Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
LOC440563	440563	broad.mit.edu	37	1	13183032	13183032	+	Missense_Mutation	SNP	C	T	T	rs55971446	by1000genomes	TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:13183032C>T	uc010obg.1	-	1	936	c.841G>A	c.(841-843)GAG>AAG	p.E281K		NM_001136561	NP_001130033	B2RXH8	B2RXH8_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	281						ribonucleoprotein complex	nucleic acid binding|nucleotide binding				0						CTGTTATCCTCTCCTTCCTCA	0.443													4	108	---	---	---	---	capture	Missense_Mutation	SNP	13183032	13183032	LOC440563	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	8797	147
PADI6	353238	broad.mit.edu	37	1	17721458	17721458	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17721458G>A	uc001bak.1	+	13	1349	c.1349G>A	c.(1348-1350)CGG>CAG	p.R450Q		NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6	442					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GCAGAGGGCCGGGCCATGAGT	0.602													9	42	---	---	---	---	capture	Missense_Mutation	SNP	17721458	17721458	PADI6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11285	147
KIAA0090	23065	broad.mit.edu	37	1	19546124	19546124	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19546124T>C	uc001bbo.2	-	22	2784	c.2741A>G	c.(2740-2742)CAG>CGG	p.Q914R	KIAA0090_uc001bbn.2_RNA|KIAA0090_uc001bbp.2_Missense_Mutation_p.Q913R|KIAA0090_uc001bbq.2_Missense_Mutation_p.Q913R|KIAA0090_uc001bbr.2_Missense_Mutation_p.Q892R	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor	914	DUF1620.|Extracellular (Potential).					integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)		AGAAACTGTCTGGTTATAGTT	0.507													6	135	---	---	---	---	capture	Missense_Mutation	SNP	19546124	19546124	KIAA0090	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	8075	147
KIF17	57576	broad.mit.edu	37	1	20992723	20992723	+	Silent	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:20992723G>A	uc001bdr.3	-	14	3013	c.2895C>T	c.(2893-2895)GAC>GAT	p.D965D	KIF17_uc001bdp.3_Silent_p.D242D|KIF17_uc001bdq.3_Silent_p.D243D|KIF17_uc009vpx.2_Silent_p.D335D|KIF17_uc001bds.3_Silent_p.D964D	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	965					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TCTTCCTGGCGTCTGTGCTGA	0.517													44	130	---	---	---	---	capture	Silent	SNP	20992723	20992723	KIF17	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8201	147
NR0B2	8431	broad.mit.edu	37	1	27240176	27240176	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27240176G>A	uc001bnf.2	-	1	392	c.256C>T	c.(256-258)CGG>TGG	p.R86W		NM_021969	NP_068804	Q15466	NR0B2_HUMAN	short heterodimer partner	86	Ligand-binding (By similarity).				cholesterol metabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	DNA binding|protein domain specific binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity				0		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		TGCAGCAGCCGCCGCTGGTCC	0.642													11	25	---	---	---	---	capture	Missense_Mutation	SNP	27240176	27240176	NR0B2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	10521	147
TNR	7143	broad.mit.edu	37	1	175372637	175372637	+	Silent	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:175372637C>T	uc001gkp.1	-	2	696	c.615G>A	c.(613-615)CCG>CCA	p.P205P	TNR_uc009wwu.1_Silent_p.P205P|TNR_uc010pmz.1_Silent_p.P205P	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	205	Cys-rich.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					AGCAACCCAGCGGGCAGTAGG	0.597													67	194	---	---	---	---	capture	Silent	SNP	175372637	175372637	TNR	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	16221	147
CFHR4	10877	broad.mit.edu	37	1	196871608	196871608	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196871608G>A	uc001gto.2	+	2	188	c.119G>A	c.(118-120)CGT>CAT	p.R40H	CFHR4_uc009wyy.2_Missense_Mutation_p.R39H|CFHR4_uc001gtp.2_Missense_Mutation_p.R40H	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	40	Sushi 1.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						AAGAGTTTGCGTAGACTATAC	0.323													16	167	---	---	---	---	capture	Missense_Mutation	SNP	196871608	196871608	CFHR4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3253	147
NAALADL1	10004	broad.mit.edu	37	11	64825878	64825878	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64825878T>A	uc001ocn.2	-	1	132	c.116A>T	c.(115-117)GAC>GTC	p.D39V	NAALADL1_uc010rnw.1_5'UTR	NM_005468	NP_005459	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic	39	Extracellular (Potential).				proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0						CAGGTCCAGGTCCTGGGGGGC	0.637													7	66	---	---	---	---	capture	Missense_Mutation	SNP	64825878	64825878	NAALADL1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	10039	147
SART1	9092	broad.mit.edu	37	11	65743897	65743897	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65743897G>A	uc001ogl.2	+	13	1696	c.1604G>A	c.(1603-1605)CGC>CAC	p.R535H		NM_005146	NP_005137	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T	535					cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol				ovary(1)	1						CTGGAGTCTCGCCAGCGGGGC	0.637													8	13	---	---	---	---	capture	Missense_Mutation	SNP	65743897	65743897	SART1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13738	147
SLC38A1	81539	broad.mit.edu	37	12	46594885	46594885	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:46594885G>C	uc001rpa.2	-	13	1257	c.999C>G	c.(997-999)TTC>TTG	p.F333L	SLC38A1_uc001rpb.2_Missense_Mutation_p.F333L|SLC38A1_uc001rpc.2_Missense_Mutation_p.F333L|SLC38A1_uc001rpd.2_Missense_Mutation_p.F333L|SLC38A1_uc001rpe.2_Missense_Mutation_p.F333L|SLC38A1_uc010slh.1_Missense_Mutation_p.F306L|SLC38A1_uc009zkj.1_Missense_Mutation_p.F333L	NM_030674	NP_109599	Q9H2H9	S38A1_HUMAN	amino acid transporter system A1	333	Helical; (Potential).				cellular nitrogen compound metabolic process|neurotransmitter uptake	integral to membrane|plasma membrane	sodium:amino acid symporter activity			ovary(2)|skin(2)|central_nervous_system(1)	5	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			ACTTACCATAGAATGTCAAGT	0.299													11	52	---	---	---	---	capture	Missense_Mutation	SNP	46594885	46594885	SLC38A1	12	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	14493	147
OR6C6	283365	broad.mit.edu	37	12	55688832	55688832	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55688832C>T	uc010sph.1	-	1	185	c.185G>A	c.(184-186)CGT>CAT	p.R62H		NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C,	62	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|skin(1)	2						GGAGAAATTACGGAGAAAGAA	0.388													24	99	---	---	---	---	capture	Missense_Mutation	SNP	55688832	55688832	OR6C6	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11098	147
APPL2	55198	broad.mit.edu	37	12	105600948	105600948	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:105600948C>T	uc001tlf.1	-	8	730	c.512G>A	c.(511-513)CGG>CAG	p.R171Q	APPL2_uc010swt.1_Missense_Mutation_p.R128Q|APPL2_uc001tlg.1_5'UTR|APPL2_uc010swu.1_Missense_Mutation_p.R177Q|APPL2_uc009zuq.2_Missense_Mutation_p.R128Q	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	171	Required for RAB5A binding (By similarity).				cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						CTGCTTCCGCCGGGCCGCGGC	0.522													6	111	---	---	---	---	capture	Missense_Mutation	SNP	105600948	105600948	APPL2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	811	147
GZMB	3002	broad.mit.edu	37	14	25100297	25100297	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:25100297T>C	uc001wps.2	-	5	790	c.724A>G	c.(724-726)AAA>GAA	p.K242E	GZMB_uc010ama.2_Missense_Mutation_p.K230E|GZMB_uc010amb.2_RNA	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor	242	Peptidase S1.				activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.028)		TTCATGGTTTTCTTTATCCAG	0.493													50	201	---	---	---	---	capture	Missense_Mutation	SNP	25100297	25100297	GZMB	14	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	6845	147
ESRRB	2103	broad.mit.edu	37	14	76957925	76957925	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:76957925A>C	uc001xsq.1	+	6	990	c.923A>C	c.(922-924)GAT>GCT	p.D308A	ESRRB_uc001xsr.2_Missense_Mutation_p.D308A|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	308						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		TACATCATGGATGAGGAGCAC	0.592													6	12	---	---	---	---	capture	Missense_Mutation	SNP	76957925	76957925	ESRRB	14	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	5216	147
KCNK13	56659	broad.mit.edu	37	14	90528848	90528848	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:90528848C>T	uc001xye.1	+	1	741	c.299C>T	c.(298-300)GCC>GTC	p.A100V		NM_022054	NP_071337	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	100						integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)				TTCACCGGCGCCTTCTACTTC	0.692													4	6	---	---	---	---	capture	Missense_Mutation	SNP	90528848	90528848	KCNK13	14	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7983	147
FOXN1	8456	broad.mit.edu	37	17	26862064	26862064	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26862064C>G	uc010crm.2	+	8	1673	c.1475C>G	c.(1474-1476)CCT>CGT	p.P492R	FOXN1_uc002hbj.2_Missense_Mutation_p.P492R	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	492					defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					CAGGACTCGCCTCTGCCTGCC	0.687													6	55	---	---	---	---	capture	Missense_Mutation	SNP	26862064	26862064	FOXN1	17	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	5963	147
HOXB13	10481	broad.mit.edu	37	17	46805737	46805737	+	Silent	SNP	C	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46805737C>A	uc002ioa.2	-	1	375	c.219G>T	c.(217-219)ACG>ACT	p.T73T		NM_006361	NP_006352	Q92826	HXB13_HUMAN	homeobox B13	73					angiogenesis|epidermis development|response to wounding		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GAGCTGGGGACGTCCCCTGGG	0.652													8	134	---	---	---	---	capture	Silent	SNP	46805737	46805737	HOXB13	17	C	A	A	A	1	0	0	0	0	0	0	0	1	236	19	4	4	7225	147
C18orf62	284274	broad.mit.edu	37	18	73139434	73139434	+	Missense_Mutation	SNP	G	A	A	rs142533881		TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:73139434G>A	uc002lma.1	-	1	156	c.85C>T	c.(85-87)CGG>TGG	p.R29W	C18orf62_uc010dqw.1_RNA|C18orf62_uc002lmb.1_RNA	NM_001037331	NP_001032408	Q3B7S5	CR062_HUMAN	hypothetical protein LOC284274	29						integral to membrane					0		Esophageal squamous(42;0.131)|Prostate(75;0.155)		OV - Ovarian serous cystadenocarcinoma(15;6.21e-06)		TTGAATATCCGTCCCATTCCT	0.498													32	160	---	---	---	---	capture	Missense_Mutation	SNP	73139434	73139434	C18orf62	18	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	1890	147
FAM187B	148109	broad.mit.edu	37	19	35718884	35718884	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35718884A>T	uc002nyk.1	-	1	745	c.700T>A	c.(700-702)TGT>AGT	p.C234S		NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	234	Extracellular (Potential).					integral to membrane				ovary(2)	2						CCTAAGGGACAGTCGAGCCAC	0.507													7	38	---	---	---	---	capture	Missense_Mutation	SNP	35718884	35718884	FAM187B	19	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	5465	147
ZIM3	114026	broad.mit.edu	37	19	57647409	57647409	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57647409C>G	uc002qnz.1	-	5	682	c.296G>C	c.(295-297)AGT>ACT	p.S99T		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	99					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCTTGCGAGACTCTCTTTCAC	0.408													38	216	---	---	---	---	capture	Missense_Mutation	SNP	57647409	57647409	ZIM3	19	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	17565	147
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289													3	13	---	---	---	---	capture	Missense_Mutation	SNP	97869931	97869931	ANKRD36	2	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	661	147
RGPD3	653489	broad.mit.edu	37	2	107049596	107049596	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107049596G>C	uc010ywi.1	-	16	2408	c.2351C>G	c.(2350-2352)ACC>AGC	p.T784S		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	784					intracellular transport		binding			ovary(1)	1						TGAATATTTGGTAGGAGATGG	0.338													29	191	---	---	---	---	capture	Missense_Mutation	SNP	107049596	107049596	RGPD3	2	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	13180	147
CNTNAP5	129684	broad.mit.edu	37	2	125405459	125405459	+	Silent	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:125405459C>T	uc002tno.2	+	13	2362	c.1998C>T	c.(1996-1998)GCC>GCT	p.A666A	CNTNAP5_uc010flu.2_Silent_p.A667A	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	666	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGCTGGAGGCCGTGATCGACG	0.622													5	27	---	---	---	---	capture	Silent	SNP	125405459	125405459	CNTNAP5	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3615	147
THSD7B	80731	broad.mit.edu	37	2	138033556	138033556	+	Silent	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:138033556G>A	uc002tva.1	+	11	2367	c.2367G>A	c.(2365-2367)ACG>ACA	p.T789T	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Silent_p.T679T	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGGGAATAACGGGCAGCAGTG	0.398													7	44	---	---	---	---	capture	Silent	SNP	138033556	138033556	THSD7B	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15765	147
NEB	4703	broad.mit.edu	37	2	152425820	152425820	+	Missense_Mutation	SNP	C	T	T	rs149881695	by1000genomes	TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152425820C>T	uc010fnx.2	-	82	12585	c.12394G>A	c.(12394-12396)GTC>ATC	p.V4132I	NEB_uc002txr.2_Missense_Mutation_p.V555I	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	4132	Nebulin 113.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCATGATTGACGGACACGGAG	0.458													38	38	---	---	---	---	capture	Missense_Mutation	SNP	152425820	152425820	NEB	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10209	147
COBLL1	22837	broad.mit.edu	37	2	165551266	165551266	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:165551266T>C	uc010zcw.1	-	15	3075	c.2951A>G	c.(2950-2952)TAT>TGT	p.Y984C	COBLL1_uc002ucp.2_Missense_Mutation_p.Y917C|COBLL1_uc002ucq.2_Missense_Mutation_p.Y879C|COBLL1_uc010zcx.1_Missense_Mutation_p.Y925C|COBLL1_uc002ucn.2_Missense_Mutation_p.Y345C|COBLL1_uc002uco.2_Missense_Mutation_p.Y648C	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1	955										ovary(2)|pancreas(1)	3						AGATGTCACATAGTGACCCGA	0.448													17	45	---	---	---	---	capture	Missense_Mutation	SNP	165551266	165551266	COBLL1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	3619	147
TTN	7273	broad.mit.edu	37	2	179454479	179454479	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179454479G>A	uc010zfg.1	-	253	54493	c.54269C>T	c.(54268-54270)ACT>ATT	p.T18090I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T11785I|TTN_uc010zfi.1_Missense_Mutation_p.T11718I|TTN_uc010zfj.1_Missense_Mutation_p.T11593I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19017							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGAATGGGAGTTTTTGTTTC	0.413													60	302	---	---	---	---	capture	Missense_Mutation	SNP	179454479	179454479	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	16617	147
CCDC141	285025	broad.mit.edu	37	2	179730518	179730518	+	Silent	SNP	G	A	A	rs144206841		TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179730518G>A	uc002unf.1	-	7	1032	c.975C>T	c.(973-975)TGC>TGT	p.C325C		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	325	Potential.						protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CTCTCATGGCGCAGTACTCCA	0.532													10	469	---	---	---	---	capture	Silent	SNP	179730518	179730518	CCDC141	2	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	2749	147
NEU2	4759	broad.mit.edu	37	2	233899574	233899574	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233899574C>T	uc010zmn.1	+	2	950	c.950C>T	c.(949-951)GCC>GTC	p.A317V		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	317							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		CGACCTCCAGCCCCTGAGGCC	0.672													57	206	---	---	---	---	capture	Missense_Mutation	SNP	233899574	233899574	NEU2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10249	147
ANO7	50636	broad.mit.edu	37	2	242149970	242149970	+	Missense_Mutation	SNP	G	A	A	rs148576854		TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242149970G>A	uc002wax.2	+	15	1811	c.1708G>A	c.(1708-1710)GTC>ATC	p.V570I		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	570	Helical; (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						CCTGGCCCACGTCCTGACACG	0.622													27	72	---	---	---	---	capture	Missense_Mutation	SNP	242149970	242149970	ANO7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	696	147
HNF4A	3172	broad.mit.edu	37	20	43048412	43048412	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43048412G>A	uc002xma.2	+	7	877	c.788G>A	c.(787-789)CGG>CAG	p.R263Q	HNF4A_uc002xlt.2_Missense_Mutation_p.R241Q|HNF4A_uc002xlu.2_Missense_Mutation_p.R241Q|HNF4A_uc002xlv.2_Missense_Mutation_p.R241Q|HNF4A_uc002xly.2_Missense_Mutation_p.R263Q|HNF4A_uc002xlz.2_Missense_Mutation_p.R263Q|HNF4A_uc010ggq.2_Missense_Mutation_p.R256Q	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	263					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GAGATGAGCCGGGTGTCCATA	0.572													39	83	---	---	---	---	capture	Missense_Mutation	SNP	43048412	43048412	HNF4A	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7178	147
PABPC1L	80336	broad.mit.edu	37	20	43545422	43545422	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43545422G>A	uc010ggv.1	+	3	495	c.413G>A	c.(412-414)CGG>CAG	p.R138Q	PABPC1L_uc010zwq.1_RNA	NM_001124756	NP_001118228	Q4VXU2	PAP1L_HUMAN	poly(A)-binding protein, cytoplasmic 1-like	138	RRM 2.						nucleotide binding|RNA binding			ovary(1)	1						CATGGCTCCCGGGGTTTCGGC	0.557													77	225	---	---	---	---	capture	Missense_Mutation	SNP	43545422	43545422	PABPC1L	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11268	147
RBPJL	11317	broad.mit.edu	37	20	43938206	43938206	+	Splice_Site	SNP	G	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43938206G>T	uc002xns.2	+	3	204	c.132_splice	c.e3-1	p.R44_splice	MATN4_uc002xnn.2_5'Flank|MATN4_uc002xno.2_5'Flank|MATN4_uc002xnp.2_5'Flank|MATN4_uc002xnr.1_5'Flank|RBPJL_uc002xnt.2_Splice_Site_p.R44_splice	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L						signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				CCTACTCCCAGGTCATCCCCA	0.607													8	40	---	---	---	---	capture	Splice_Site	SNP	43938206	43938206	RBPJL	20	G	T	T	T	1	0	0	0	0	0	0	1	0	455	35	5	4	13057	147
OGG1	4968	broad.mit.edu	37	3	9798237	9798237	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9798237G>A	uc003bsi.2	+	5	1173	c.830G>A	c.(829-831)CGT>CAT	p.R277H	OGG1_uc003bsh.2_Missense_Mutation_p.R277H|OGG1_uc003bsj.2_Missense_Mutation_p.R277H|OGG1_uc003bsk.2_Missense_Mutation_p.R277H|OGG1_uc003bsl.2_Missense_Mutation_p.R277H|OGG1_uc003bsm.2_Missense_Mutation_p.R277H|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|OGG1_uc003bsp.1_Missense_Mutation_p.R42H|OGG1_uc010hcm.1_Intron|OGG1_uc003bsq.1_Intron|OGG1_uc003bsr.1_Missense_Mutation_p.R42H	NM_002542	NP_002533	O15527	OGG1_HUMAN	8-oxoguanine DNA-glycosylase 1 isoform 1a	277					depurination|nucleotide-excision repair|regulation of protein import into nucleus, translocation|regulation of transcription, DNA-dependent|response to oxidative stress|response to radiation	mitochondrion|nuclear matrix|nuclear speck	damaged DNA binding|endonuclease activity|oxidized purine base lesion DNA N-glycosylase activity|protein binding				0	Medulloblastoma(99;0.227)					ATTGCCCAACGTGACTACAGC	0.602								BER_DNA_glycosylases					32	58	---	---	---	---	capture	Missense_Mutation	SNP	9798237	9798237	OGG1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10750	147
NKIRAS1	28512	broad.mit.edu	37	3	23942514	23942514	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:23942514C>A	uc003ccj.2	-	4	523	c.121G>T	c.(121-123)GAT>TAT	p.D41Y	NKIRAS1_uc003cck.2_Missense_Mutation_p.D41Y|NKIRAS1_uc003ccl.2_Missense_Mutation_p.D41Y|NKIRAS1_uc003ccm.2_Missense_Mutation_p.D41Y	NM_020345	NP_065078	Q9NYS0	KBRS1_HUMAN	kappa B-ras 1	41	Effector region.				I-kappaB kinase/NF-kappaB cascade|small GTPase mediated signal transduction	cytoplasm	GTP binding|GTPase activity				0						ATGTATACATCTTCCATTGTT	0.413													42	119	---	---	---	---	capture	Missense_Mutation	SNP	23942514	23942514	NKIRAS1	3	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	10351	147
ACTR8	93973	broad.mit.edu	37	3	53909976	53909976	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53909976G>A	uc003dhd.2	-	7	969	c.910C>T	c.(910-912)CGG>TGG	p.R304W	ACTR8_uc003dhb.2_Missense_Mutation_p.R54C|ACTR8_uc003dhc.2_Missense_Mutation_p.R193W	NM_022899	NP_075050	Q9H981	ARP8_HUMAN	actin-related protein 8	304					cell division|DNA recombination|DNA repair|mitosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex	protein binding			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		GTTCCTTACCGAGTATTCCGA	0.433													35	85	---	---	---	---	capture	Missense_Mutation	SNP	53909976	53909976	ACTR8	3	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	217	147
EPHA6	285220	broad.mit.edu	37	3	97167503	97167503	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97167503A>T	uc010how.1	+	7	1866	c.1823A>T	c.(1822-1824)CAC>CTC	p.H608L	EPHA6_uc011bgo.1_RNA|EPHA6_uc011bgp.1_5'UTR|EPHA6_uc003drs.3_5'UTR|EPHA6_uc003drr.3_5'UTR|EPHA6_uc003drt.2_5'UTR|EPHA6_uc010hox.1_RNA	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	513	Fibronectin type-III 2.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						TATGTATTTCACATCCGAGTG	0.448													29	72	---	---	---	---	capture	Missense_Mutation	SNP	97167503	97167503	EPHA6	3	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	5126	147
MORC1	27136	broad.mit.edu	37	3	108698509	108698509	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108698509A>T	uc003dxl.2	-	24	2417	c.2330T>A	c.(2329-2331)CTC>CAC	p.L777H	MORC1_uc011bhn.1_Missense_Mutation_p.L756H	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	777					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						CGGCACATTGAGCAAGCTGAG	0.368													7	124	---	---	---	---	capture	Missense_Mutation	SNP	108698509	108698509	MORC1	3	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	9613	147
UGT2A3	79799	broad.mit.edu	37	4	69796959	69796959	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69796959A>C	uc003hef.2	-	4	1029	c.998T>G	c.(997-999)GTG>GGG	p.V333G	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	333	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						CCTCCATAACACCTACGGAAG	0.373													9	31	---	---	---	---	capture	Missense_Mutation	SNP	69796959	69796959	UGT2A3	4	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	16837	147
DDX60	55601	broad.mit.edu	37	4	169196591	169196591	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:169196591G>A	uc003irp.2	-	16	2501	c.2209C>T	c.(2209-2211)CGG>TGG	p.R737W		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	737							ATP binding|ATP-dependent helicase activity|RNA binding	p.R737W(2)		ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		AGTTGGAACCGAGCTGGCCCA	0.393													18	60	---	---	---	---	capture	Missense_Mutation	SNP	169196591	169196591	DDX60	4	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	4336	147
KCNQ5	56479	broad.mit.edu	37	6	73713705	73713705	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:73713705G>T	uc003pgk.2	+	2	820	c.473G>T	c.(472-474)AGT>ATT	p.S158I	KCNQ5_uc003pgj.3_Missense_Mutation_p.S158I|KCNQ5_uc011dyh.1_Missense_Mutation_p.S158I|KCNQ5_uc011dyi.1_Missense_Mutation_p.S158I|KCNQ5_uc010kat.2_Missense_Mutation_p.S158I|KCNQ5_uc011dyj.1_Missense_Mutation_p.S158I|KCNQ5_uc011dyk.1_5'UTR	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	158	Helical; Name=Segment S2; (Potential).				protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		TTGGCCTCAAGTTGCCTCTTG	0.358													21	54	---	---	---	---	capture	Missense_Mutation	SNP	73713705	73713705	KCNQ5	6	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	8008	147
COL12A1	1303	broad.mit.edu	37	6	75858174	75858174	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:75858174C>T	uc003phs.2	-	22	4353	c.4187G>A	c.(4186-4188)CGA>CAA	p.R1396Q	COL12A1_uc003pht.2_Missense_Mutation_p.R232Q	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1396	Fibronectin type-III 9.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						ACGATGGGTTCGCTCAGAAAT	0.398													16	62	---	---	---	---	capture	Missense_Mutation	SNP	75858174	75858174	COL12A1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3634	147
BVES	11149	broad.mit.edu	37	6	105573416	105573416	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:105573416C>T	uc003pqw.2	-	4	546	c.389G>A	c.(388-390)CGA>CAA	p.R130Q	BVES_uc003pqx.2_Missense_Mutation_p.R130Q|BVES_uc003pqy.2_Missense_Mutation_p.R130Q	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance isoform 5	130	Cytoplasmic (Potential).				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity				0		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				TTCAAACAATCGCCGGTACAT	0.443													7	154	---	---	---	---	capture	Missense_Mutation	SNP	105573416	105573416	BVES	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1563	147
T	6862	broad.mit.edu	37	6	166571970	166571970	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:166571970C>T	uc003quu.1	-	9	1634	c.1141G>A	c.(1141-1143)GCG>ACG	p.A381T	T_uc003qut.1_Missense_Mutation_p.A382T|T_uc003quv.1_Missense_Mutation_p.A323T	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	381					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GTGTAGTGCGCGGGGGAGCCC	0.711									Chordoma_Familial_Clustering_of				19	49	---	---	---	---	capture	Missense_Mutation	SNP	166571970	166571970	T	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15376	147
FERD3L	222894	broad.mit.edu	37	7	19184907	19184907	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:19184907G>A	uc003suo.1	-	1	138	c.79C>T	c.(79-81)CGC>TGC	p.R27C	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	27					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						AGGAGAGGGCGTCTCGGGGAG	0.652													15	133	---	---	---	---	capture	Missense_Mutation	SNP	19184907	19184907	FERD3L	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5762	147
UPP1	7378	broad.mit.edu	37	7	48139333	48139333	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48139333C>A	uc003toj.2	+	5	640	c.111C>A	c.(109-111)TTC>TTA	p.F37L	UPP1_uc003tok.2_Missense_Mutation_p.F37L|UPP1_uc003tol.2_Missense_Mutation_p.F37L|UPP1_uc011kcg.1_Missense_Mutation_p.F37L|UPP1_uc011kch.1_Intron|UPP1_uc003ton.2_Intron|UPP1_uc003too.2_Intron	NM_181597	NP_853628	Q16831	UPP1_HUMAN	uridine phosphorylase 1	37					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage	cytosol	uridine phosphorylase activity				0						TCTATCATTTCAATCTCACCA	0.393													19	477	---	---	---	---	capture	Missense_Mutation	SNP	48139333	48139333	UPP1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	376	29	4	4	16894	147
UPP1	7378	broad.mit.edu	37	7	48146585	48146585	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48146585G>T	uc003toj.2	+	8	1081	c.552G>T	c.(550-552)AAG>AAT	p.K184N	UPP1_uc003tok.2_Missense_Mutation_p.K184N|UPP1_uc003tol.2_Missense_Mutation_p.K184N|UPP1_uc011kch.1_5'UTR|UPP1_uc003ton.2_Missense_Mutation_p.K47N|UPP1_uc003too.2_Missense_Mutation_p.K47N	NM_181597	NP_853628	Q16831	UPP1_HUMAN	uridine phosphorylase 1	184					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage	cytosol	uridine phosphorylase activity				0						ACCTTAACAAGAAGCTGGTGC	0.537													28	254	---	---	---	---	capture	Missense_Mutation	SNP	48146585	48146585	UPP1	7	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	16894	147
EGFR	1956	broad.mit.edu	37	7	55221821	55221821	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221821G>A	uc003tqk.2	+	7	1111	c.865G>A	c.(865-867)GCC>ACC	p.A289T	EGFR_uc003tqh.2_Missense_Mutation_p.A289T|EGFR_uc003tqi.2_Missense_Mutation_p.A289T|EGFR_uc003tqj.2_Missense_Mutation_p.A289T|EGFR_uc010kzg.1_Missense_Mutation_p.A244T|EGFR_uc011kco.1_Missense_Mutation_p.A236T|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289T(3)|p.A289D(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGCTTTGGTGCCACCTGCGT	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			868	59	---	---	---	---	capture	Missense_Mutation	SNP	55221821	55221821	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	147
FZD1	8321	broad.mit.edu	37	7	90894669	90894669	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:90894669A>T	uc003ula.2	+	1	887	c.474A>T	c.(472-474)AAA>AAT	p.K158N		NM_003505	NP_003496	Q9UP38	FZD1_HUMAN	frizzled 1 precursor	158	FZ.|Extracellular (Potential).				autocrine signaling|axonogenesis|brain development|canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|embryo development|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|lung alveolus development|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to drug|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cell surface|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|receptor binding|Wnt receptor activity|Wnt-protein binding				0	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			CTCTAGTGAAAGTGCAGTGTT	0.632													83	405	---	---	---	---	capture	Missense_Mutation	SNP	90894669	90894669	FZD1	7	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	6070	147
MUC17	140453	broad.mit.edu	37	7	100685376	100685376	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100685376C>G	uc003uxp.1	+	3	10732	c.10679C>G	c.(10678-10680)ACT>AGT	p.T3560S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3560	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TCTCCAGCAACTCTTCAGGTC	0.478													103	413	---	---	---	---	capture	Missense_Mutation	SNP	100685376	100685376	MUC17	7	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	9884	147
DGKI	9162	broad.mit.edu	37	7	137263039	137263039	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:137263039G>A	uc003vtt.2	-	16	1676	c.1675C>T	c.(1675-1677)CGA>TGA	p.R559*	DGKI_uc003vtu.2_Nonsense_Mutation_p.R259*	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	559					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						ATTTTATTTCGAAAACGACTG	0.338													14	72	---	---	---	---	capture	Nonsense_Mutation	SNP	137263039	137263039	DGKI	7	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	4429	147
PSD3	23362	broad.mit.edu	37	8	18432725	18432725	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:18432725A>G	uc003wza.2	-	13	2655	c.2552T>C	c.(2551-2553)TTG>TCG	p.L851S	PSD3_uc003wyx.3_Missense_Mutation_p.L180S|PSD3_uc003wyy.2_Missense_Mutation_p.L317S|PSD3_uc003wyz.2_Missense_Mutation_p.L152S	NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide	852	PH.				regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CTTGGATGCCAATGCGTGGTG	0.428													34	85	---	---	---	---	capture	Missense_Mutation	SNP	18432725	18432725	PSD3	8	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	12543	147
LGI3	203190	broad.mit.edu	37	8	22006477	22006477	+	Silent	SNP	C	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22006477C>A	uc003xav.2	-	8	1132	c.843G>T	c.(841-843)GTG>GTT	p.V281V	LGI3_uc010ltu.2_Silent_p.V257V	NM_139278	NP_644807	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	281	EAR 2.				exocytosis	cell junction|extracellular region|synaptic vesicle|synaptosome				ovary(1)	1				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		GCTTGCAGTGCACTGCAGAGG	0.627													8	15	---	---	---	---	capture	Silent	SNP	22006477	22006477	LGI3	8	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	8673	147
SNAI2	6591	broad.mit.edu	37	8	49831516	49831516	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:49831516G>T	uc003xqp.2	-	3	821	c.657C>A	c.(655-657)AAC>AAA	p.N219K		NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2	219	C2H2-type 4.				canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CAAATGCTCTGTTGCAGTGAG	0.433													15	87	---	---	---	---	capture	Missense_Mutation	SNP	49831516	49831516	SNAI2	8	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	14719	147
ZFHX4	79776	broad.mit.edu	37	8	77763369	77763369	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:77763369G>C	uc003yav.2	+	10	4464	c.4077G>C	c.(4075-4077)TTG>TTC	p.L1359F	ZFHX4_uc003yau.1_Missense_Mutation_p.L1404F|ZFHX4_uc003yaw.1_Missense_Mutation_p.L1359F	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1359	C2H2-type 10.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATTGTAGCTTGGCTTTCAAAA	0.453										HNSCC(33;0.089)			9	42	---	---	---	---	capture	Missense_Mutation	SNP	77763369	77763369	ZFHX4	8	G	C	C	C	1	0	0	0	0	1	0	0	0	607	47	4	4	17515	147
LRP12	29967	broad.mit.edu	37	8	105503293	105503293	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105503293G>C	uc003yma.2	-	7	2283	c.2188C>G	c.(2188-2190)CTC>GTC	p.L730V	LRP12_uc003ymb.2_Missense_Mutation_p.L711V|LRP12_uc003ylz.2_Missense_Mutation_p.L136V	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	730	Cytoplasmic (Potential).				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATACGACTGAGTGCACTTGTA	0.493													26	51	---	---	---	---	capture	Missense_Mutation	SNP	105503293	105503293	LRP12	8	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	8870	147
NFX1	4799	broad.mit.edu	37	9	33351731	33351731	+	Silent	SNP	G	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33351731G>A	uc003zsq.2	+	16	2659	c.2598G>A	c.(2596-2598)CCG>CCA	p.P866P	SUGT1P1_uc010mjq.1_Intron|NFX1_uc003zsp.1_Silent_p.P866P|NFX1_uc010mjr.1_Silent_p.P867P|NFX1_uc003zsr.2_Silent_p.P867P	NM_002504	NP_002495	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	866	NF-X1-type 8.				inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GTGGTCACCCGTGTATGGCAC	0.552													17	38	---	---	---	---	capture	Silent	SNP	33351731	33351731	NFX1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10294	147
VPS13A	23230	broad.mit.edu	37	9	79867155	79867155	+	Silent	SNP	T	C	C			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79867155T>C	uc004akr.2	+	22	2435	c.2175T>C	c.(2173-2175)GAT>GAC	p.D725D	VPS13A_uc004akp.3_Silent_p.D725D|VPS13A_uc004akq.3_Silent_p.D725D|VPS13A_uc004aks.2_Silent_p.D725D	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	725					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						ACTTAGGTGATAATTGGAGAG	0.343													44	88	---	---	---	---	capture	Silent	SNP	79867155	79867155	VPS13A	9	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	17071	147
C9orf125	84302	broad.mit.edu	37	9	104239089	104239089	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:104239089C>A	uc004bbm.2	-	2	608	c.286G>T	c.(286-288)GCC>TCC	p.A96S	uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	96						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				CGGGGGGTGGCCTGCCAGACA	0.592													7	55	---	---	---	---	capture	Missense_Mutation	SNP	104239089	104239089	C9orf125	9	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	2431	147
NUP214	8021	broad.mit.edu	37	9	134022964	134022964	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:134022964C>G	uc004cag.2	+	14	2144	c.2033C>G	c.(2032-2034)TCT>TGT	p.S678C	NUP214_uc004cah.2_Missense_Mutation_p.S668C|NUP214_uc004cai.2_Missense_Mutation_p.S108C|NUP214_uc004caf.1_Missense_Mutation_p.S667C|NUP214_uc010mzf.2_Intron	NM_005085	NP_005076	P35658	NU214_HUMAN	nucleoporin 214kDa	678	11 X 5 AA approximate repeats.				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		AAGCCAGGCTCTCCCCAGGTA	0.433			T	DEK|SET|ABL1	AML|T-ALL								33	95	---	---	---	---	capture	Missense_Mutation	SNP	134022964	134022964	NUP214	9	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	10669	147
SSX1	6756	broad.mit.edu	37	X	48118025	48118025	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48118025A>T	uc004djb.1	+	4	330	c.239A>T	c.(238-240)CAG>CTG	p.Q80L		NM_005635	NP_005626	Q16384	SSX1_HUMAN	synovial sarcoma, X breakpoint 1	80	KRAB-related.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|transcription corepressor activity		SS18/SSX1(1169)	soft_tissue(1169)	1169						ACAGACTTCCAGGGGAATGAT	0.428													13	204	---	---	---	---	capture	Missense_Mutation	SNP	48118025	48118025	SSX1	23	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	15095	147
FOXP3	50943	broad.mit.edu	37	X	49113238	49113238	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49113238T>A	uc004dnf.3	-	6	805	c.617A>T	c.(616-618)AAG>ATG	p.K206M	FOXP3_uc011mnb.1_Missense_Mutation_p.K229M|FOXP3_uc011mnc.1_Missense_Mutation_p.K206M|FOXP3_uc004dne.3_Missense_Mutation_p.K171M|FOXP3_uc010niq.1_Missense_Mutation_p.K171M	NM_014009	NP_054728	Q9BZS1	FOXP3_HUMAN	forkhead box P3 isoform a	206	C2H2-type.				B cell homeostasis|cerebellum development|chromatin remodeling|embryo development|myeloid cell homeostasis|negative regulation of activated T cell proliferation|negative regulation of chronic inflammatory response|negative regulation of CREB transcription factor activity|negative regulation of cytokine secretion|negative regulation of histone acetylation|negative regulation of histone deacetylation|negative regulation of interferon-gamma biosynthetic process|negative regulation of interferon-gamma production|negative regulation of interleukin-10 production|negative regulation of interleukin-2 biosynthetic process|negative regulation of interleukin-2 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of interleukin-6 production|negative regulation of isotype switching to IgE isotypes|negative regulation of NF-kappaB transcription factor activity|negative regulation of T cell cytokine production|negative regulation of tumor necrosis factor production|pattern specification process|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation|positive regulation of histone acetylation|positive regulation of immature T cell proliferation in thymus|positive regulation of peripheral T cell tolerance induction|positive regulation of T cell anergy|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transforming growth factor-beta1 production|post-embryonic development|regulation of isotype switching to IgG isotypes|response to virus|T cell homeostasis|T cell receptor signaling pathway|tolerance induction to self antigen	cytoplasm|cytoplasm|nucleus|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|histone acetyltransferase binding|histone deacetylase binding|NF-kappaB binding|NFAT protein binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription corepressor activity|zinc ion binding				0	Ovarian(276;0.236)					TTCGAAGACCTTCTCACATCC	0.617													8	103	---	---	---	---	capture	Missense_Mutation	SNP	49113238	49113238	FOXP3	23	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	5972	147
HUWE1	10075	broad.mit.edu	37	X	53590731	53590731	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53590731C>T	uc004dsp.2	-	52	7483	c.7081G>A	c.(7081-7083)GGA>AGA	p.G2361R	HUWE1_uc004dsn.2_Missense_Mutation_p.G1185R	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2361	Glu-rich.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TTCCCAGATCCGCCATCCCTC	0.453													6	32	---	---	---	---	capture	Missense_Mutation	SNP	53590731	53590731	HUWE1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7386	147
AWAT2	158835	broad.mit.edu	37	X	69261810	69261810	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69261810C>T	uc004dxt.1	-	7	856	c.850G>A	c.(850-852)GGG>AGG	p.G284R		NM_001002254	NP_001002254	Q6E213	AWAT2_HUMAN	wax synthase 2	284						endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity				0						AGAGGCTCCCCGACTGCCAGG	0.502													8	81	---	---	---	---	capture	Missense_Mutation	SNP	69261810	69261810	AWAT2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1225	147
OTUD6A	139562	broad.mit.edu	37	X	69282974	69282974	+	Silent	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69282974C>T	uc004dxu.1	+	1	634	c.600C>T	c.(598-600)TAC>TAT	p.Y200Y		NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A	200	OTU.									lung(1)|skin(1)	2						CCTTCGGCTACGACGACTTCA	0.622													8	77	---	---	---	---	capture	Silent	SNP	69282974	69282974	OTUD6A	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11220	147
P2RY10	27334	broad.mit.edu	37	X	78216461	78216461	+	Silent	SNP	C	T	T			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78216461C>T	uc004ede.2	+	4	813	c.444C>T	c.(442-444)TAC>TAT	p.Y148Y	P2RY10_uc004edf.2_Silent_p.Y148Y	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	148	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						AGCGTAGGTACGATGTGGGCA	0.498													35	136	---	---	---	---	capture	Silent	SNP	78216461	78216461	P2RY10	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11251	147
NBPF9	400818	broad.mit.edu	37	1	144615246	144615247	+	Splice_Site	INS	-	AG	AG			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144615246_144615247insAG	uc009wig.1	+	3	190	c.114_splice	c.e3+2	p.L38_splice	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_5'UTR|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_5'UTR|NBPF9_uc010oyg.1_Frame_Shift_Ins_p.K39fs|NBPF9_uc009wii.1_5'UTR|NBPF9_uc009wif.1_RNA|C1orf152_uc001elf.3_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						GTAAACCTCAAAGAGATGTTTT	0.470													8	186	---	---	---	---	capture_indel	Splice_Site	INS	144615246	144615247	NBPF9	1	-	AG	AG	AG	1	0	1	1	0	0	0	1	0	13	1	5	5	10106	147
PRB2	653247	broad.mit.edu	37	12	11546320	11546322	+	In_Frame_Del	DEL	TTG	-	-			TCGA-14-1823-01	TCGA-14-1823-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11546320_11546322delTTG	uc010shk.1	-	3	725_727	c.690_692delCAA	c.(688-693)AACAAG>AAG	p.N230del		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACTTTGGGACTTGTTGTCTCCTT	0.601													8	1455	---	---	---	---	capture_indel	In_Frame_Del	DEL	11546320	11546322	PRB2	12	TTG	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	12339	147
