Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PEX14	5195	broad.mit.edu	37	1	10555347	10555347	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10555347G>A	uc001arn.2	+	2	74	c.53G>A	c.(52-54)GGA>GAA	p.G18E	PEX14_uc001arm.1_RNA|PEX14_uc009vmu.1_Missense_Mutation_p.G18E|PEX14_uc009vmv.2_5'UTR|PEX14_uc010oam.1_5'UTR|PEX14_uc010oan.1_Missense_Mutation_p.G18E|PEX14_uc001arl.2_RNA	NM_004565	NP_004556	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	18					negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity			breast(1)	1	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		TCTACTCCAGGAAGTGAAAAT	0.428											OREG0013090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	53	---	---	---	---	capture	Missense_Mutation	SNP	10555347	10555347	PEX14	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11645	150
PRAMEF2	65122	broad.mit.edu	37	1	12919972	12919972	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12919972G>A	uc001aum.1	+	3	799	c.712G>A	c.(712-714)GTT>ATT	p.V238I		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	238											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTGCAAACTCGTTTTCTCCAG	0.448													78	144	---	---	---	---	capture	Missense_Mutation	SNP	12919972	12919972	PRAMEF2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12335	150
C1orf173	127254	broad.mit.edu	37	1	75055329	75055329	+	Missense_Mutation	SNP	C	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75055329C>A	uc001dgg.2	-	12	2381	c.2162G>T	c.(2161-2163)GGG>GTG	p.G721V	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.G515V	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	721	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TTCCTCCAACCCAGGGAGACC	0.473													41	537	---	---	---	---	capture	Missense_Mutation	SNP	75055329	75055329	C1orf173	1	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	1996	150
GBP5	115362	broad.mit.edu	37	1	89732739	89732739	+	Missense_Mutation	SNP	A	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89732739A>T	uc001dnc.2	-	6	1063	c.526T>A	c.(526-528)TTA>ATA	p.L176I	GBP5_uc001dnd.2_Missense_Mutation_p.L176I|GBP5_uc001dne.1_Missense_Mutation_p.L176I	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN	guanylate-binding protein 5	176						plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)		GTCCACACTAAGTCTGGGAAG	0.493													11	243	---	---	---	---	capture	Missense_Mutation	SNP	89732739	89732739	GBP5	1	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	6217	150
TCHHL1	126637	broad.mit.edu	37	1	152058703	152058703	+	Silent	SNP	G	A	A	rs150195731	byFrequency	TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152058703G>A	uc001ezo.1	-	3	1520	c.1455C>T	c.(1453-1455)AAC>AAT	p.N485N		NM_001008536	NP_001008536	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	485							calcium ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			CTGCAGGTGCGTTTTTGCTGT	0.478													157	286	---	---	---	---	capture	Silent	SNP	152058703	152058703	TCHHL1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15586	150
RGS21	431704	broad.mit.edu	37	1	192321267	192321267	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:192321267C>T	uc001gsh.2	+	4	353	c.179C>T	c.(178-180)ACG>ATG	p.T60M		NM_001039152	NP_001034241	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	60	RGS.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|skin(1)	2						TTTAAGAAAACGAAAAATGCA	0.348													34	54	---	---	---	---	capture	Missense_Mutation	SNP	192321267	192321267	RGS21	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13196	150
FAM58B	339521	broad.mit.edu	37	1	200183231	200183231	+	Missense_Mutation	SNP	C	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:200183231C>G	uc009wzi.1	+	1	576	c.540C>G	c.(538-540)GAC>GAG	p.D180E		NM_001105517	NP_001098987	P0C7Q3	FA58B_HUMAN	family with sequence similarity 58 member B	180					regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding				0	Prostate(682;0.19)					TGCTGCGGGACAGCTACCACG	0.652													13	25	---	---	---	---	capture	Missense_Mutation	SNP	200183231	200183231	FAM58B	1	C	G	G	G	1	0	0	0	0	1	0	0	0	220	17	4	4	5539	150
KCNH1	3756	broad.mit.edu	37	1	211192295	211192295	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:211192295G>A	uc001hib.2	-	6	1032	c.862C>T	c.(862-864)CGC>TGC	p.R288C	KCNH1_uc001hic.2_Missense_Mutation_p.R288C	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	288	Cytoplasmic (Potential).				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TAGTTCATGCGGATAAGTTTG	0.448													68	132	---	---	---	---	capture	Missense_Mutation	SNP	211192295	211192295	KCNH1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7953	150
OBSCN	84033	broad.mit.edu	37	1	228479711	228479711	+	Silent	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228479711G>A	uc009xez.1	+	39	10496	c.10452G>A	c.(10450-10452)GGG>GGA	p.G3484G	OBSCN_uc001hsn.2_Silent_p.G3484G|OBSCN_uc001hsq.1_Silent_p.G740G	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	3484	Ig-like 35.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GGAGGAAGGGGCCCGAGAACC	0.617													36	46	---	---	---	---	capture	Silent	SNP	228479711	228479711	OBSCN	1	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	10717	150
OR2T6	254879	broad.mit.edu	37	1	248551519	248551519	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248551519G>A	uc001iei.1	+	1	610	c.610G>A	c.(610-612)GTT>ATT	p.V204I		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	204	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTGTGCTGCGTTGCAATGCT	0.517													27	61	---	---	---	---	capture	Missense_Mutation	SNP	248551519	248551519	OR2T6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10933	150
EGR2	1959	broad.mit.edu	37	10	64573353	64573353	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:64573353G>A	uc010qim.1	-	3	1199	c.1045C>T	c.(1045-1047)CGG>TGG	p.R349W	EGR2_uc010qin.1_Missense_Mutation_p.R299W|EGR2_uc001jmi.2_Missense_Mutation_p.R349W|EGR2_uc010qio.1_Missense_Mutation_p.R362W|EGR2_uc009xph.2_Missense_Mutation_p.R349W	NM_001136177	NP_001129649	P11161	EGR2_HUMAN	early growth response 2 protein isoform a	349	C2H2-type 1.				fat cell differentiation|protein export from nucleus|transcription from RNA polymerase II promoter	cytoplasm|nucleus	chromatin binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding			ovary(2)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					GAGAACCGCCGGTCGCAGCCT	0.642													3	39	---	---	---	---	capture	Missense_Mutation	SNP	64573353	64573353	EGR2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	4927	150
PCGF5	84333	broad.mit.edu	37	10	93038067	93038067	+	Silent	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:93038067C>T	uc001khh.2	+	10	1012	c.765C>T	c.(763-765)TTC>TTT	p.F255F	PCGF5_uc010qnk.1_Silent_p.F255F|PCGF5_uc001khi.2_Silent_p.F255F	NM_032373	NP_115749	Q86SE9	PCGF5_HUMAN	polycomb group ring finger 5	255					regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|PcG protein complex	zinc ion binding			lung(1)	1						GAATTGATTTCGGTTAGACCA	0.388													38	66	---	---	---	---	capture	Silent	SNP	93038067	93038067	PCGF5	10	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	11480	150
OR5D13	390142	broad.mit.edu	37	11	55541269	55541269	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55541269C>T	uc010ril.1	+	1	356	c.356C>T	c.(355-357)GCG>GTG	p.A119V		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				ATGTTAGCAGCGATGGCTTAT	0.423													114	251	---	---	---	---	capture	Missense_Mutation	SNP	55541269	55541269	OR5D13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11058	150
OR5M9	390162	broad.mit.edu	37	11	56230864	56230864	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56230864G>A	uc010rjj.1	-	1	14	c.14C>T	c.(13-15)ACG>ATG	p.T5M		NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M,	5	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.T5T(1)		skin(2)|ovary(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					TGTCACATCCGTGAAATTAGG	0.408													9	20	---	---	---	---	capture	Missense_Mutation	SNP	56230864	56230864	OR5M9	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11081	150
C11orf84	144097	broad.mit.edu	37	11	63585590	63585590	+	Silent	SNP	G	A	A	rs114963373	by1000genomes	TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63585590G>A	uc001nxt.2	+	2	677	c.441G>A	c.(439-441)CCG>CCA	p.P147P		NM_138471	NP_612480	Q9BUA3	CK084_HUMAN	hypothetical protein LOC144097	147	Pro-rich.										0						CTGAGCAGCCGTCCCCACCCA	0.587													31	88	---	---	---	---	capture	Silent	SNP	63585590	63585590	C11orf84	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	1653	150
CAPN1	823	broad.mit.edu	37	11	64950650	64950650	+	Missense_Mutation	SNP	A	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64950650A>G	uc009yqd.1	+	3	430	c.319A>G	c.(319-321)ATC>GTC	p.I107V	uc001ode.2_5'Flank|CAPN1_uc001odf.1_Missense_Mutation_p.I107V|CAPN1_uc001odg.1_Missense_Mutation_p.I107V|CAPN1_uc010roa.1_Intron	NM_005186	NP_005177	P07384	CAN1_HUMAN	calpain 1, large subunit	107	Calpain catalytic.				positive regulation of cell proliferation|proteolysis	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		CCGCACAGACATCTGCCAGGG	0.602													85	194	---	---	---	---	capture	Missense_Mutation	SNP	64950650	64950650	CAPN1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	2598	150
CABP2	51475	broad.mit.edu	37	11	67287267	67287267	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67287267C>T	uc001omc.1	-	6	736	c.634G>A	c.(634-636)GAA>AAA	p.E212K	CABP2_uc001omd.1_Missense_Mutation_p.E155K|CABP2_uc001ome.1_Missense_Mutation_p.E218K	NM_016366	NP_057450	Q9NPB3	CABP2_HUMAN	calcium binding protein 2 isoform 1	212	EF-hand 4.|3 (Potential).				signal transduction	Golgi apparatus|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1						GGGGTACCTTCGAAGTCGACC	0.572													8	103	---	---	---	---	capture	Missense_Mutation	SNP	67287267	67287267	CABP2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2508	150
ALDH3B2	222	broad.mit.edu	37	11	67433035	67433035	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67433035C>T	uc001omr.2	-	7	866	c.427G>A	c.(427-429)GAC>AAC	p.D143N	ALDH3B2_uc001oms.2_Missense_Mutation_p.D143N|ALDH3B2_uc009ysa.1_Missense_Mutation_p.D143N	NM_000695	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3B2	143					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase			lung(1)|kidney(1)	2					NADH(DB00157)	GTCTGGGGGTCGCAGTTGTCG	0.637													86	176	---	---	---	---	capture	Missense_Mutation	SNP	67433035	67433035	ALDH3B2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	500	150
CLEC4D	338339	broad.mit.edu	37	12	8672917	8672917	+	Silent	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8672917G>A	uc001qun.2	+	5	673	c.480G>A	c.(478-480)ACG>ACA	p.T160T		NM_080387	NP_525126	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	160	C-type lectin.|Extracellular (Potential).				innate immune response	integral to membrane	sugar binding				0	Lung SC(5;0.184)					TGGACCAGACGCCATTTAACC	0.423													41	119	---	---	---	---	capture	Silent	SNP	8672917	8672917	CLEC4D	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3479	150
TRHDE	29953	broad.mit.edu	37	12	73015443	73015443	+	Missense_Mutation	SNP	A	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:73015443A>G	uc001sxa.2	+	15	2482	c.2452A>G	c.(2452-2454)ATA>GTA	p.I818V		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	818	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TAGAGAAGTTATAATGCTGGC	0.363													74	51	---	---	---	---	capture	Missense_Mutation	SNP	73015443	73015443	TRHDE	12	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	16362	150
CCDC60	160777	broad.mit.edu	37	12	119968731	119968731	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:119968731G>A	uc001txe.2	+	13	1879	c.1414G>A	c.(1414-1416)GCC>ACC	p.A472T	uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	472										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CTTCCGCCCCGCCAAAAAGAT	0.483													37	140	---	---	---	---	capture	Missense_Mutation	SNP	119968731	119968731	CCDC60	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2805	150
TDRD3	81550	broad.mit.edu	37	13	61103056	61103056	+	Missense_Mutation	SNP	A	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:61103056A>G	uc001via.2	+	11	2206	c.1418A>G	c.(1417-1419)AAA>AGA	p.K473R	TDRD3_uc010aef.2_Missense_Mutation_p.K298R|TDRD3_uc001vhz.3_Missense_Mutation_p.K473R|TDRD3_uc010aeg.2_Missense_Mutation_p.K566R|TDRD3_uc001vib.3_Missense_Mutation_p.K472R	NM_030794	NP_110421	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3 isoform 2	473					chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		AAAATTGAAAAACATTTTAAT	0.313													31	58	---	---	---	---	capture	Missense_Mutation	SNP	61103056	61103056	TDRD3	13	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	15617	150
COL4A2	1284	broad.mit.edu	37	13	111077144	111077144	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111077144G>A	uc001vqx.2	+	5	533	c.244G>A	c.(244-246)GGA>AGA	p.G82R		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	82					angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			AGGATTCCCGGGACTGCAGGG	0.597													36	74	---	---	---	---	capture	Missense_Mutation	SNP	111077144	111077144	COL4A2	13	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	3655	150
RNASE10	338879	broad.mit.edu	37	14	20979116	20979116	+	Silent	SNP	G	A	A	rs148975319		TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20979116G>A	uc010tlj.1	+	1	486	c.486G>A	c.(484-486)AAG>AAA	p.K162K	RNASE10_uc001vxp.2_Silent_p.K190K	NM_001012975	NP_001012993	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	162						extracellular region	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		GTGAGCTCAAGGGGGGAAAAT	0.478													27	56	---	---	---	---	capture	Silent	SNP	20979116	20979116	RNASE10	14	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	13292	150
CKMT1B	1159	broad.mit.edu	37	15	43890515	43890515	+	Missense_Mutation	SNP	T	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43890515T>G	uc001zsc.2	+	8	1393	c.1001T>G	c.(1000-1002)CTG>CGG	p.L334R	CKMT1B_uc010uds.1_Missense_Mutation_p.L365R|CKMT1B_uc010udv.1_3'UTR|CKMT1B_uc001zsd.3_Missense_Mutation_p.L334R|CKMT1B_uc010bdj.2_RNA|CKMT1B_uc010udy.1_RNA	NM_020990	NP_066270	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1B precursor	334	Phosphagen kinase C-terminal.				creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	AAACTGCCCCTGCTAAGCAAA	0.537													62	94	---	---	---	---	capture	Missense_Mutation	SNP	43890515	43890515	CKMT1B	15	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	3415	150
CACNG3	10368	broad.mit.edu	37	16	24358110	24358110	+	Silent	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24358110C>T	uc002dmf.2	+	2	1467	c.267C>T	c.(265-267)TAC>TAT	p.Y89Y		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	89					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		ATGCTGACTACGAACAGGACA	0.562													25	60	---	---	---	---	capture	Silent	SNP	24358110	24358110	CACNG3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2534	150
RPGRIP1L	23322	broad.mit.edu	37	16	53671674	53671674	+	Silent	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53671674C>T	uc002ehp.2	-	21	3217	c.3153G>A	c.(3151-3153)CAG>CAA	p.Q1051Q	RPGRIP1L_uc002eho.3_Silent_p.Q1017Q|RPGRIP1L_uc010vgy.1_Silent_p.Q1051Q|RPGRIP1L_uc010cbx.2_Silent_p.Q1017Q|RPGRIP1L_uc010vgz.1_Silent_p.Q1051Q	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	1051					negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				GTTCTGCAAGCTGACCTTCAG	0.373													81	145	---	---	---	---	capture	Silent	SNP	53671674	53671674	RPGRIP1L	16	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	13442	150
MVD	4597	broad.mit.edu	37	16	88724388	88724388	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:88724388C>T	uc002flg.1	-	3	198	c.191G>A	c.(190-192)CGG>CAG	p.R64Q	MVD_uc002flf.1_5'Flank	NM_002461	NP_002452	P53602	MVD1_HUMAN	diphosphomevalonate decarboxylase	64					cholesterol biosynthetic process|positive regulation of cell proliferation	cytosol	ATP binding|diphosphomevalonate decarboxylase activity|Hsp70 protein binding|kinase activity|protein homodimerization activity				0				BRCA - Breast invasive adenocarcinoma(80;0.0478)		CAGCCAAATCCGGTCCTCGGT	0.617													39	34	---	---	---	---	capture	Missense_Mutation	SNP	88724388	88724388	MVD	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9904	150
PER1	5187	broad.mit.edu	37	17	8053154	8053154	+	Silent	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8053154G>A	uc002gkd.2	-	5	808	c.570C>T	c.(568-570)GGC>GGT	p.G190G	PER1_uc010vuq.1_RNA|PER1_uc010vur.1_Silent_p.G174G|PER1_uc010vus.1_Silent_p.G190G	NM_002616	NP_002607	O15534	PER1_HUMAN	period 1	190					circadian rhythm|entrainment of circadian clock|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			lung(2)|breast(2)|skin(2)|large_intestine(1)|ovary(1)|kidney(1)	9						AGCAAGGCTCGCCCTCCTCCA	0.602			T	ETV6	AML|CMML			Other_conserved_DNA_damage_response_genes					11	355	---	---	---	---	capture	Silent	SNP	8053154	8053154	PER1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11632	150
MADCAM1	8174	broad.mit.edu	37	19	498515	498515	+	Silent	SNP	C	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:498515C>A	uc002los.2	+	3	367	c.357C>A	c.(355-357)ACC>ACA	p.T119T	MADCAM1_uc002lot.2_Silent_p.T119T|MADCAM1_uc010drq.2_Silent_p.T24T	NM_130760	NP_570116	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion	119	Extracellular (Potential).|Ig-like 2.				cell adhesion|immune response|regulation of immune response|signal transduction	integral to membrane|membrane fraction|plasma membrane					0		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCAGCTGACCGTCTCCCCAG	0.697													9	33	---	---	---	---	capture	Silent	SNP	498515	498515	MADCAM1	19	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	9066	150
HMHA1	23526	broad.mit.edu	37	19	1068628	1068628	+	Silent	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1068628G>A	uc002lqz.1	+	2	537	c.306G>A	c.(304-306)GAG>GAA	p.E102E	HMHA1_uc010xgd.1_Silent_p.E118E|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_5'UTR|HMHA1_uc002lrb.1_5'Flank	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	102					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGGGCGAGCTGCCCACCG	0.716													13	38	---	---	---	---	capture	Silent	SNP	1068628	1068628	HMHA1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	7165	150
PIP5K1C	23396	broad.mit.edu	37	19	3653547	3653547	+	Missense_Mutation	SNP	T	C	C			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3653547T>C	uc002lyj.1	-	7	719	c.662A>G	c.(661-663)TAT>TGT	p.Y221C	PIP5K1C_uc010xhq.1_Missense_Mutation_p.Y221C|PIP5K1C_uc010xhr.1_Missense_Mutation_p.Y221C	NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	221	PIPK.				axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		GTACAGCCCATAGAACTTGGG	0.642													22	51	---	---	---	---	capture	Missense_Mutation	SNP	3653547	3653547	PIP5K1C	19	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	11844	150
CYP4F3	4051	broad.mit.edu	37	19	15760895	15760895	+	Missense_Mutation	SNP	C	T	T	rs141338088	byFrequency	TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15760895C>T	uc002nbj.2	+	7	870	c.820C>T	c.(820-822)CGG>TGG	p.R274W	CYP4F3_uc010xok.1_Missense_Mutation_p.R274W|CYP4F3_uc010xol.1_Missense_Mutation_p.R274W|CYP4F3_uc010xom.1_Missense_Mutation_p.R125W|CYP4F3_uc002nbk.2_Missense_Mutation_p.R274W|CYP4F3_uc010xon.1_5'UTR	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	274					leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						CATCCAGGAGCGGCGCCGCAC	0.567													65	154	---	---	---	---	capture	Missense_Mutation	SNP	15760895	15760895	CYP4F3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4150	150
ZNF208	7757	broad.mit.edu	37	19	22155163	22155163	+	Nonsense_Mutation	SNP	A	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22155163A>T	uc002nqp.2	-	5	2522	c.2373T>A	c.(2371-2373)TGT>TGA	p.C791*	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CACATTCTTCACATTTGTAGG	0.378													48	122	---	---	---	---	capture	Nonsense_Mutation	SNP	22155163	22155163	ZNF208	19	A	T	T	T	1	0	0	0	0	0	1	0	0	76	6	5	4	17646	150
EML2	24139	broad.mit.edu	37	19	46127976	46127976	+	Splice_Site	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46127976C>T	uc002pcn.2	-	9	876	c.841_splice	c.e9+1	p.G281_splice	EML2_uc002pco.2_Splice_Site|EML2_uc002pcp.2_Splice_Site_p.G165_splice|EML2_uc010xxl.1_Splice_Site_p.G428_splice|EML2_uc010xxm.1_Splice_Site_p.G482_splice|EML2_uc010xxn.1_Splice_Site|EML2_uc010xxo.1_Splice_Site_p.G281_splice|EML2_uc010ekj.2_Intron|EML2_uc010ekk.1_Splice_Site	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GTGACACTGACCTTTGCCCCA	0.507													10	44	---	---	---	---	capture	Splice_Site	SNP	46127976	46127976	EML2	19	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	5052	150
SIGLEC9	27180	broad.mit.edu	37	19	51633283	51633283	+	Silent	SNP	C	A	A	rs141580830		TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51633283C>A	uc002pvu.2	+	7	1406	c.1339C>A	c.(1339-1341)CGG>AGG	p.R447R	SIGLEC9_uc010yct.1_Intron	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	447	Cytoplasmic (Potential).				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		TTGGGACTCGCGGGGACAGGA	0.602													33	99	---	---	---	---	capture	Silent	SNP	51633283	51633283	SIGLEC9	19	C	A	A	A	1	0	0	0	0	0	0	0	1	347	27	4	4	14208	150
NLRP11	204801	broad.mit.edu	37	19	56300621	56300621	+	Missense_Mutation	SNP	A	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56300621A>T	uc010ygf.1	-	10	3369	c.2658T>A	c.(2656-2658)CAT>CAA	p.H886Q	NLRP11_uc002qlz.2_Missense_Mutation_p.H733Q|NLRP11_uc002qmb.2_Missense_Mutation_p.H787Q|NLRP11_uc002qmc.2_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	886							ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TGCAGTTGGGATGTCTCAAAC	0.453													63	197	---	---	---	---	capture	Missense_Mutation	SNP	56300621	56300621	NLRP11	19	A	T	T	T	1	0	0	0	0	1	0	0	0	154	12	4	4	10380	150
HK2	3099	broad.mit.edu	37	2	75081444	75081444	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:75081444C>T	uc002snd.2	+	2	2014	c.88C>T	c.(88-90)CGC>TGC	p.R30C		NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2	30	Regulatory.	ATP 1 (By similarity).			apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						CTACCACATGCGCCTCTCTGA	0.403													45	577	---	---	---	---	capture	Missense_Mutation	SNP	75081444	75081444	HK2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7116	150
PSD4	23550	broad.mit.edu	37	2	113955141	113955141	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113955141C>T	uc002tjc.2	+	13	2570	c.2387C>T	c.(2386-2388)ACG>ATG	p.T796M	PSD4_uc002tjd.2_Missense_Mutation_p.T417M|PSD4_uc002tje.2_Missense_Mutation_p.T767M|PSD4_uc002tjf.2_Missense_Mutation_p.T417M|PSD4_uc002tjg.2_5'UTR|PSD4_uc010yxs.1_Missense_Mutation_p.A27V|PSD4_uc002tjh.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	796	PH.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						CCTGGAACAGCGCCATGGGGC	0.552													21	41	---	---	---	---	capture	Missense_Mutation	SNP	113955141	113955141	PSD4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12544	150
TMEM163	81615	broad.mit.edu	37	2	135215640	135215640	+	Missense_Mutation	SNP	C	T	T	rs145243913		TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135215640C>T	uc002ttx.2	-	7	838	c.772G>A	c.(772-774)GTT>ATT	p.V258I	TMEM163_uc002tty.2_RNA	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163	258	Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		CCGATCAGAACGCCTATGCTG	0.552													25	89	---	---	---	---	capture	Missense_Mutation	SNP	135215640	135215640	TMEM163	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15961	150
GALNT13	114805	broad.mit.edu	37	2	155102330	155102330	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:155102330C>T	uc002tyr.3	+	7	1259	c.692C>T	c.(691-693)ACG>ATG	p.T231M	GALNT13_uc002tyt.3_Missense_Mutation_p.T231M|GALNT13_uc010foc.1_Missense_Mutation_p.T50M|GALNT13_uc010fod.2_Translation_Start_Site	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	231	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						TGCAGGAAAACGGTTGTCTGC	0.323													31	130	---	---	---	---	capture	Missense_Mutation	SNP	155102330	155102330	GALNT13	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6151	150
TTN	7273	broad.mit.edu	37	2	179572434	179572434	+	Missense_Mutation	SNP	C	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179572434C>A	uc010zfg.1	-	97	25352	c.25128G>T	c.(25126-25128)AGG>AGT	p.R8376S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R5037S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9303							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCACTGGATCCTAATTGGCT	0.498													36	73	---	---	---	---	capture	Missense_Mutation	SNP	179572434	179572434	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	389	30	4	4	16617	150
PDE1A	5136	broad.mit.edu	37	2	183094871	183094871	+	Silent	SNP	A	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:183094871A>G	uc002uos.2	-	7	669	c.585T>C	c.(583-585)ATT>ATC	p.I195I	PDE1A_uc010zfp.1_Silent_p.I91I|PDE1A_uc002uoq.1_Silent_p.I195I|PDE1A_uc010zfq.1_Silent_p.I195I|PDE1A_uc002uor.2_Silent_p.I179I|PDE1A_uc002uou.2_Silent_p.I161I	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2	195	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			AAGAAACAGGAATCTGTGGAA	0.348													33	69	---	---	---	---	capture	Silent	SNP	183094871	183094871	PDE1A	2	A	G	G	G	1	0	0	0	0	0	0	0	1	112	9	3	3	11536	150
COL6A3	1293	broad.mit.edu	37	2	238277593	238277593	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238277593G>A	uc002vwl.2	-	10	4798	c.4513C>T	c.(4513-4515)CGC>TGC	p.R1505C	COL6A3_uc002vwo.2_Missense_Mutation_p.R1299C|COL6A3_uc010znj.1_Missense_Mutation_p.R898C	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1505	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGCCTCAGGCGCCGTATGGCG	0.537													31	63	---	---	---	---	capture	Missense_Mutation	SNP	238277593	238277593	COL6A3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3666	150
APCDD1L	164284	broad.mit.edu	37	20	57035877	57035877	+	Missense_Mutation	SNP	A	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:57035877A>T	uc002xze.1	-	4	1661	c.1475T>A	c.(1474-1476)GTT>GAT	p.V492D	APCDD1L_uc010zzp.1_Missense_Mutation_p.V503D	NM_153360	NP_699191	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated	492	Helical; (Potential).					integral to membrane				ovary(1)	1	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			CAGCCCTAGAACTAGGGGCAG	0.612													20	66	---	---	---	---	capture	Missense_Mutation	SNP	57035877	57035877	APCDD1L	20	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	759	150
LARGE	9215	broad.mit.edu	37	22	34046457	34046457	+	Missense_Mutation	SNP	A	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:34046457A>T	uc003and.3	-	4	883	c.304T>A	c.(304-306)TAC>AAC	p.Y102N	LARGE_uc003ane.3_Missense_Mutation_p.Y102N|LARGE_uc010gwp.2_Missense_Mutation_p.Y102N|LARGE_uc011ame.1_Missense_Mutation_p.Y34N|LARGE_uc011amf.1_Missense_Mutation_p.Y102N	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	102	Lumenal (Potential).				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				TCCATGGAGTAGGTCTTGGAG	0.667													43	91	---	---	---	---	capture	Missense_Mutation	SNP	34046457	34046457	LARGE	22	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	8547	150
RBMS3	27303	broad.mit.edu	37	3	29985717	29985717	+	Missense_Mutation	SNP	T	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:29985717T>G	uc003cel.2	+	12	1300	c.1070T>G	c.(1069-1071)ATT>AGT	p.I357S	RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Missense_Mutation_p.I339S|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793	Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting	357						cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)				CAAGACAGGATTATGATACTC	0.388													29	124	---	---	---	---	capture	Missense_Mutation	SNP	29985717	29985717	RBMS3	3	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	13045	150
ITIH1	3697	broad.mit.edu	37	3	52825916	52825916	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52825916G>A	uc003dfs.2	+	22	2749	c.2725G>A	c.(2725-2727)GAC>AAC	p.D909N	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_3'UTR|ITIH1_uc010hmo.1_Missense_Mutation_p.D463N|ITIH1_uc003dfu.2_Missense_Mutation_p.D275N|ITIH3_uc003dfv.2_5'Flank|ITIH3_uc011bek.1_5'Flank	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	909	Hyaluronan-binding.				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TATCGTCCCCGACATCTTCTG	0.607													30	71	---	---	---	---	capture	Missense_Mutation	SNP	52825916	52825916	ITIH1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7826	150
MAN2B2	23324	broad.mit.edu	37	4	6594914	6594914	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:6594914G>A	uc003gjf.1	+	6	731	c.695G>A	c.(694-696)TGG>TAG	p.W232*	MAN2B2_uc003gje.1_Nonsense_Mutation_p.W232*|MAN2B2_uc011bwf.1_Nonsense_Mutation_p.W232*	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	232					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						GGATTTTACTGGAATGGCGTG	0.353													24	45	---	---	---	---	capture	Nonsense_Mutation	SNP	6594914	6594914	MAN2B2	4	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	9131	150
OCIAD1	54940	broad.mit.edu	37	4	48853837	48853837	+	Missense_Mutation	SNP	A	C	C			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48853837A>C	uc003gyo.2	+	7	649	c.392A>C	c.(391-393)AAG>ACG	p.K131T	OCIAD1_uc011bzk.1_RNA|OCIAD1_uc003gyr.2_Missense_Mutation_p.K131T|OCIAD1_uc003gyp.2_Missense_Mutation_p.K131T|OCIAD1_uc003gys.2_Missense_Mutation_p.K131T|OCIAD1_uc003gyq.2_Missense_Mutation_p.K131T|OCIAD1_uc010igk.2_Missense_Mutation_p.K136T	NM_017830	NP_060300	Q9NX40	OCAD1_HUMAN	OCIA domain containing 1 isoform 1	131						endosome	protein binding				0						TATTATCAAAAGTCAAAATAT	0.333													8	129	---	---	---	---	capture	Missense_Mutation	SNP	48853837	48853837	OCIAD1	4	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	10722	150
C4orf35	85438	broad.mit.edu	37	4	71201726	71201726	+	Missense_Mutation	SNP	G	A	A	rs139939232		TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71201726G>A	uc003hff.2	+	1	1056	c.970G>A	c.(970-972)GTT>ATT	p.V324I		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	324						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				ATATGACTTCGTTGTCCCTGC	0.413													64	98	---	---	---	---	capture	Missense_Mutation	SNP	71201726	71201726	C4orf35	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2243	150
ENAM	10117	broad.mit.edu	37	4	71507774	71507774	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71507774C>T	uc011caw.1	+	9	912	c.631C>T	c.(631-633)CGC>TGC	p.R211C		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	211					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			CTTTGGGGGTCGCCCTCCTTA	0.398													138	241	---	---	---	---	capture	Missense_Mutation	SNP	71507774	71507774	ENAM	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5067	150
AFP	174	broad.mit.edu	37	4	74310789	74310789	+	Missense_Mutation	SNP	G	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74310789G>T	uc003hgz.1	+	7	840	c.793G>T	c.(793-795)GTA>TTA	p.V265L	AFP_uc003hha.1_Missense_Mutation_p.V265L|AFP_uc011cbg.1_Missense_Mutation_p.V39L	NM_001134	NP_001125	P02771	FETA_HUMAN	alpha-fetoprotein precursor	265	Albumin 2.				transport		metal ion binding			ovary(1)	1	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGTGGCCCATGTACATGAGCA	0.388									Alpha-Fetoprotein_Hereditary_Persistence_of				72	96	---	---	---	---	capture	Missense_Mutation	SNP	74310789	74310789	AFP	4	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	363	150
IRF2	3660	broad.mit.edu	37	4	185310216	185310216	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:185310216C>T	uc003iwf.3	-	9	946	c.746G>A	c.(745-747)CGG>CAG	p.R249Q		NM_002199	NP_002190	P14316	IRF2_HUMAN	interferon regulatory factor 2	249					blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		CCAGTGTGGCCGCCCCTTTCA	0.418													83	92	---	---	---	---	capture	Missense_Mutation	SNP	185310216	185310216	IRF2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7751	150
RAD50	10111	broad.mit.edu	37	5	131927096	131927096	+	Missense_Mutation	SNP	A	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131927096A>G	uc003kxi.2	+	10	2020	c.1633A>G	c.(1633-1635)AAA>GAA	p.K545E	RAD50_uc003kxh.2_Missense_Mutation_p.K406E	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	545	Potential.				DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GACCAAAGACAAAGTATGATT	0.378								Homologous_recombination					22	40	---	---	---	---	capture	Missense_Mutation	SNP	131927096	131927096	RAD50	5	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	12879	150
HIST1H2AA	221613	broad.mit.edu	37	6	25726546	25726546	+	Silent	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25726546C>T	uc003nfc.2	-	1	245	c.210G>A	c.(208-210)GCG>GCA	p.A70A	HIST1H2BA_uc003nfd.2_5'Flank	NM_170745	NP_734466	Q96QV6	H2A1A_HUMAN	histone cluster 1, H2aa	70					nucleosome assembly	nucleosome|nucleus	DNA binding				0						TATCGCGAGACGCATTGCCTG	0.522													47	72	---	---	---	---	capture	Silent	SNP	25726546	25726546	HIST1H2AA	6	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	7053	150
C2	717	broad.mit.edu	37	6	31901972	31901972	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31901972C>T	uc003nyf.2	+	6	1009	c.745C>T	c.(745-747)CGC>TGC	p.R249C	C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_Intron|C2_uc003nye.3_Missense_Mutation_p.R249C|C2_uc010jtk.2_Missense_Mutation_p.R117C|C2_uc011doq.1_Missense_Mutation_p.R220C|C2_uc003nyg.2_Intron|CFB_uc011dor.1_Intron|C2_uc003nyh.1_5'Flank	NM_000063	NP_000054	P06681	CO2_HUMAN	complement component 2 isoform 1 preproprotein	249				R -> S (in Ref. 7; AA sequence).	complement activation, classical pathway|innate immune response|proteolysis	extracellular space	serine-type endopeptidase activity			ovary(1)|skin(1)	2		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		CCAAATCCAGCGCTCTGGTCA	0.547													11	262	---	---	---	---	capture	Missense_Mutation	SNP	31901972	31901972	C2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2056	150
PPP2R5D	5528	broad.mit.edu	37	6	42976451	42976451	+	Silent	SNP	A	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:42976451A>G	uc003oth.2	+	10	1133	c.1047A>G	c.(1045-1047)CAA>CAG	p.Q349Q	MEA1_uc010jyc.1_Intron|PPP2R5D_uc003otg.2_Silent_p.Q317Q|PPP2R5D_uc010jyd.2_Silent_p.Q243Q|PPP2R5D_uc011dva.1_Silent_p.Q198Q|PPP2R5D_uc003oti.2_Silent_p.Q198Q|PPP2R5D_uc003otj.2_Intron	NM_006245	NP_006236	Q14738	2A5D_HUMAN	delta isoform of regulatory subunit B56, protein	349					nervous system development|signal transduction	cytoplasm|nucleus|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			breast(1)|central_nervous_system(1)	2			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GTGTGGTACAATTCCTGGAGA	0.527													23	30	---	---	---	---	capture	Silent	SNP	42976451	42976451	PPP2R5D	6	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	12296	150
SUPT3H	8464	broad.mit.edu	37	6	44988338	44988338	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44988338C>T	uc003oxo.2	-	6	569	c.251G>A	c.(250-252)CGG>CAG	p.R84Q	SUPT3H_uc003oxn.1_Missense_Mutation_p.R73Q|SUPT3H_uc011dvv.1_5'UTR|SUPT3H_uc003oxp.2_Missense_Mutation_p.R73Q|SUPT3H_uc011dvw.1_5'UTR	NM_181356	NP_852001	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog isoform 2	155					histone deubiquitination|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	STAGA complex|transcription factor TFTC complex	DNA binding|transcription coactivator activity			ovary(2)|breast(1)	3						CCTTGCTCCCCGCAGCTGAGA	0.318													57	72	---	---	---	---	capture	Missense_Mutation	SNP	44988338	44988338	SUPT3H	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15285	150
STXBP5	134957	broad.mit.edu	37	6	147631323	147631323	+	Missense_Mutation	SNP	G	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:147631323G>T	uc003qlz.2	+	10	1182	c.1021G>T	c.(1021-1023)GAC>TAC	p.D341Y	STXBP5_uc010khz.1_Missense_Mutation_p.D341Y|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.D12Y	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	341					exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		GCTAGAAATGGACTATTCAAT	0.368													45	111	---	---	---	---	capture	Missense_Mutation	SNP	147631323	147631323	STXBP5	6	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	15246	150
CDK13	8621	broad.mit.edu	37	7	40039057	40039057	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40039057G>A	uc003thh.3	+	4	2422	c.2140G>A	c.(2140-2142)GGT>AGT	p.G714S	CDK13_uc003thi.3_Missense_Mutation_p.G714S|CDK13_uc011kbf.1_Missense_Mutation_p.G100S	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	714	Protein kinase.|ATP (By similarity).				alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						TATTGGAGAAGGTACTTACGG	0.413													55	149	---	---	---	---	capture	Missense_Mutation	SNP	40039057	40039057	CDK13	7	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	3099	150
POM121L12	285877	broad.mit.edu	37	7	53104173	53104173	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53104173C>T	uc003tpz.2	+	1	825	c.809C>T	c.(808-810)GCG>GTG	p.A270V		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	270											0						TTCTGGGAGGCGACAACGCCT	0.632													31	95	---	---	---	---	capture	Missense_Mutation	SNP	53104173	53104173	POM121L12	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12143	150
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			290	627	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	150
CYP3A4	1576	broad.mit.edu	37	7	99366124	99366124	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99366124C>T	uc003urv.1	-	7	627	c.523G>A	c.(523-525)GTC>ATC	p.V175I	CYP3A4_uc003urw.1_Missense_Mutation_p.V175I|CYP3A4_uc011kiz.1_Missense_Mutation_p.V134I|CYP3A4_uc011kja.1_Missense_Mutation_p.V126I|CYP3A4_uc011kjb.1_Missense_Mutation_p.V25I	NM_017460	NP_059488	P08684	CP3A4_HUMAN	cytochrome P450, family 3, subfamily A,	175					alkaloid catabolic process|androgen metabolic process|exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid catabolic process|xenobiotic metabolic process	cell surface|endoplasmic reticulum membrane|integral to membrane|microsome	albendazole monooxygenase activity|caffeine oxidase activity|electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding|quinine 3-monooxygenase activity|steroid binding|taurochenodeoxycholate 6alpha-hydroxylase activity|testosterone 6-beta-hydroxylase activity|vitamin D 24-hydroxylase activity|vitamin D3 25-hydroxylase activity			central_nervous_system(3)|ovary(1)	4	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Albendazole(DB00518)|Alclometasone(DB00240)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Aliskiren(DB01258)|Almotriptan(DB00918)|Alosetron(DB00969)|Alprazolam(DB00404)|Amlodipine(DB00381)|Amprenavir(DB00701)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Benazepril(DB00542)|Bepridil(DB01244)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bortezomib(DB00188)|Bosentan(DB00559)|Bromocriptine(DB01200)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Buspirone(DB00490)|Busulfan(DB01008)|Carbamazepine(DB00564)|Cevimeline(DB00185)|Chlorpheniramine(DB01114)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cinacalcet(DB01012)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clindamycin(DB01190)|Clofibrate(DB00636)|Clonazepam(DB01068)|Clopidogrel(DB00758)|Cocaine(DB00907)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cyproterone(DB04839)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Delavirdine(DB00705)|Desogestrel(DB00304)|Dexamethasone(DB01234)|Diazepam(DB00829)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dofetilide(DB00204)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Doxorubicin(DB00997)|Drospirenone(DB01395)|Dutasteride(DB01126)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Epirubicin(DB00445)|Eplerenone(DB00700)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Exemestane(DB00990)|Felodipine(DB01023)|Fentanyl(DB00813)|Fexofenadine(DB00950)|Finasteride(DB01216)|Fluconazole(DB00196)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Fosamprenavir(DB01319)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Granisetron(DB00889)|Grepafloxacin(DB00365)|Halofantrine(DB01218)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Imatinib(DB00619)|Indinavir(DB00224)|Ipratropium(DB00332)|Irinotecan(DB00762)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levomethadyl Acetate(DB01227)|Levothyroxine(DB00451)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Maraviroc(DB04835)|Marinol(DB00470)|Mebendazole(DB00643)|Medroxyprogesterone(DB00603)|Methadone(DB00333)|Methylprednisolone(DB00959)|Metyrapone(DB01011)|Mibefradil(DB01388)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirtazapine(DB00370)|Modafinil(DB00745)|Mometasone(DB00764)|Montelukast(DB00471)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norgestrel(DB00506)|Nystatin(DB00646)|Ondansetron(DB00904)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paricalcitol(DB00910)|Phenmetrazine(DB00830)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prednisolone(DB00860)|Prednisone(DB00635)|Prochlorperazine(DB00433)|Quetiapine(DB01224)|Quinapril(DB00881)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranolazine(DB00243)|Reboxetine(DB00234)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampin(DB01045)|Rimonabant(DB06155)|Ritonavir(DB00503)|Rofecoxib(DB00533)|Roxithromycin(DB00778)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sertindole(DB06144)|Sibutramine(DB01105)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Terconazole(DB00251)|Terfenadine(DB00342)|Testosterone(DB00624)|Tiagabine(DB00906)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tiotropium(DB01409)|Tipranavir(DB00932)|Toremifene(DB00539)|Triazolam(DB00897)|Trimetrexate(DB01157)|Troglitazone(DB00197)|Valdecoxib(DB00580)|Vardenafil(DB00862)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Voriconazole(DB00582)|Zaleplon(DB00962)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)	GCCCCAAAGACGCTGAGTGGA	0.448													61	170	---	---	---	---	capture	Missense_Mutation	SNP	99366124	99366124	CYP3A4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4138	150
SH2B2	10603	broad.mit.edu	37	7	101943880	101943880	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:101943880G>A	uc011kko.1	+	2	220	c.175G>A	c.(175-177)GTC>ATC	p.V59I		NM_020979	NP_066189	O14492	SH2B2_HUMAN	SH2B adaptor protein 2	16					blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity				0						cccggtcccagtcccggtccc	0.473													3	12	---	---	---	---	capture	Missense_Mutation	SNP	101943880	101943880	SH2B2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	14121	150
C7orf66	154907	broad.mit.edu	37	7	108524569	108524569	+	Silent	SNP	G	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:108524569G>T	uc003vfo.2	-	1	69	c.21C>A	c.(19-21)CCC>CCA	p.P7P		NM_001024607	NP_001019778	A4D0T2	CG066_HUMAN	hypothetical protein LOC154907	7						integral to membrane				ovary(2)	2						GACCATCACTGGGTGTCATCA	0.408													11	60	---	---	---	---	capture	Silent	SNP	108524569	108524569	C7orf66	7	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	2389	150
ABP1	26	broad.mit.edu	37	7	150554147	150554147	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150554147C>T	uc003why.1	+	3	4807	c.589C>T	c.(589-591)CGC>TGC	p.R197C	ABP1_uc003whz.1_Missense_Mutation_p.R197C|ABP1_uc003wia.1_Missense_Mutation_p.R197C	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	197					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	TTCTGGCCAGCGCCGCAGTTG	0.577													38	105	---	---	---	---	capture	Missense_Mutation	SNP	150554147	150554147	ABP1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	98	150
TM7SF4	81501	broad.mit.edu	37	8	105361359	105361359	+	Silent	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105361359C>T	uc003ylx.1	+	2	628	c.579C>T	c.(577-579)GTC>GTT	p.V193V		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	193					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AAGGGGAAGTCCTGAGCGTCT	0.527													84	162	---	---	---	---	capture	Silent	SNP	105361359	105361359	TM7SF4	8	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	15861	150
MAPK15	225689	broad.mit.edu	37	8	144801639	144801639	+	Silent	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144801639G>A	uc003yzj.2	+	7	749	c.708G>A	c.(706-708)CCG>CCA	p.P236P		NM_139021	NP_620590	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	236	Protein kinase.				protein autophosphorylation	extracellular region	ATP binding|MAP kinase activity|SH3 domain binding			lung(2)	2	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CCATCCCACCGCCATCTGAGG	0.662													12	38	---	---	---	---	capture	Silent	SNP	144801639	144801639	MAPK15	8	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9190	150
ELAVL2	1993	broad.mit.edu	37	9	23701591	23701591	+	Missense_Mutation	SNP	C	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:23701591C>A	uc003zpu.2	-	5	774	c.499G>T	c.(499-501)GGT>TGT	p.G167C	ELAVL2_uc003zps.2_Missense_Mutation_p.G167C|ELAVL2_uc003zpt.2_Missense_Mutation_p.G167C|ELAVL2_uc003zpv.2_Missense_Mutation_p.G167C|ELAVL2_uc003zpw.2_Missense_Mutation_p.G167C	NM_004432	NP_004423	Q12926	ELAV2_HUMAN	ELAV (embryonic lethal, abnormal vision,	167	RRM 2.				regulation of transcription, DNA-dependent		mRNA 3'-UTR binding|nucleotide binding|protein binding	p.G167D(1)		ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		AACCCTACACCCCTTGATATG	0.443													43	49	---	---	---	---	capture	Missense_Mutation	SNP	23701591	23701591	ELAVL2	9	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	5005	150
TMEM215	401498	broad.mit.edu	37	9	32784490	32784490	+	Silent	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32784490C>T	uc003zri.3	+	2	674	c.309C>T	c.(307-309)TCC>TCT	p.S103S		NM_212558	NP_997723	Q68D42	TM215_HUMAN	transmembrane protein 215	103						integral to membrane					0						ACCTAGAATCCGGCAAGGGGA	0.602													32	88	---	---	---	---	capture	Silent	SNP	32784490	32784490	TMEM215	9	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16021	150
BSPRY	54836	broad.mit.edu	37	9	116122968	116122968	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116122968G>A	uc004bhg.3	+	3	530	c.482G>A	c.(481-483)CGC>CAC	p.R161H	BSPRY_uc010muw.2_Missense_Mutation_p.R161H	NM_017688	NP_060158	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	161					calcium ion transport	cytoplasm|membrane	zinc ion binding			breast(1)	1						GACACCATCCGCACTGGCCTG	0.602													10	10	---	---	---	---	capture	Missense_Mutation	SNP	116122968	116122968	BSPRY	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1520	150
MXRA5	25878	broad.mit.edu	37	X	3238673	3238673	+	Missense_Mutation	SNP	T	C	C			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3238673T>C	uc004crg.3	-	5	5210	c.5053A>G	c.(5053-5055)AGT>GGT	p.S1685G		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1685						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GTAAACTTACTAGGAATGCTG	0.438													205	554	---	---	---	---	capture	Missense_Mutation	SNP	3238673	3238673	MXRA5	23	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	9913	150
MAGEB1	4112	broad.mit.edu	37	X	30269312	30269312	+	Missense_Mutation	SNP	G	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30269312G>T	uc004dcc.2	+	4	1022	c.702G>T	c.(700-702)GAG>GAT	p.E234D	MAGEB1_uc004dcd.2_Missense_Mutation_p.E234D|MAGEB1_uc004dce.2_Missense_Mutation_p.E234D	NM_002363	NP_002354	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	234	MAGE.										0						ATGGAGAGGAGCACTTAATCT	0.498													26	73	---	---	---	---	capture	Missense_Mutation	SNP	30269312	30269312	MAGEB1	23	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	9086	150
FAM47A	158724	broad.mit.edu	37	X	34150178	34150178	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:34150178C>T	uc004ddg.2	-	1	251	c.218G>A	c.(217-219)CGT>CAT	p.R73H		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	73										ovary(4)|central_nervous_system(1)	5						AAACTCGTCACGGCGACAAAC	0.532													71	154	---	---	---	---	capture	Missense_Mutation	SNP	34150178	34150178	FAM47A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5517	150
ZNF674	641339	broad.mit.edu	37	X	46387797	46387797	+	Missense_Mutation	SNP	G	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:46387797G>A	uc004dgr.2	-	5	453	c.226C>T	c.(226-228)CGG>TGG	p.R76W	ZNF674_uc011mlg.1_Missense_Mutation_p.R76W|ZNF674_uc010nhm.2_Missense_Mutation_p.R76W	NM_001039891	NP_001034980	Q2M3X9	ZN674_HUMAN	zinc finger family member 674 isoform 1	76	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)	2						GCACAGGTCCGTACCGGGGTC	0.587													7	155	---	---	---	---	capture	Missense_Mutation	SNP	46387797	46387797	ZNF674	23	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	17959	150
ARHGEF9	23229	broad.mit.edu	37	X	62926262	62926262	+	Missense_Mutation	SNP	G	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:62926262G>T	uc004dvl.2	-	3	1096	c.257C>A	c.(256-258)CCC>CAC	p.P86H	ARHGEF9_uc004dvj.1_5'UTR|ARHGEF9_uc004dvk.1_5'UTR|ARHGEF9_uc011mos.1_Missense_Mutation_p.P65H|ARHGEF9_uc004dvm.1_Missense_Mutation_p.P65H|ARHGEF9_uc011mot.1_Missense_Mutation_p.P33H|ARHGEF9_uc004dvn.2_Missense_Mutation_p.P93H	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	86					apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						GTCTGAATTGGGGTCCAGGTG	0.547													5	22	---	---	---	---	capture	Missense_Mutation	SNP	62926262	62926262	ARHGEF9	23	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	905	150
THOC2	57187	broad.mit.edu	37	X	122799518	122799518	+	Missense_Mutation	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122799518C>T	uc004etu.2	-	12	1393	c.1361G>A	c.(1360-1362)CGC>CAC	p.R454H	THOC2_uc011muh.1_Missense_Mutation_p.R375H|THOC2_uc011mui.1_Missense_Mutation_p.R339H	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	454					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						CTTGCCTATGCGCACCACTTT	0.358													38	226	---	---	---	---	capture	Missense_Mutation	SNP	122799518	122799518	THOC2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15750	150
STAG2	10735	broad.mit.edu	37	X	123215351	123215351	+	Missense_Mutation	SNP	C	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123215351C>A	uc004etz.3	+	27	3236	c.2897C>A	c.(2896-2898)ACA>AAA	p.T966K	STAG2_uc004eua.2_Missense_Mutation_p.T966K|STAG2_uc004eub.2_Missense_Mutation_p.T966K|STAG2_uc004euc.2_Missense_Mutation_p.T966K|STAG2_uc004eud.2_Missense_Mutation_p.T966K|STAG2_uc004eue.2_Missense_Mutation_p.T966K	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	966					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CAGTTGAAAACAAGAGAAGCC	0.328													70	216	---	---	---	---	capture	Missense_Mutation	SNP	123215351	123215351	STAG2	23	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	15133	150
ODZ1	10178	broad.mit.edu	37	X	123870959	123870959	+	Missense_Mutation	SNP	C	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123870959C>A	uc004euj.2	-	4	688	c.624G>T	c.(622-624)AAG>AAT	p.K208N	ODZ1_uc011muj.1_Missense_Mutation_p.K208N|ODZ1_uc010nqy.2_Missense_Mutation_p.K208N	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	208	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CAGGGGGTGGCTTCCTGGCAC	0.622													69	164	---	---	---	---	capture	Missense_Mutation	SNP	123870959	123870959	ODZ1	23	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	10739	150
FLNA	2316	broad.mit.edu	37	X	153581719	153581719	+	Silent	SNP	C	T	T			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153581719C>T	uc004fkk.2	-	37	6216	c.5967G>A	c.(5965-5967)CCG>CCA	p.P1989P	FLNA_uc004fki.2_Silent_p.P32P|FLNA_uc011mzn.1_Silent_p.P122P|FLNA_uc010nuu.1_Silent_p.P1981P	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1989	Filamin 18.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCCCGAGGGCGGGACCACAG	0.627													56	126	---	---	---	---	capture	Silent	SNP	153581719	153581719	FLNA	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5877	150
F8	2157	broad.mit.edu	37	X	154185266	154185266	+	Missense_Mutation	SNP	C	A	A			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154185266C>A	uc004fmt.2	-	11	1889	c.1718G>T	c.(1717-1719)TGC>TTC	p.C573F		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	573	F5/8 type A 2.|Plastocyanin-like 3.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TTCTTTGTAGCAGATGAGGAG	0.448													106	353	---	---	---	---	capture	Missense_Mutation	SNP	154185266	154185266	F8	23	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	5304	150
BIRC8	112401	broad.mit.edu	37	19	53792992	53792993	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-2554-01	TCGA-14-2554-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53792992_53792993insG	uc002qbk.2	-	1	1883_1884	c.635_636insC	c.(634-636)CAAfs	p.Q212fs		NM_033341	NP_203127	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat-containing 8	212	RING-type.				apoptosis		zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(134;0.00304)		CTTCAGCACATTGTTTACAAGT	0.426													100	292	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	53792992	53792993	BIRC8	19	-	G	G	G	1	0	1	1	0	0	0	0	0	673	52	5	5	1428	150
