc001pcu.2_Splice_Site_p.C285_splice|NOX4_uc001pcw.2_Splice_Site_p.C52_splice|NOX4_uc001pcx.2_Splice_Site_p.C52_splice|NOX4_uc001pcv.2_Splice_Site_p.C359_splice|NOX4_uc009yvo.2_Splice_Site|NOX4_uc010rtu.1_Splice_Site_p.C193_splice|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Splice_Site_p.C335_splice|NOX4_uc009yvq.2_Splice_Site_p.C335_splice	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AGTTGGACACTAAAAAAAAATA	0.292													7	154	---	---	---	---	capture_indel	Splice_Site	INS	89106662	89106663	NOX4	11	-	A	A	A	1	0	1	1	0	0	0	1	0	689	53	5	5	10465	144
CNTN6	27255	broad.mit.edu	37	3	1415706	1415706	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:1415706delG	uc003boz.2	+	16	2311	c.2044delG	c.(2044-2046)GGGfs	p.G682fs	CNTN6_uc011asj.1_Frame_Shift_Del_p.G610fs|CNTN6_uc003bpa.2_Frame_Shift_Del_p.G682fs	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	682	Fibronectin type-III 1.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CAACAGCATTGGGATTGGAGA	0.393													30	35	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	1415706	1415706	CNTN6	3	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	3610	144
HIST1H1C	3006	broad.mit.edu	37	6	26056384	26056385	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26056384_26056385insC	uc003nfw.2	-	1	315_316	c.272_273insG	c.(271-273)GGCfs	p.G91fs		NM_005319	NP_005310	P16403	H12_HUMAN	histone cluster 1, H1c	91	H15.				nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)|skin(2)	5						GCACCAGAGTGCCCTTGCTCAC	0.545													90	135	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	26056384	26056385	HIST1H1C	6	-	C	C	C	1	0	1	1	0	0	0	0	0	587	46	5	5	7049	144
NCOA2	10499	broad.mit.edu	37	8	71068332	71068338	+	Frame_Shift_Del	DEL	ATCTTTA	-	-			TCGA-14-1395-01	TCGA-14-1395-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:71068332_71068338delATCTTTA	uc003xyn.1	-	11	2424_2430	c.2262_2268delTAAAGAT	c.(2260-2268)ACTAAAGATfs	p.T754fs		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	754_756					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GTAAACCAATATCTTTAGTATCATCTT	0.411			T	RUNXBP2	AML								33	82	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	71068332	71068338	NCOA2	8	ATCTTTA	-	-	-	1	0	1	0	1	0	0	0	0	206	16	5	5	10136	144
