Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CATSPER4	378807	broad.mit.edu	37	1	26524560	26524560	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26524560T>G	uc010oez.1	+	5	670	c.670T>G	c.(670-672)TTC>GTC	p.F224V	CATSPER4_uc010oey.1_Missense_Mutation_p.F46V|CATSPER4_uc009vsf.2_RNA	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	224	Helical; Name=Segment S5; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		CATCCTCTTCTTCATGCTGGT	0.597													33	377	---	---	---	---	capture	Missense_Mutation	SNP	26524560	26524560	CATSPER4	1	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	2666	146
SDCCAG8	10806	broad.mit.edu	37	1	243507526	243507526	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:243507526G>C	uc001hzw.2	+	12	1522	c.1366G>C	c.(1366-1368)GAA>CAA	p.E456Q	SDCCAG8_uc010pyk.1_Missense_Mutation_p.E311Q|SDCCAG8_uc010pyl.1_Missense_Mutation_p.E268Q|SDCCAG8_uc001hzx.2_Missense_Mutation_p.E268Q	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	456	Potential.|Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GGTGTGTGGAGAAATGCGCTA	0.423													17	37	---	---	---	---	capture	Missense_Mutation	SNP	243507526	243507526	SDCCAG8	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	13852	146
SDCCAG8	10806	broad.mit.edu	37	1	243507574	243507574	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:243507574G>A	uc001hzw.2	+	12	1570	c.1414G>A	c.(1414-1416)GAA>AAA	p.E472K	SDCCAG8_uc010pyk.1_Missense_Mutation_p.E327K|SDCCAG8_uc010pyl.1_Missense_Mutation_p.E284K|SDCCAG8_uc001hzx.2_Missense_Mutation_p.E284K	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	472	Potential.|Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GGATGAGGCAGAAAAGGAGCA	0.393													24	33	---	---	---	---	capture	Missense_Mutation	SNP	243507574	243507574	SDCCAG8	1	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	13852	146
OGDHL	55753	broad.mit.edu	37	10	50959004	50959004	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50959004C>A	uc001jie.2	-	7	919	c.777G>T	c.(775-777)TGG>TGT	p.W259C	OGDHL_uc009xog.2_Missense_Mutation_p.W286C|OGDHL_uc010qgt.1_Missense_Mutation_p.W202C|OGDHL_uc010qgu.1_Missense_Mutation_p.W50C|OGDHL_uc009xoh.2_Missense_Mutation_p.W50C	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	259					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						TCTCTGAGGACCATTTCCGGG	0.418													6	52	---	---	---	---	capture	Missense_Mutation	SNP	50959004	50959004	OGDHL	10	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	10745	146
CYSLTR2	57105	broad.mit.edu	37	13	49280992	49280992	+	Silent	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49280992C>T	uc010acx.1	+	6	722	c.39C>T	c.(37-39)TCC>TCT	p.S13S	CYSLTR2_uc010acy.1_Silent_p.S13S|CYSLTR2_uc010acz.1_Silent_p.S13S|CYSLTR2_uc010ada.1_Silent_p.S13S|CYSLTR2_uc010adb.1_Silent_p.S13S|CYSLTR2_uc010adc.1_Silent_p.S13S|CYSLTR2_uc010add.1_Silent_p.S13S|CYSLTR2_uc010acw.1_Silent_p.S13S|CYSLTR2_uc001vck.2_Silent_p.S13S	NM_020377	NP_065110	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	13	Extracellular (Potential).				immune response	integral to membrane|plasma membrane				lung(2)	2		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	CATCCATCTCCGTATCAGAAA	0.373													7	188	---	---	---	---	capture	Silent	SNP	49280992	49280992	CYSLTR2	13	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4161	146
SLC27A2	11001	broad.mit.edu	37	15	50515253	50515253	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50515253A>G	uc001zxw.2	+	5	1296	c.1064A>G	c.(1063-1065)GAC>GGC	p.D355G	SLC27A2_uc010bes.2_Missense_Mutation_p.D302G|SLC27A2_uc001zxx.2_Missense_Mutation_p.D120G	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	355	Cytoplasmic (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		AGATTTGGGGACATATGCATC	0.428													63	102	---	---	---	---	capture	Missense_Mutation	SNP	50515253	50515253	SLC27A2	15	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	14418	146
SEC11A	23478	broad.mit.edu	37	15	85234816	85234816	+	Silent	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85234816C>T	uc002blb.1	-	2	479	c.111G>A	c.(109-111)AAG>AAA	p.K37K	SEC11A_uc002blc.1_Silent_p.K11K	NM_014300	NP_055115	P67812	SC11A_HUMAN	SEC11-like 1	37	Lumenal (Potential).				energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	endoplasmic reticulum membrane|integral to membrane|microsome	protein binding|serine-type peptidase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(143;0.199)			CCATTAACCCCTTCCAGATCA	0.408													20	69	---	---	---	---	capture	Silent	SNP	85234816	85234816	SEC11A	15	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	13871	146
C16orf54	283897	broad.mit.edu	37	16	29755735	29755735	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29755735C>T	uc002dtp.2	-	2	647	c.538G>A	c.(538-540)GTC>ATC	p.V180I	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|uc002dtq.1_5'Flank	NM_175900	NP_787096	Q6UWD8	CP054_HUMAN	hypothetical protein LOC283897	180						integral to membrane					0						CCAAACTGGACGCTGGCCTCT	0.711													6	5	---	---	---	---	capture	Missense_Mutation	SNP	29755735	29755735	C16orf54	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1805	146
PKD1L2	114780	broad.mit.edu	37	16	81211460	81211460	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81211460C>T	uc002fgh.1	-	14	2389	c.2389G>A	c.(2389-2391)GCC>ACC	p.A797T	PKD1L2_uc002fgg.1_RNA|PKD1L2_uc002fgi.2_Missense_Mutation_p.A112T|PKD1L2_uc002fgj.2_Missense_Mutation_p.A797T|PKD1L2_uc002fgk.1_5'UTR|PKD1L2_uc002fgl.1_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	797	REJ.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GCTGTGGAGGCGTTGCAGAAG	0.592													19	184	---	---	---	---	capture	Missense_Mutation	SNP	81211460	81211460	PKD1L2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11868	146
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	C	C	rs121912666		TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578190T>C	uc002gim.2	-	6	853	c.659A>G	c.(658-660)TAT>TGT	p.Y220C	TP53_uc002gig.1_Missense_Mutation_p.Y220C|TP53_uc002gih.2_Missense_Mutation_p.Y220C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y88C|TP53_uc010cng.1_Missense_Mutation_p.Y88C|TP53_uc002gii.1_Missense_Mutation_p.Y88C|TP53_uc010cnh.1_Missense_Mutation_p.Y220C|TP53_uc010cni.1_Missense_Mutation_p.Y220C|TP53_uc002gij.2_Missense_Mutation_p.Y220C|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y127C|TP53_uc002gio.2_Missense_Mutation_p.Y88C|TP53_uc010vug.1_Missense_Mutation_p.Y181C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	220	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> N (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y220C(205)|p.Y220N(12)|p.Y220H(9)|p.Y220S(9)|p.0?(7)|p.Y220fs*27(4)|p.Y220*(3)|p.Y220D(2)|p.Y127C(2)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.?(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*1(1)|p.Y220fs*2(1)|p.V218fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGCGGCTCATAGGGCACCAC	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			38	12	---	---	---	---	capture	Missense_Mutation	SNP	7578190	7578190	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	16264	146
KRTAP4-11	653240	broad.mit.edu	37	17	39274319	39274319	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274319G>C	uc002hvz.2	-	1	288	c.249C>G	c.(247-249)AGC>AGG	p.S83R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	83	12.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCTTGCAGCAGCTGGACACAC	0.483													4	29	---	---	---	---	capture	Missense_Mutation	SNP	39274319	39274319	KRTAP4-11	17	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	8469	146
KCTD2	23510	broad.mit.edu	37	17	73043590	73043590	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73043590A>G	uc002jmp.2	+	1	312	c.245A>G	c.(244-246)TAC>TGC	p.Y82C	KCTD2_uc010dfy.1_Intron|KCTD2_uc010dfz.2_Intron|ATP5H_uc002jmn.1_5'Flank|ATP5H_uc002jmo.1_5'Flank|KCTD2_uc002jmq.2_RNA	NM_015353	NP_056168	Q14681	KCTD2_HUMAN	potassium channel tetramerisation domain	82	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity				0	all_lung(278;0.226)					GGAGGCACCTACTTCGTGACC	0.388													16	25	---	---	---	---	capture	Missense_Mutation	SNP	73043590	73043590	KCTD2	17	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	8029	146
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma 								37	94	---	---	---	---	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	146
ALPPL2	251	broad.mit.edu	37	2	233274433	233274433	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233274433G>A	uc002vss.3	+	11	1503	c.1450G>A	c.(1450-1452)GCC>ACC	p.A484T		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	484					phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			skin(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)|Levamisole(DB00848)	CATGGCCTTCGCCGCCTGCCT	0.751													3	29	---	---	---	---	capture	Missense_Mutation	SNP	233274433	233274433	ALPPL2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	549	146
SPP2	6694	broad.mit.edu	37	2	234967503	234967503	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234967503C>G	uc002vvk.1	+	3	319	c.234C>G	c.(232-234)AAC>AAG	p.N78K	SPP2_uc010fyl.1_5'UTR	NM_006944	NP_008875	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa precursor	78					bone remodeling|skeletal system development	extracellular region	endopeptidase inhibitor activity				0		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		ATGAGAACAACTTGGTCATGA	0.423													66	119	---	---	---	---	capture	Missense_Mutation	SNP	234967503	234967503	SPP2	2	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	14979	146
PER2	8864	broad.mit.edu	37	2	239157759	239157759	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:239157759G>A	uc002vyc.2	-	22	3799	c.3562C>T	c.(3562-3564)CGC>TGC	p.R1188C	PER2_uc010znv.1_Missense_Mutation_p.R1188C	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2	1188	CRY binding domain (By similarity).				circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TGGACCTCGCGCAGCTCCTGC	0.567													144	193	---	---	---	---	capture	Missense_Mutation	SNP	239157759	239157759	PER2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11633	146
CHD6	84181	broad.mit.edu	37	20	40049780	40049780	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:40049780C>T	uc002xka.1	-	31	5673	c.5495G>A	c.(5494-5496)TGT>TAT	p.C1832Y		NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1832					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				TTTGGAGTCACAGACACTAAG	0.383													138	260	---	---	---	---	capture	Missense_Mutation	SNP	40049780	40049780	CHD6	20	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	3295	146
PREX1	57580	broad.mit.edu	37	20	47267957	47267957	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47267957C>T	uc002xtw.1	-	22	2655	c.2632G>A	c.(2632-2634)GGC>AGC	p.G878S	PREX1_uc002xtv.1_Missense_Mutation_p.G175S	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	878					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CCGAAGCAGCCGCGGGGCTCC	0.607													20	32	---	---	---	---	capture	Missense_Mutation	SNP	47267957	47267957	PREX1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12372	146
PIK3R1	5295	broad.mit.edu	37	5	67589147	67589147	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589147A>G	uc003jva.2	+	10	1695	c.1135A>G	c.(1135-1137)AAA>GAA	p.K379E	PIK3R1_uc003jvb.2_Missense_Mutation_p.K379E|PIK3R1_uc003jvc.2_Missense_Mutation_p.K79E|PIK3R1_uc003jvd.2_Missense_Mutation_p.K109E|PIK3R1_uc003jve.2_Missense_Mutation_p.K58E|PIK3R1_uc011crb.1_Missense_Mutation_p.K49E	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	379	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	GGGAAATAACAAATTAATCAA	0.308			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			17	62	---	---	---	---	capture	Missense_Mutation	SNP	67589147	67589147	PIK3R1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	11821	146
ARSK	153642	broad.mit.edu	37	5	94936730	94936730	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94936730T>C	uc003kld.2	+	7	1434	c.1276T>C	c.(1276-1278)TAT>CAT	p.Y426H	ARSK_uc010jbg.2_Missense_Mutation_p.Y267H|ARSK_uc011cum.1_RNA	NM_198150	NP_937793	Q6UWY0	ARSK_HUMAN	arylsulfatase K precursor	426						extracellular region	arylsulfatase activity|metal ion binding			pancreas(1)	1		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		CCACTGGAAATATATAGCCTA	0.343													100	140	---	---	---	---	capture	Missense_Mutation	SNP	94936730	94936730	ARSK	5	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	989	146
MSH5	4439	broad.mit.edu	37	6	31729252	31729252	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31729252G>A	uc003nwv.1	+	22	2120	c.2041G>A	c.(2041-2043)GAT>AAT	p.D681N	MSH5_uc003nwt.1_Missense_Mutation_p.D698N|MSH5_uc003nwu.1_Missense_Mutation_p.D682N|MSH5_uc003nww.1_Missense_Mutation_p.D681N|MSH5_uc003nwx.1_Missense_Mutation_p.D699N|MSH5_uc011dof.1_Missense_Mutation_p.D380N|MSH5_uc003nwy.1_Missense_Mutation_p.D355N|MSH5_uc003nwz.3_RNA|C6orf26_uc003nxa.3_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c	681					chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3						TTTGCAGGTGGATGGGCTCGC	0.577								Direct_reversal_of_damage|MMR					15	174	---	---	---	---	capture	Missense_Mutation	SNP	31729252	31729252	MSH5	6	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	9783	146
CD2AP	23607	broad.mit.edu	37	6	47547178	47547178	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47547178C>T	uc003oyw.2	+	9	1417	c.961C>T	c.(961-963)CCA>TCA	p.P321S		NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	321	SH3 3.				cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			AGGAGTATTTCCAGACAATTT	0.343													39	68	---	---	---	---	capture	Missense_Mutation	SNP	47547178	47547178	CD2AP	6	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2965	146
EPHA7	2045	broad.mit.edu	37	6	94120318	94120318	+	Missense_Mutation	SNP	C	T	T	rs41273629	byFrequency	TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:94120318C>T	uc003poe.2	-	3	974	c.733G>A	c.(733-735)GCC>ACC	p.A245T	EPHA7_uc003pof.2_Missense_Mutation_p.A245T|EPHA7_uc011eac.1_Missense_Mutation_p.A245T|EPHA7_uc003pog.3_Missense_Mutation_p.A245T	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor	245	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		ATCCTGGGGGCGTTTTCCGCT	0.483													78	99	---	---	---	---	capture	Missense_Mutation	SNP	94120318	94120318	EPHA7	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5127	146
CCDC129	223075	broad.mit.edu	37	7	31614260	31614260	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31614260T>A	uc003tcj.1	+	7	1495	c.502T>A	c.(502-504)TTC>ATC	p.F168I	CCDC129_uc011kad.1_Missense_Mutation_p.F178I|CCDC129_uc003tci.1_Missense_Mutation_p.F167I|CCDC129_uc011kae.1_Missense_Mutation_p.F194I|CCDC129_uc003tck.1_Missense_Mutation_p.F76I	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	168											0						CCCAGCCAGATTCCTTGGTTG	0.478													13	150	---	---	---	---	capture	Missense_Mutation	SNP	31614260	31614260	CCDC129	7	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	2738	146
EGFR	1956	broad.mit.edu	37	7	55219021	55219021	+	Silent	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55219021C>T	uc003tqk.2	+	5	840	c.594C>T	c.(592-594)AGC>AGT	p.S198S	EGFR_uc003tqh.2_Silent_p.S198S|EGFR_uc003tqi.2_Silent_p.S198S|EGFR_uc003tqj.2_Silent_p.S198S|EGFR_uc010kzg.1_Silent_p.S153S|EGFR_uc011kco.1_Silent_p.S145S|EGFR_uc003tql.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	198	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CCAATGGGAGCTGCTGGGGTG	0.493		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			55	185	---	---	---	---	capture	Silent	SNP	55219021	55219021	EGFR	7	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	4922	146
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			30	97	---	---	---	---	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	146
SULF1	23213	broad.mit.edu	37	8	70488235	70488235	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70488235A>C	uc010lza.1	+	6	920	c.203A>C	c.(202-204)AAG>ACG	p.K68T	SULF1_uc003xyd.2_Missense_Mutation_p.K68T|SULF1_uc003xye.2_Missense_Mutation_p.K68T|SULF1_uc003xyf.2_Missense_Mutation_p.K68T|SULF1_uc003xyg.2_Missense_Mutation_p.K68T	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	68					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AAAACGAGAAAGATTATGGAA	0.517													13	53	---	---	---	---	capture	Missense_Mutation	SNP	70488235	70488235	SULF1	8	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	15260	146
ZNF251	90987	broad.mit.edu	37	8	145947815	145947815	+	Silent	SNP	G	A	A			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145947815G>A	uc003zdv.3	-	5	1486	c.1230C>T	c.(1228-1230)TGC>TGT	p.C410C		NM_138367	NP_612376	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	410	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		AGGCTCTGCCGCATTCATTAC	0.443													24	377	---	---	---	---	capture	Silent	SNP	145947815	145947815	ZNF251	8	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	17676	146
GABBR2	9568	broad.mit.edu	37	9	101052880	101052880	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101052880C>G	uc004ays.2	-	19	2968	c.2812G>C	c.(2812-2814)GTC>CTC	p.V938L		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	938	Cytoplasmic (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	AGGCCCGAGACCATGACTCGG	0.687													5	11	---	---	---	---	capture	Missense_Mutation	SNP	101052880	101052880	GABBR2	9	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	6098	146
FUT7	2529	broad.mit.edu	37	9	139925805	139925805	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139925805C>T	uc004ckq.2	-	2	1235	c.386G>A	c.(385-387)GGC>GAC	p.G129D	ABCA2_uc004ckm.1_5'Flank|C9orf139_uc004ckp.1_Intron	NM_004479	NP_004470	Q11130	FUT7_HUMAN	fucosyltransferase 7	129	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity				0	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		GTGGCTGAGGCCGTGGGTGTG	0.711													3	10	---	---	---	---	capture	Missense_Mutation	SNP	139925805	139925805	FUT7	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6051	146
FOXR2	139628	broad.mit.edu	37	X	55650997	55650997	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55650997C>T	uc004duo.2	+	1	1165	c.853C>T	c.(853-855)CGT>TGT	p.R285C		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	285	Fork-head.				embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						GGAGGAGACTCGTGTCTTAGC	0.502													4	66	---	---	---	---	capture	Missense_Mutation	SNP	55650997	55650997	FOXR2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5976	146
ATRX	546	broad.mit.edu	37	X	76872118	76872118	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76872118C>G	uc004ecp.3	-	22	5761	c.5529G>C	c.(5527-5529)CAG>CAC	p.Q1843H	ATRX_uc004ecq.3_Missense_Mutation_p.Q1805H|ATRX_uc004eco.3_Missense_Mutation_p.Q1628H	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1843					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	AGAGCTTGCACTGAATAGAAG	0.328			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						57	22	---	---	---	---	capture	Missense_Mutation	SNP	76872118	76872118	ATRX	23	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	1199	146
TBX22	50945	broad.mit.edu	37	X	79282295	79282295	+	Silent	SNP	C	A	A			TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:79282295C>A	uc010nmg.1	+	6	860	c.726C>A	c.(724-726)CCC>CCA	p.P242P	TBX22_uc004edi.1_Silent_p.P122P|TBX22_uc004edj.1_Silent_p.P242P	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	242	T-box.				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						AGTCCTTGCCCACTGAAGGTG	0.463													9	63	---	---	---	---	capture	Silent	SNP	79282295	79282295	TBX22	23	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	15545	146
AP3S1	1176	broad.mit.edu	37	5	115202418	115202421	+	Frame_Shift_Del	DEL	AAGA	-	-	rs80118146		TCGA-14-1456-01	TCGA-14-1456-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:115202418_115202421delAAGA	uc003krl.2	+	2	237_240	c.121_124delAAGA	c.(121-126)AAGAGAfs	p.K41fs	AP3S1_uc003krk.2_Frame_Shift_Del_p.K19fs|AP3S1_uc003krm.2_Frame_Shift_Del_p.K41fs	NM_001284	NP_001275	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1	41_42					insulin receptor signaling pathway|intracellular protein transport|vesicle-mediated transport	AP-type membrane coat adaptor complex|cytoplasmic vesicle membrane|Golgi apparatus|transport vesicle	protein binding|protein transporter activity				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		TTTGGTATCTAAGAGAGATGAAAA	0.304													9	63	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	115202418	115202421	AP3S1	5	AAGA	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	742	146
