Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PEX14	5195	broad.mit.edu	37	1	10683104	10683104	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10683104G>T	uc001arn.2	+	6	434	c.413G>T	c.(412-414)GGC>GTC	p.G138V	PEX14_uc009vmu.1_Missense_Mutation_p.G95V|PEX14_uc009vmv.2_Missense_Mutation_p.G74V|PEX14_uc010oam.1_Missense_Mutation_p.G74V|PEX14_uc010oan.1_Missense_Mutation_p.G95V|PEX14_uc009vmw.2_Missense_Mutation_p.G74V	NM_004565	NP_004556	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	138					negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity			breast(1)	1	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		ATCCTGGGCGGCCGAGAGGAC	0.557													12	17	---	---	---	---	capture	Missense_Mutation	SNP	10683104	10683104	PEX14	1	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	11645	148
CLCNKB	1188	broad.mit.edu	37	1	16378220	16378220	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16378220G>A	uc001axw.3	+	14	1393	c.1313G>A	c.(1312-1314)CGC>CAC	p.R438H	FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Missense_Mutation_p.R438H|CLCNKB_uc001axy.3_Missense_Mutation_p.R269H	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1	438			R -> C (in BS3).		excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		GCTATCGGGCGCCTCTTTGGG	0.622													95	120	---	---	---	---	capture	Missense_Mutation	SNP	16378220	16378220	CLCNKB	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3435	148
SRRM1	10250	broad.mit.edu	37	1	24996658	24996658	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24996658G>A	uc001bjm.2	+	15	2476	c.2252G>A	c.(2251-2253)CGA>CAA	p.R751Q	SRRM1_uc010oel.1_Missense_Mutation_p.R763Q|SRRM1_uc009vri.1_Missense_Mutation_p.R680Q	NM_005839	NP_005830	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	751	Pro-rich.|Ser-rich.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		TCATCCTCCCGATCTGTCTCC	0.532													92	138	---	---	---	---	capture	Missense_Mutation	SNP	24996658	24996658	SRRM1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15060	148
TAL1	6886	broad.mit.edu	37	1	47685764	47685764	+	Silent	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47685764G>A	uc001cqx.2	-	4	1201	c.624C>T	c.(622-624)GCC>GCT	p.A208A	TAL1_uc009vyq.2_5'UTR|TAL1_uc001cqy.2_Silent_p.A208A	NM_003189	NP_003180	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	208	Helix-loop-helix motif.				basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity			lung(1)	1						TGCGGAGCTCGGCAAAGGCCC	0.572			T	TRD@|SIL	lymphoblastic leukemia/biphasic								13	44	---	---	---	---	capture	Silent	SNP	47685764	47685764	TAL1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15429	148
L1TD1	54596	broad.mit.edu	37	1	62675593	62675593	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62675593G>A	uc001dae.3	+	4	1449	c.1147G>A	c.(1147-1149)GAG>AAG	p.E383K		NM_019079	NP_061952	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	383	Glu-rich.									ovary(1)|skin(1)	2						AGAGTTTTCCGAGCTAGAGGA	0.358													45	69	---	---	---	---	capture	Missense_Mutation	SNP	62675593	62675593	L1TD1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8509	148
PPFIA4	8497	broad.mit.edu	37	1	203029484	203029484	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:203029484G>A	uc001gyz.2	+	9	1798	c.1205G>A	c.(1204-1206)CGC>CAC	p.R402H	PPFIA4_uc009xaj.2_Missense_Mutation_p.R1033H|PPFIA4_uc010pqf.1_Missense_Mutation_p.R615H|PPFIA4_uc001gza.2_Missense_Mutation_p.R402H|PPFIA4_uc001gzb.1_Missense_Mutation_p.R97H	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f	402	SAM 1.				cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						CTCAAGCTCCGCCTGGCCATT	0.612													25	100	---	---	---	---	capture	Missense_Mutation	SNP	203029484	203029484	PPFIA4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12213	148
THNSL1	79896	broad.mit.edu	37	10	25313035	25313035	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:25313035C>A	uc001isi.3	+	3	1212	c.883C>A	c.(883-885)CTG>ATG	p.L295M	ENKUR_uc001ish.1_Intron	NM_024838	NP_079114	Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1	295					threonine biosynthetic process		ATP binding|pyridoxal phosphate binding|shikimate kinase activity|threonine synthase activity			pancreas(1)	1					L-Threonine(DB00156)|Pyridoxal Phosphate(DB00114)	AGCACAGATACTGTTGGAAAG	0.458													42	4	---	---	---	---	capture	Missense_Mutation	SNP	25313035	25313035	THNSL1	10	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	15747	148
OR52R1	119695	broad.mit.edu	37	11	4825094	4825094	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4825094G>T	uc010qym.1	-	1	754	c.754C>A	c.(754-756)CAA>AAA	p.Q252K		NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R,	173	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCTTGGTGTTGGCAGAAGGGC	0.552													52	70	---	---	---	---	capture	Missense_Mutation	SNP	4825094	4825094	OR52R1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	11035	148
APBB1	322	broad.mit.edu	37	11	6424912	6424912	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6424912G>A	uc001mdb.1	-	3	962	c.862C>T	c.(862-864)CCC>TCC	p.P288S	APBB1_uc001mcz.1_5'Flank|APBB1_uc001mdd.3_Missense_Mutation_p.P68S|APBB1_uc001mda.2_Intron|APBB1_uc001mdc.1_Missense_Mutation_p.P288S|APBB1_uc010rab.1_5'Flank|APBB1_uc010rac.1_5'Flank|APBB1_uc010rad.1_5'Flank|APBB1_uc010rae.1_Missense_Mutation_p.P53S|APBB1_uc010raf.1_Missense_Mutation_p.P29S|APBB1_uc009yfa.2_Missense_Mutation_p.P29S|APBB1_uc009yey.2_Missense_Mutation_p.P29S|APBB1_uc010rag.1_Missense_Mutation_p.P29S|APBB1_uc009yfb.2_Missense_Mutation_p.P29S|APBB1_uc001mde.2_Missense_Mutation_p.P29S|APBB1_uc010rah.1_Missense_Mutation_p.P29S	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	288					apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CCCTGTGAGGGGGAGGCCCGG	0.652													48	76	---	---	---	---	capture	Missense_Mutation	SNP	6424912	6424912	APBB1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	752	148
OR5M1	390168	broad.mit.edu	37	11	56380529	56380529	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56380529C>T	uc001nja.1	-	1	450	c.450G>A	c.(448-450)ATG>ATA	p.M150I		NM_001004740	NP_001004740	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						GAAACCCATACATGTAAGGGA	0.458													24	56	---	---	---	---	capture	Missense_Mutation	SNP	56380529	56380529	OR5M1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	11076	148
NUMA1	4926	broad.mit.edu	37	11	71717105	71717105	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71717105C>T	uc001orl.1	-	22	5840	c.5668G>A	c.(5668-5670)GGG>AGG	p.G1890R	NUMA1_uc001orj.2_Missense_Mutation_p.G72R|NUMA1_uc009ysw.1_Missense_Mutation_p.G1457R|NUMA1_uc001ork.1_Missense_Mutation_p.G754R|NUMA1_uc001orm.1_Missense_Mutation_p.G1876R	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1890					G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CTGGACACCCCGGCCTGGGAA	0.592			T	RARA	APL								64	111	---	---	---	---	capture	Missense_Mutation	SNP	71717105	71717105	NUMA1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10657	148
ADAMTS8	11095	broad.mit.edu	37	11	130281492	130281492	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130281492C>T	uc001qgg.3	-	6	1928	c.1570G>A	c.(1570-1572)GTG>ATG	p.V524M	ADAMTS8_uc001qgf.2_Missense_Mutation_p.V5M	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	524	Disintegrin.				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		CCATCTGCCACGGGCTGCAAC	0.577													28	51	---	---	---	---	capture	Missense_Mutation	SNP	130281492	130281492	ADAMTS8	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	272	148
MLL2	8085	broad.mit.edu	37	12	49420539	49420539	+	Nonsense_Mutation	SNP	A	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49420539A>T	uc001rta.3	-	48	15210	c.15210T>A	c.(15208-15210)TAT>TAA	p.Y5070*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	5070					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CCTGGGTCTCATACACCTCCG	0.632			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			28	56	---	---	---	---	capture	Nonsense_Mutation	SNP	49420539	49420539	MLL2	12	A	T	T	T	1	0	0	0	0	0	1	0	0	102	8	5	4	9533	148
HOXC13	3229	broad.mit.edu	37	12	54332758	54332758	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54332758C>T	uc001sei.2	+	1	183	c.68C>T	c.(67-69)GCG>GTG	p.A23V	HOXC13_uc010sop.1_RNA	NM_017410	NP_059106	P31276	HXC13_HUMAN	homeobox C13	23						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						GAGGACAGCgcggcggagagc	0.468			T	NUP98	AML								3	7	---	---	---	---	capture	Missense_Mutation	SNP	54332758	54332758	HOXC13	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7237	148
MMP19	4327	broad.mit.edu	37	12	56231702	56231702	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56231702G>C	uc001sib.2	-	7	1106	c.985C>G	c.(985-987)CTT>GTT	p.L329V	MMP19_uc001sia.2_Missense_Mutation_p.L43V|MMP19_uc001sid.2_RNA|MMP19_uc010spw.1_Missense_Mutation_p.P282R	NM_002429	NP_002420	Q99542	MMP19_HUMAN	matrix metalloproteinase 19 isoform rasi-1	329	Hemopexin-like 1.				angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1						CCCTCCCAAAGGGCAGACACT	0.542													44	61	---	---	---	---	capture	Missense_Mutation	SNP	56231702	56231702	MMP19	12	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	9569	148
PTPRB	5787	broad.mit.edu	37	12	70983775	70983775	+	Silent	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70983775C>T	uc001swb.3	-	6	1395	c.1365G>A	c.(1363-1365)TTG>TTA	p.L455L	PTPRB_uc010sto.1_Silent_p.L455L|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Silent_p.L673L|PTPRB_uc001swa.3_Silent_p.L673L|PTPRB_uc001swd.3_Silent_p.L672L|PTPRB_uc009zrr.1_Silent_p.L552L	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	455	Fibronectin type-III 5.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CAGAATTCTTCAAATTTCCAC	0.458											OREG0021990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	40	185	---	---	---	---	capture	Silent	SNP	70983775	70983775	PTPRB	12	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	12691	148
MYF6	4618	broad.mit.edu	37	12	81101567	81101567	+	Silent	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:81101567G>A	uc001szf.1	+	1	122	c.69G>A	c.(67-69)CAG>CAA	p.Q23Q		NM_002469	NP_002460	P23409	MYF6_HUMAN	myogenic factor 6	23					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						TTACTCTGCAGCCATTAGAAG	0.517													37	48	---	---	---	---	capture	Silent	SNP	81101567	81101567	MYF6	12	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	9938	148
AACS	65985	broad.mit.edu	37	12	125591804	125591804	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125591804A>C	uc001uhc.2	+	8	1111	c.905A>C	c.(904-906)CAT>CCT	p.H302P	AACS_uc009zyg.2_RNA|AACS_uc001uhd.2_Missense_Mutation_p.H302P|AACS_uc009zyh.2_RNA|AACS_uc009zyi.2_5'UTR	NM_023928	NP_076417	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	302					fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TGCATGGTGCATTCCGCTGGG	0.607													33	63	---	---	---	---	capture	Missense_Mutation	SNP	125591804	125591804	AACS	12	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	9	148
CYSLTR2	57105	broad.mit.edu	37	13	49281611	49281611	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49281611T>A	uc010acx.1	+	6	1341	c.658T>A	c.(658-660)TGT>AGT	p.C220S	CYSLTR2_uc010acy.1_Missense_Mutation_p.C220S|CYSLTR2_uc010acz.1_Missense_Mutation_p.C220S|CYSLTR2_uc010ada.1_Missense_Mutation_p.C220S|CYSLTR2_uc010adb.1_Missense_Mutation_p.C220S|CYSLTR2_uc010adc.1_Missense_Mutation_p.C220S|CYSLTR2_uc010add.1_Missense_Mutation_p.C220S|CYSLTR2_uc010acw.1_Missense_Mutation_p.C220S|CYSLTR2_uc001vck.2_Missense_Mutation_p.C220S	NM_020377	NP_065110	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	220	Helical; Name=5; (Potential).				immune response	integral to membrane|plasma membrane				lung(2)	2		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	ACTCAGCATCTGTTATCTGCT	0.478													49	59	---	---	---	---	capture	Missense_Mutation	SNP	49281611	49281611	CYSLTR2	13	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	4161	148
C13orf16	121793	broad.mit.edu	37	13	111995233	111995233	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111995233C>A	uc001vsa.2	+	5	499	c.370C>A	c.(370-372)CCA>ACA	p.P124T		NM_152324	NP_689537	Q8N6K0	CM016_HUMAN	hypothetical protein LOC121793	124	Cytoplasmic (Potential).					integral to membrane					0	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		all cancers(43;0.113)|GBM - Glioblastoma multiforme(44;0.174)|BRCA - Breast invasive adenocarcinoma(86;0.188)			TCCTGGGCCTCCAAGTGCTGG	0.577													14	47	---	---	---	---	capture	Missense_Mutation	SNP	111995233	111995233	C13orf16	13	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	1705	148
ADPRHL1	113622	broad.mit.edu	37	13	114079397	114079397	+	Silent	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:114079397G>A	uc001vtq.1	-	5	831	c.744C>T	c.(742-744)CCC>CCT	p.P248P	ADPRHL1_uc001vtp.1_Silent_p.P166P	NM_138430	NP_612439	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1 isoform 1	248					protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			CATAATTGTCGGGGAAGATGG	0.299													60	88	---	---	---	---	capture	Silent	SNP	114079397	114079397	ADPRHL1	13	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	332	148
AARS	16	broad.mit.edu	37	16	70310471	70310471	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70310471G>T	uc002eyn.1	-	4	507	c.397C>A	c.(397-399)CTT>ATT	p.L133I		NM_001605	NP_001596	P49588	SYAC_HUMAN	alanyl-tRNA synthetase	133					alanyl-tRNA aminoacylation|tRNA processing	cytosol|soluble fraction	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			pancreas(1)	1		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)	L-Alanine(DB00160)	GTAACATAAAGTCTTTCAATG	0.428													48	61	---	---	---	---	capture	Missense_Mutation	SNP	70310471	70310471	AARS	16	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	19	148
MLYCD	23417	broad.mit.edu	37	16	83933176	83933176	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:83933176C>G	uc002fgz.2	+	1	447	c.427C>G	c.(427-429)CAC>GAC	p.H143D		NM_012213	NP_036345	O95822	DCMC_HUMAN	malonyl-CoA decarboxylase precursor	143					acyl-CoA metabolic process|fatty acid biosynthetic process	mitochondrion|peroxisome	malonyl-CoA decarboxylase activity|methylmalonyl-CoA decarboxylase activity				0						CCTCTTCCACCACATCAGCAA	0.731													5	11	---	---	---	---	capture	Missense_Mutation	SNP	83933176	83933176	MLYCD	16	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	9550	148
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	A	A	rs28934574		TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577094G>A	uc002gim.2	-	8	1038	c.844C>T	c.(844-846)CGG>TGG	p.R282W	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R282W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R150W|TP53_uc010cng.1_Missense_Mutation_p.R150W|TP53_uc002gii.1_Missense_Mutation_p.R150W|TP53_uc010cnh.1_Missense_Mutation_p.R282W|TP53_uc010cni.1_Missense_Mutation_p.R282W|TP53_uc002gij.2_Missense_Mutation_p.R282W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	282	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R282W(367)|p.R282G(27)|p.R282Q(20)|p.R282P(14)|p.R282R(8)|p.0?(7)|p.R282L(3)|p.D281fs*63(2)|p.?(2)|p.R282fs*24(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.R280fs*62(1)|p.R282_E287delRRTEEE(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.R282H(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R282fs*63(1)|p.C275fs*20(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGTGCGCCGGTCTCTCCCA	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			22	43	---	---	---	---	capture	Missense_Mutation	SNP	7577094	7577094	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16264	148
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578263G>A	uc002gim.2	-	6	780	c.586C>T	c.(586-588)CGA>TGA	p.R196*	TP53_uc002gig.1_Nonsense_Mutation_p.R196*|TP53_uc002gih.2_Nonsense_Mutation_p.R196*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R64*|TP53_uc010cng.1_Nonsense_Mutation_p.R64*|TP53_uc002gii.1_Nonsense_Mutation_p.R64*|TP53_uc010cnh.1_Nonsense_Mutation_p.R196*|TP53_uc010cni.1_Nonsense_Mutation_p.R196*|TP53_uc002gij.2_Nonsense_Mutation_p.R196*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R103*|TP53_uc002gio.2_Nonsense_Mutation_p.R64*|TP53_uc010vug.1_Nonsense_Mutation_p.R157*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	196	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R196*(125)|p.R196P(12)|p.0?(7)|p.R196R(5)|p.R196fs*51(4)|p.A189_V197delAPPQHLIRV(4)|p.R196Q(3)|p.K164_P219del(1)|p.R196L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.R64*(1)|p.I195fs*12(1)|p.R103*(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCTTCCACTCGGATAAGATGC	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			36	39	---	---	---	---	capture	Nonsense_Mutation	SNP	7578263	7578263	TP53	17	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	16264	148
PPM1D	8493	broad.mit.edu	37	17	58711271	58711271	+	Silent	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:58711271C>T	uc002iyt.1	+	3	981	c.759C>T	c.(757-759)CAC>CAT	p.H253H	PPM1D_uc010ddm.1_RNA	NM_003620	NP_003611	O15297	PPM1D_HUMAN	protein phosphatase 1D	253	PP2C-like.				negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			GACTCACTCACAATGGACCTG	0.363													45	42	---	---	---	---	capture	Silent	SNP	58711271	58711271	PPM1D	17	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	12238	148
EMILIN2	84034	broad.mit.edu	37	18	2847912	2847912	+	Silent	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2847912C>T	uc002kln.2	+	2	399	c.240C>T	c.(238-240)CCC>CCT	p.P80P		NM_032048	NP_114437	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2 precursor	80	EMI.				cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			skin(2)|ovary(1)	3				READ - Rectum adenocarcinoma(2;0.1)		ACCAGATGCCCTGTCCGTCGG	0.483													17	31	---	---	---	---	capture	Silent	SNP	2847912	2847912	EMILIN2	18	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	5049	148
TCEB3C	162699	broad.mit.edu	37	18	44554653	44554653	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44554653G>A	uc010xdb.1	-	1	1797	c.1561C>T	c.(1561-1563)CGA>TGA	p.R521*	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	521					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0						GCCTGTTTTCGGGTTTTGTcc	0.353													19	429	---	---	---	---	capture	Nonsense_Mutation	SNP	44554653	44554653	TCEB3C	18	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	15570	148
TET3	200424	broad.mit.edu	37	2	74274539	74274539	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74274539C>T	uc002skb.3	+	1	1090	c.1090C>T	c.(1090-1092)CCG>TCG	p.P364S	TET3_uc010fez.1_Missense_Mutation_p.P364S	NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	364							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CTCTTCCTCCCCGGCCCCGGC	0.652													18	12	---	---	---	---	capture	Missense_Mutation	SNP	74274539	74274539	TET3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15656	148
FAM123C	205147	broad.mit.edu	37	2	131521195	131521195	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131521195C>T	uc002trw.2	+	2	1740	c.1550C>T	c.(1549-1551)ACG>ATG	p.T517M	FAM123C_uc010fmv.2_Missense_Mutation_p.T517M|FAM123C_uc010fms.1_Missense_Mutation_p.T517M|FAM123C_uc010fmt.1_Missense_Mutation_p.T517M|FAM123C_uc010fmu.1_Missense_Mutation_p.T517M	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	517										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CGAGGCCCCACGCCCCGTGCC	0.687													4	4	---	---	---	---	capture	Missense_Mutation	SNP	131521195	131521195	FAM123C	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5378	148
THSD7B	80731	broad.mit.edu	37	2	137988713	137988713	+	Missense_Mutation	SNP	C	T	T	rs61741154		TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:137988713C>T	uc002tva.1	+	7	1730	c.1730C>T	c.(1729-1731)ACG>ATG	p.T577M	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.T467M	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGCGAGTGGACGGAGTGGTCA	0.517													25	30	---	---	---	---	capture	Missense_Mutation	SNP	137988713	137988713	THSD7B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15765	148
XIRP2	129446	broad.mit.edu	37	2	168101235	168101235	+	Silent	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168101235G>A	uc002udx.2	+	8	3351	c.3333G>A	c.(3331-3333)TCG>TCA	p.S1111S	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.S936S|XIRP2_uc010fpq.2_Silent_p.S889S|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	936					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AAAAAGTTTCGTTAATGACCA	0.368													29	48	---	---	---	---	capture	Silent	SNP	168101235	168101235	XIRP2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17311	148
TTN	7273	broad.mit.edu	37	2	179647001	179647001	+	Silent	SNP	G	A	A	rs141768043		TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179647001G>A	uc010zfg.1	-	20	3542	c.3318C>T	c.(3316-3318)GGC>GGT	p.G1106G	TTN_uc010zfh.1_Silent_p.G1060G|TTN_uc010zfi.1_Silent_p.G1060G|TTN_uc010zfj.1_Silent_p.G1060G|TTN_uc002unb.2_Silent_p.G1106G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1106							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGGTTGCCGCCAACTTGGC	0.488													49	66	---	---	---	---	capture	Silent	SNP	179647001	179647001	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	16617	148
C20orf70	140683	broad.mit.edu	37	20	31760743	31760743	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31760743C>A	uc002wyo.1	+	3	234	c.163C>A	c.(163-165)CTT>ATT	p.L55I		NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor	55						extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2						GGCAGGCATCCTTGAGAAACT	0.338													5	62	---	---	---	---	capture	Missense_Mutation	SNP	31760743	31760743	C20orf70	20	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	2097	148
TRPC4AP	26133	broad.mit.edu	37	20	33591328	33591328	+	Missense_Mutation	SNP	C	T	T	rs146813768		TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33591328C>T	uc002xbk.2	-	18	2175	c.2141G>A	c.(2140-2142)CGG>CAG	p.R714Q	TRPC4AP_uc002xbj.2_RNA|TRPC4AP_uc010zuq.1_Missense_Mutation_p.R305Q|TRPC4AP_uc002xbl.2_Missense_Mutation_p.R706Q|TRPC4AP_uc010zur.1_Missense_Mutation_p.R675Q	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	714					protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GTGCTCCATCCGCTGCAGCAG	0.612													13	19	---	---	---	---	capture	Missense_Mutation	SNP	33591328	33591328	TRPC4AP	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16464	148
TSHZ2	128553	broad.mit.edu	37	20	51870234	51870234	+	Silent	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51870234C>T	uc002xwo.2	+	2	1193	c.237C>T	c.(235-237)GCC>GCT	p.A79A		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	79					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			ATCAGGATGCCGAGAACGAGT	0.537													40	36	---	---	---	---	capture	Silent	SNP	51870234	51870234	TSHZ2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16507	148
MC3R	4159	broad.mit.edu	37	20	54824418	54824418	+	Silent	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54824418C>T	uc002xxb.2	+	1	631	c.519C>T	c.(517-519)GGC>GGT	p.G173G		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	210	Helical; Name=4; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			TCTGCTGCGGCGTCTGTGGCG	0.562													60	91	---	---	---	---	capture	Silent	SNP	54824418	54824418	MC3R	20	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9278	148
BAGE2	85319	broad.mit.edu	37	21	11058294	11058294	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:11058294G>A	uc002yit.1	-	3	354	c.146C>T	c.(145-147)CCA>CTA	p.P49L	BAGE_uc002yiw.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATTTGATAGTGGCTCCAAAGT	0.403													14	222	---	---	---	---	capture	Missense_Mutation	SNP	11058294	11058294	BAGE2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	1281	148
ACR	49	broad.mit.edu	37	22	51183292	51183292	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:51183292G>A	uc003bnh.3	+	5	935	c.923G>A	c.(922-924)CGA>CAA	p.R308Q		NM_001097	NP_001088	P10323	ACRO_HUMAN	acrosin precursor	308					acrosome matrix dispersal|activation of adenylate cyclase activity	acrosomal matrix|protein complex	amidase activity|copper ion binding|DNA binding|drug binding|fucose binding|mannose binding|protein binding|serine-type endopeptidase activity|zinc ion binding				0		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		CCCACCACTCGACCGCCCCCG	0.602													6	5	---	---	---	---	capture	Missense_Mutation	SNP	51183292	51183292	ACR	22	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	169	148
METTL6	131965	broad.mit.edu	37	3	15468122	15468122	+	Translation_Start_Site	SNP	C	T	T	rs140376877	by1000genomes	TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15468122C>T	uc003bzs.1	-	2	155	c.-103G>A	c.(-105--101)GCGTG>GCATG		METTL6_uc011avp.1_Translation_Start_Site|METTL6_uc003bzt.1_Translation_Start_Site|EAF1_uc003bzu.2_5'Flank|EAF1_uc011avq.1_5'Flank	NM_152396	NP_689609	Q8TCB7	METL6_HUMAN	methyltransferase like 6								methyltransferase activity				0						GTGAGTTTCACGCCTCAAACA	0.418													13	52	---	---	---	---	capture	Translation_Start_Site	SNP	15468122	15468122	METTL6	3	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	9416	148
TIPARP	25976	broad.mit.edu	37	3	156422618	156422618	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:156422618A>G	uc003fav.2	+	6	1920	c.1672A>G	c.(1672-1674)ATG>GTG	p.M558V	TIPARP_uc003faw.2_Missense_Mutation_p.M558V	NM_015508	NP_056323	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	558	PARP catalytic.						NAD+ ADP-ribosyltransferase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|breast(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GCATGCTACAATGTTTGGACA	0.408													102	369	---	---	---	---	capture	Missense_Mutation	SNP	156422618	156422618	TIPARP	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	15809	148
VPS8	23355	broad.mit.edu	37	3	184648300	184648300	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184648300G>A	uc003fpb.1	+	33	3007	c.2836G>A	c.(2836-2838)GGA>AGA	p.G946R	VPS8_uc010hyd.1_Missense_Mutation_p.G856R|VPS8_uc010hye.1_Missense_Mutation_p.G375R	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	948							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			ATCCATTCCCGGACACAGTGC	0.393													115	64	---	---	---	---	capture	Missense_Mutation	SNP	184648300	184648300	VPS8	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17100	148
C4orf35	85438	broad.mit.edu	37	4	71201281	71201281	+	Silent	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71201281C>T	uc003hff.2	+	1	611	c.525C>T	c.(523-525)GAC>GAT	p.D175D		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	175						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				GTGTTGCTGACGCTCCTGCCT	0.463													38	41	---	---	---	---	capture	Silent	SNP	71201281	71201281	C4orf35	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2243	148
FGG	2266	broad.mit.edu	37	4	155528020	155528020	+	Silent	SNP	G	A	A	rs146218442		TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155528020G>A	uc003ioj.2	-	8	1107	c.966C>T	c.(964-966)GGC>GGT	p.G322G	FGG_uc003iog.2_Silent_p.G322G|FGG_uc003ioh.2_Silent_p.G330G|FGG_uc010ipx.2_Silent_p.G150G|FGG_uc010ipy.2_Silent_p.G33G|FGG_uc003ioi.2_Silent_p.G33G|FGG_uc003iok.2_Silent_p.G330G	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	322	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TAGGATCATCGCCAAAATCAA	0.473													65	95	---	---	---	---	capture	Silent	SNP	155528020	155528020	FGG	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5816	148
NKD2	85409	broad.mit.edu	37	5	1033572	1033572	+	Silent	SNP	C	G	G			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1033572C>G	uc003jbt.1	+	5	293	c.288C>G	c.(286-288)CGC>CGG	p.R96R	NKD2_uc010itf.1_Silent_p.R96R	NM_033120	NP_149111	Q969F2	NKD2_HUMAN	naked cuticle homolog 2	96	Targeting to the basolateral cell membrane.				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			CAGCAAACCGCGAGGGCCCGC	0.692													3	4	---	---	---	---	capture	Silent	SNP	1033572	1033572	NKD2	5	C	G	G	G	1	0	0	0	0	0	0	0	1	340	27	4	4	10349	148
PCDHGB2	56103	broad.mit.edu	37	5	140741624	140741624	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140741624G>A	uc003ljs.1	+	1	1922	c.1922G>A	c.(1921-1923)CGC>CAC	p.R641H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.R641H|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	641	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCGCCAGCGCCTGCTGGTC	0.687													9	7	---	---	---	---	capture	Missense_Mutation	SNP	140741624	140741624	PCDHGB2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11466	148
KIF4B	285643	broad.mit.edu	37	5	154396976	154396976	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154396976C>A	uc010jih.1	+	1	3717	c.3557C>A	c.(3556-3558)GCT>GAT	p.A1186D		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1186	Interaction with PRC1 (By similarity).|Globular (By similarity).				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ACTGCTCCAGCTCCCTCCCCT	0.493													29	31	---	---	---	---	capture	Missense_Mutation	SNP	154396976	154396976	KIF4B	5	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	8226	148
DUSP22	56940	broad.mit.edu	37	6	335117	335117	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:335117G>T	uc003msx.2	+	4	581	c.142G>T	c.(142-144)GTT>TTT	p.V48F	DUSP22_uc011dhn.1_Missense_Mutation_p.V48F|DUSP22_uc003msy.1_Missense_Mutation_p.V5F	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	48					apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		TCTGCAGGGAGTTAAATACCT	0.299													14	92	---	---	---	---	capture	Missense_Mutation	SNP	335117	335117	DUSP22	6	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	4776	148
HFE	3077	broad.mit.edu	37	6	26091215	26091215	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26091215G>A	uc003nfx.1	+	2	383	c.223G>A	c.(223-225)GTT>ATT	p.V75I	HFE_uc003nfy.1_Missense_Mutation_p.V52I|HFE_uc010jqe.1_Missense_Mutation_p.V75I|HFE_uc003nfz.1_Intron|HFE_uc003ngd.1_Intron|HFE_uc003nga.1_Missense_Mutation_p.V75I|HFE_uc003ngb.1_Missense_Mutation_p.V75I|HFE_uc003ngc.1_Missense_Mutation_p.V75I|HFE_uc003nge.1_Intron|HFE_uc003ngf.1_Intron	NM_000410	NP_000401	Q30201	HFE_HUMAN	hemochromatosis protein isoform 1 precursor	75	Extracellular (Potential).|Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I|cellular iron ion homeostasis|immune response|iron ion transport|protein complex assembly|receptor-mediated endocytosis	apical part of cell|basal part of cell|cytoplasmic vesicle|early endosome|integral to plasma membrane|MHC class I protein complex|perinuclear region of cytoplasm|recycling endosome	protein binding				0						AACTCCATGGGTTTCCAGTAG	0.488									Hemochromatosis				47	57	---	---	---	---	capture	Missense_Mutation	SNP	26091215	26091215	HFE	6	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	7006	148
C6orf170	221322	broad.mit.edu	37	6	121625568	121625568	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:121625568C>T	uc003pyo.1	-	8	946	c.878G>A	c.(877-879)CGT>CAT	p.R293H	C6orf170_uc003pyq.1_RNA	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	293					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		ATTTAGAAGACGAACCTACAA	0.358													43	51	---	---	---	---	capture	Missense_Mutation	SNP	121625568	121625568	C6orf170	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2321	148
RBAK	57786	broad.mit.edu	37	7	5097035	5097035	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5097035G>A	uc010kss.1	+	4	449	c.125G>A	c.(124-126)AGC>AAC	p.S42N	LOC389458_uc003snr.2_Missense_Mutation_p.S42N|RBAK_uc003sns.1_Missense_Mutation_p.S42N	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor	42	KRAB.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		GAGAACTATAGCCATCTAGTT	0.433													69	201	---	---	---	---	capture	Missense_Mutation	SNP	5097035	5097035	RBAK	7	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	12995	148
MGAM	8972	broad.mit.edu	37	7	141759688	141759688	+	Silent	SNP	T	C	C			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141759688T>C	uc003vwy.2	+	33	4035	c.3981T>C	c.(3979-3981)CCT>CCC	p.P1327P		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1327	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGACACAGCCTTATCCTGCCT	0.463													3	30	---	---	---	---	capture	Silent	SNP	141759688	141759688	MGAM	7	T	C	C	C	1	0	0	0	0	0	0	0	1	717	56	3	3	9453	148
PDGFRL	5157	broad.mit.edu	37	8	17447275	17447275	+	Splice_Site	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:17447275G>A	uc003wxr.2	+	2	414	c.353_splice	c.e2+1	p.S118_splice		NM_006207	NP_006198	Q15198	PGFRL_HUMAN	platelet-derived growth factor receptor-like							extracellular region	platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity				0				Colorectal(111;0.0752)		CTCGCCTCAGGTAAGCATTTT	0.403													34	73	---	---	---	---	capture	Splice_Site	SNP	17447275	17447275	PDGFRL	8	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	11566	148
RANBP6	26953	broad.mit.edu	37	9	6014248	6014248	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:6014248G>T	uc003zjr.2	-	1	1371	c.1360C>A	c.(1360-1362)CTG>ATG	p.L454M	RANBP6_uc011lmf.1_Missense_Mutation_p.L102M|RANBP6_uc003zjs.2_Missense_Mutation_p.L42M	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	454	HEAT 4.				protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GTACGTAACAGAGCTGCAATC	0.413													26	47	---	---	---	---	capture	Missense_Mutation	SNP	6014248	6014248	RANBP6	9	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	12926	148
PLIN2	123	broad.mit.edu	37	9	19120899	19120899	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19120899G>A	uc003zno.2	-	5	753	c.574C>T	c.(574-576)CCT>TCT	p.P192S	PLIN2_uc011lna.1_Missense_Mutation_p.P164S|PLIN2_uc011lnb.1_Intron	NM_001122	NP_001113	Q99541	PLIN2_HUMAN	adipose differentiation-related protein	192					cellular lipid metabolic process	endoplasmic reticulum|extracellular region|lipid particle				ovary(2)	2						TCAGTGAGAGGGAGGTACTGT	0.403													56	79	---	---	---	---	capture	Missense_Mutation	SNP	19120899	19120899	PLIN2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11993	148
TMOD1	7111	broad.mit.edu	37	9	100353675	100353675	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100353675C>T	uc004axk.1	+	9	1186	c.973C>T	c.(973-975)CGG>TGG	p.R325W	TMOD1_uc004axl.1_Missense_Mutation_p.R325W	NM_003275	NP_003266	P28289	TMOD1_HUMAN	tropomodulin 1	325					muscle filament sliding	cytosol	actin binding				0		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		GCAAGGACCCCGGCTTCGGGC	0.512													4	133	---	---	---	---	capture	Missense_Mutation	SNP	100353675	100353675	TMOD1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	16116	148
SLC44A1	23446	broad.mit.edu	37	9	108110683	108110683	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:108110683A>G	uc004bcn.2	+	5	672	c.451A>G	c.(451-453)ACA>GCA	p.T151A	SLC44A1_uc010mtk.1_Missense_Mutation_p.T151A	NM_080546	NP_536856	Q8WWI5	CTL1_HUMAN	CDW92 antigen	151	Mitochondrial intermembrane (Potential).					integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity			breast(3)|ovary(1)	4					Choline(DB00122)	TGAATACACTACATCTCCAAA	0.373													37	73	---	---	---	---	capture	Missense_Mutation	SNP	108110683	108110683	SLC44A1	9	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	14527	148
MED22	6837	broad.mit.edu	37	9	136211100	136211100	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136211100A>G	uc004cdc.2	-	4	527	c.293T>C	c.(292-294)ATT>ACT	p.I98T	MED22_uc004cdd.2_Missense_Mutation_p.I98T	NM_133640	NP_598395	Q15528	MED22_HUMAN	mediator complex subunit 22 isoform b	98	Potential.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|mediator complex|soluble fraction	protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		GCGCTGGTCAATGGCCTCGTT	0.602													62	71	---	---	---	---	capture	Missense_Mutation	SNP	136211100	136211100	MED22	9	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9353	148
CFP	5199	broad.mit.edu	37	X	47486279	47486279	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47486279G>T	uc004dig.3	-	6	959	c.833C>A	c.(832-834)ACC>AAC	p.T278N	CFP_uc004dih.2_Missense_Mutation_p.T278N|CFP_uc004dii.1_Missense_Mutation_p.T214N|CFP_uc010nhu.2_Missense_Mutation_p.T278N	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor	278	TSP type-1 4.				complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						TTGTTCCATGGTCTGGCCCAG	0.662													12	1	---	---	---	---	capture	Missense_Mutation	SNP	47486279	47486279	CFP	23	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	3259	148
ITIH5L	347365	broad.mit.edu	37	X	54777770	54777770	+	Silent	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54777770C>T	uc004dtj.2	-	12	3426	c.3396G>A	c.(3394-3396)CCG>CCA	p.P1132P		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	1132					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						CCTTGTGGCCCGGCCTTGGTG	0.572													29	6	---	---	---	---	capture	Silent	SNP	54777770	54777770	ITIH5L	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7831	148
DCAF12L1	139170	broad.mit.edu	37	X	125685588	125685588	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125685588C>T	uc004eul.2	-	1	1255	c.1004G>A	c.(1003-1005)CGC>CAC	p.R335H		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	335										skin(3)|ovary(1)	4						CTGGTCCTGGCGCAGATCCAG	0.597													56	7	---	---	---	---	capture	Missense_Mutation	SNP	125685588	125685588	DCAF12L1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4223	148
MAGEA10	4109	broad.mit.edu	37	X	151303380	151303380	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151303380C>T	uc004ffk.2	-	5	1121	c.713G>A	c.(712-714)GGC>GAC	p.G238D	MAGEA10_uc004ffl.2_Missense_Mutation_p.G238D	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	238	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					GGTGCAGTAGCCCTCTATGAA	0.527													44	8	---	---	---	---	capture	Missense_Mutation	SNP	151303380	151303380	MAGEA10	23	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9078	148
CACNA1G	8913	broad.mit.edu	37	17	48703853	48703854	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48703853_48703854insC	uc002irk.1	+	38	7247_7248	c.6875_6876insC	c.(6874-6876)GGCfs	p.G2292fs	CACNA1G_uc002irj.1_Frame_Shift_Ins_p.G2086fs|CACNA1G_uc002irl.1_Frame_Shift_Ins_p.G2176fs|CACNA1G_uc002irm.1_Frame_Shift_Ins_p.G2213fs|CACNA1G_uc002irn.1_Frame_Shift_Ins_p.G2158fs|CACNA1G_uc002iro.1_Frame_Shift_Ins_p.G2165fs|CACNA1G_uc002irp.1_Frame_Shift_Ins_p.G2247fs|CACNA1G_uc002irq.1_Frame_Shift_Ins_p.G2269fs|CACNA1G_uc002irr.1_Frame_Shift_Ins_p.G2199fs|CACNA1G_uc002irs.1_Frame_Shift_Ins_p.G2236fs|CACNA1G_uc002irt.1_Frame_Shift_Ins_p.G2181fs|CACNA1G_uc002irv.1_Frame_Shift_Ins_p.G2188fs|CACNA1G_uc002irw.1_Frame_Shift_Ins_p.G2221fs|CACNA1G_uc002iru.1_Frame_Shift_Ins_p.G2258fs|CACNA1G_uc002irx.1_Frame_Shift_Ins_p.G2033fs|CACNA1G_uc002iry.1_Frame_Shift_Ins_p.G2022fs|CACNA1G_uc002irz.1_Frame_Shift_Ins_p.G2105fs|CACNA1G_uc002isa.1_Frame_Shift_Ins_p.G2078fs|CACNA1G_uc002isb.1_Frame_Shift_Ins_p.G2119fs|CACNA1G_uc002isc.1_Frame_Shift_Ins_p.G2194fs|CACNA1G_uc002isd.1_Frame_Shift_Ins_p.G2087fs|CACNA1G_uc002ise.1_Frame_Shift_Ins_p.G2115fs|CACNA1G_uc002isf.1_Frame_Shift_Ins_p.G2142fs|CACNA1G_uc002isg.1_Frame_Shift_Ins_p.G2060fs|CACNA1G_uc002ish.1_Frame_Shift_Ins_p.G2067fs|CACNA1G_uc002isi.1_Frame_Shift_Ins_p.G2055fs	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	2292	Cytoplasmic (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	AACCTTGGGGGCCAGCCTCTTG	0.653											OREG0024569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	6	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	48703853	48703854	CACNA1G	17	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	2520	148
SLC35A2	7355	broad.mit.edu	37	X	48762551	48762552	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-14-1825-01	TCGA-14-1825-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48762551_48762552delGA	uc004dlo.1	-	4	638_639	c.634_635delTC	c.(634-636)TCCfs	p.S212fs	SLC35A2_uc011mml.1_Frame_Shift_Del_p.S225fs|SLC35A2_uc004dlp.1_Frame_Shift_Del_p.S212fs|SLC35A2_uc011mmm.1_Frame_Shift_Del_p.S240fs|SLC35A2_uc011mmn.1_Frame_Shift_Del_p.S151fs|SLC35A2_uc004dlr.1_Intron|SLC35A2_uc004dlq.2_Intron	NM_005660	NP_005651	P78381	S35A2_HUMAN	solute carrier family 35, member A2 isoform a	212	Helical; (Potential).				galactose metabolic process	Golgi membrane|integral to membrane|nucleus	sugar:hydrogen symporter activity|UDP-galactose transmembrane transporter activity			breast(1)	1						GAAGCCGGAGGAGAGACAGGAG	0.649													4	2	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	48762551	48762552	SLC35A2	23	GA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	14463	148
