Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA1751	85452	broad.mit.edu	37	1	1888142	1888142	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1888142C>T	uc001aim.1	-	17	2089	c.1933G>A	c.(1933-1935)GTT>ATT	p.V645I	KIAA1751_uc009vkz.1_Missense_Mutation_p.V645I	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	645										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		AAGCCCCCAACGTTGGTCAGC	0.572													28	38	---	---	---	---	capture	Missense_Mutation	SNP	1888142	1888142	KIAA1751	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8178	153
KIF1B	23095	broad.mit.edu	37	1	10425498	10425498	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10425498G>A	uc001aqx.3	+	43	4746	c.4544G>A	c.(4543-4545)CGT>CAT	p.R1515H	KIF1B_uc001aqw.3_Missense_Mutation_p.R1469H|KIF1B_uc001aqy.2_Missense_Mutation_p.R1489H|KIF1B_uc001aqz.2_Missense_Mutation_p.R1515H|KIF1B_uc001ara.2_Missense_Mutation_p.R1475H|KIF1B_uc001arb.2_Missense_Mutation_p.R1501H	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1515					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TTGCTGCTGCGTGAGAGACTT	0.507													44	48	---	---	---	---	capture	Missense_Mutation	SNP	10425498	10425498	KIF1B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8206	153
CNKSR1	10256	broad.mit.edu	37	1	26507077	26507077	+	Silent	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26507077C>T	uc001bln.3	+	2	244	c.186C>T	c.(184-186)GGC>GGT	p.G62G	CNKSR1_uc010oex.1_RNA|CNKSR1_uc001blm.3_Silent_p.G62G|CNKSR1_uc009vsd.2_5'UTR|CNKSR1_uc009vse.2_5'UTR|CNKSR1_uc001blo.2_5'UTR	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	62	SAM.				Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			lung(1)|kidney(1)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		TCATCCTGGGCGGGGTGGAAC	0.657													62	77	---	---	---	---	capture	Silent	SNP	26507077	26507077	CNKSR1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3571	153
TACSTD2	4070	broad.mit.edu	37	1	59042498	59042498	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:59042498C>T	uc001cyz.3	-	1	669	c.331G>A	c.(331-333)GAG>AAG	p.E111K		NM_002353	NP_002344	P09758	TACD2_HUMAN	tumor-associated calcium signal transducer 2	111	Extracellular (Potential).|Thyroglobulin type-1.				cell proliferation|cell surface receptor linked signaling pathway|visual perception	cytosol|integral to plasma membrane	receptor activity				0	all_cancers(7;6.54e-05)					AAGCGGCCCTCGGGGTCGCAG	0.706													9	20	---	---	---	---	capture	Missense_Mutation	SNP	59042498	59042498	TACSTD2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15396	153
CCDC18	343099	broad.mit.edu	37	1	93698049	93698049	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93698049G>A	uc001dpq.2	+	18	2881	c.2713G>A	c.(2713-2715)GTT>ATT	p.V905I	CCDC18_uc009wdl.1_Missense_Mutation_p.V422I	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	786	Potential.									ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TGAGCAAAACGTTATTCTACA	0.318													74	106	---	---	---	---	capture	Missense_Mutation	SNP	93698049	93698049	CCDC18	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2768	153
NOTCH2	4853	broad.mit.edu	37	1	120510196	120510196	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120510196C>T	uc001eik.2	-	8	1569	c.1313G>A	c.(1312-1314)GGC>GAC	p.G438D	NOTCH2_uc001eil.2_Missense_Mutation_p.G438D|NOTCH2_uc001eim.3_Missense_Mutation_p.G355D	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	438	Extracellular (Potential).|EGF-like 11; calcium-binding (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGGAAGGCGCCATCCGTGTT	0.478			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				5	125	---	---	---	---	capture	Missense_Mutation	SNP	120510196	120510196	NOTCH2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10455	153
PTCHD3	374308	broad.mit.edu	37	10	27688091	27688091	+	Missense_Mutation	SNP	A	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:27688091A>T	uc001itu.2	-	4	1554	c.1436T>A	c.(1435-1437)ATG>AAG	p.M479K		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	479	SSD.				spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						GACATTGGACATCCGCTCTCG	0.403													64	16	---	---	---	---	capture	Missense_Mutation	SNP	27688091	27688091	PTCHD3	10	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	12629	153
TRIM3	10612	broad.mit.edu	37	11	6470405	6470405	+	Missense_Mutation	SNP	G	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6470405G>C	uc001mdh.2	-	13	2475	c.2088C>G	c.(2086-2088)TTC>TTG	p.F696L	TRIM3_uc001mdi.2_Missense_Mutation_p.F696L|TRIM3_uc010raj.1_Missense_Mutation_p.F577L|TRIM3_uc009yfd.2_Missense_Mutation_p.F696L	NM_006458	NP_006449	O75382	TRIM3_HUMAN	tripartite motif-containing 3	696	NHL 5.				nervous system development|protein transport	early endosome	protein C-terminus binding|zinc ion binding			central_nervous_system(2)|large_intestine(1)|ovary(1)|skin(1)	5		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGAGCTGTCGAATACCTGGG	0.562													3	92	---	---	---	---	capture	Missense_Mutation	SNP	6470405	6470405	TRIM3	11	G	C	C	C	1	0	0	0	0	1	0	0	0	477	37	4	4	16387	153
SYT9	143425	broad.mit.edu	37	11	7324279	7324279	+	Missense_Mutation	SNP	T	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7324279T>C	uc001mfe.2	+	2	392	c.155T>C	c.(154-156)GTG>GCG	p.V52A	SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_RNA	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX	52	Vesicular (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		GATATCTCAGTGAGCCTGCTG	0.537													87	114	---	---	---	---	capture	Missense_Mutation	SNP	7324279	7324279	SYT9	11	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	15369	153
ANO1	55107	broad.mit.edu	37	11	69924755	69924755	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:69924755C>T	uc001opj.2	+	1	348	c.43C>T	c.(43-45)CGC>TGC	p.R15C		NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	15	Cytoplasmic (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						GGCCGAGGACCGCAGCGTCCA	0.731													8	18	---	---	---	---	capture	Missense_Mutation	SNP	69924755	69924755	ANO1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	689	153
NOX4	50507	broad.mit.edu	37	11	89155085	89155085	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89155085G>A	uc001pct.2	-	8	853	c.614C>T	c.(613-615)ACG>ATG	p.T205M	NOX4_uc009yvr.2_Missense_Mutation_p.T180M|NOX4_uc001pcu.2_Missense_Mutation_p.T131M|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Missense_Mutation_p.T205M|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Missense_Mutation_p.T39M|NOX4_uc009yvp.2_Missense_Mutation_p.T205M|NOX4_uc010rtv.1_Missense_Mutation_p.T181M|NOX4_uc009yvq.2_Missense_Mutation_p.T181M|NOX4_uc009yvs.1_RNA	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	205	Helical; (Potential).|Ferric oxidoreductase.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AACATGCAACGTCAGCAGCAT	0.333													35	46	---	---	---	---	capture	Missense_Mutation	SNP	89155085	89155085	NOX4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10465	153
CARD16	114769	broad.mit.edu	37	11	104915384	104915384	+	Missense_Mutation	SNP	G	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:104915384G>T	uc001pip.1	-	2	36	c.9C>A	c.(7-9)GAC>GAA	p.D3E	CASP1_uc010rve.1_Intron|CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CARD16_uc001pio.1_Missense_Mutation_p.D3E	NM_001017534	NP_001017534	Q5EG05	CAR16_HUMAN	caspase-1 dominant-negative inhibitor pseudo-ICE	3	CARD.				regulation of apoptosis	intracellular	cysteine-type endopeptidase inhibitor activity			skin(1)	1						TCAGGACCTTGTCTGTTTGGA	0.408													231	289	---	---	---	---	capture	Missense_Mutation	SNP	104915384	104915384	CARD16	11	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	2623	153
OLR1	4973	broad.mit.edu	37	12	10319338	10319338	+	Missense_Mutation	SNP	T	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10319338T>A	uc001qxo.1	-	3	511	c.397A>T	c.(397-399)ACA>TCA	p.T133S	OLR1_uc010sgz.1_Missense_Mutation_p.T29S|OLR1_uc010sha.1_Missense_Mutation_p.T133S	NM_002543	NP_002534	P78380	OLR1_HUMAN	oxidized low density lipoprotein (lectin-like)	133	Extracellular (Potential).|Neck.				blood circulation|blood coagulation|inflammatory response|leukocyte migration|proteolysis	extracellular region|integral to plasma membrane|membrane fraction	sugar binding			ovary(1)	1						CTCTTCAGTGTTTCTTGGAGA	0.403													90	139	---	---	---	---	capture	Missense_Mutation	SNP	10319338	10319338	OLR1	12	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	10767	153
CSRNP2	81566	broad.mit.edu	37	12	51457947	51457947	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51457947G>A	uc001rxu.1	-	5	1512	c.1214C>T	c.(1213-1215)ACG>ATG	p.T405M		NM_030809	NP_110436	Q9H175	CSRN2_HUMAN	TGF-beta induced apoptosis protein 12	405					apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						GCTGTTCACCGTTGAGGCAGT	0.567													91	124	---	---	---	---	capture	Missense_Mutation	SNP	51457947	51457947	CSRNP2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3929	153
MYO1A	4640	broad.mit.edu	37	12	57430106	57430106	+	Missense_Mutation	SNP	G	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57430106G>T	uc001smw.3	-	22	2577	c.2334C>A	c.(2332-2334)TTC>TTA	p.F778L	MYO1A_uc010sqz.1_Missense_Mutation_p.F616L|MYO1A_uc009zpd.2_Missense_Mutation_p.F778L	NM_005379	NP_005370	Q9UBC5	MYO1A_HUMAN	myosin IA	778					sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|urinary_tract(1)	7						TCTTGTAGATGAAATCTGCCA	0.502													13	284	---	---	---	---	capture	Missense_Mutation	SNP	57430106	57430106	MYO1A	12	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	9978	153
IL22	50616	broad.mit.edu	37	12	68646552	68646552	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:68646552C>T	uc001sty.1	-	2	297	c.244G>A	c.(244-246)GGA>AGA	p.G82R	IL22_uc010stb.1_Missense_Mutation_p.G82R	NM_020525	NP_065386	Q9GZX6	IL22_HUMAN	interleukin 22 precursor	82					acute-phase response	extracellular space	cytokine activity|interleukin-22 receptor binding				0		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)		ACACTGACTCCGTGGAACAGT	0.498													55	91	---	---	---	---	capture	Missense_Mutation	SNP	68646552	68646552	IL22	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7595	153
MDM1	56890	broad.mit.edu	37	12	68719231	68719231	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:68719231G>A	uc001stz.2	-	4	759	c.623C>T	c.(622-624)GCA>GTA	p.A208V	MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_5'UTR|MDM1_uc001sua.3_3'UTR|MDM1_uc010std.1_3'UTR	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1	208						nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		CTGATTGGCTGCAAAAGCTGG	0.338													5	268	---	---	---	---	capture	Missense_Mutation	SNP	68719231	68719231	MDM1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9325	153
KCNC2	3747	broad.mit.edu	37	12	75444575	75444575	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:75444575C>T	uc001sxg.1	-	3	1754	c.1210G>A	c.(1210-1212)GAG>AAG	p.E404K	KCNC2_uc009zry.2_Missense_Mutation_p.E404K|KCNC2_uc001sxe.2_Missense_Mutation_p.E404K|KCNC2_uc001sxf.2_Missense_Mutation_p.E404K|KCNC2_uc010stw.1_Missense_Mutation_p.E404K	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	404					energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						CCCACTCTCTCGGCATAGTAG	0.448													57	89	---	---	---	---	capture	Missense_Mutation	SNP	75444575	75444575	KCNC2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7937	153
RIMBP2	23504	broad.mit.edu	37	12	130927141	130927141	+	Silent	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130927141G>A	uc001uil.2	-	8	869	c.705C>T	c.(703-705)AAC>AAT	p.N235N	RIMBP2_uc001uim.2_Silent_p.N143N|RIMBP2_uc001uin.1_Translation_Start_Site	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	235						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		ACCGCGACTCGTTGTCCTGCA	0.582													82	85	---	---	---	---	capture	Silent	SNP	130927141	130927141	RIMBP2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13255	153
EP400	57634	broad.mit.edu	37	12	132490816	132490816	+	Missense_Mutation	SNP	T	G	G			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132490816T>G	uc001ujn.2	+	13	3130	c.3095T>G	c.(3094-3096)CTG>CGG	p.L1032R	EP400_uc001ujl.2_Missense_Mutation_p.L1031R|EP400_uc001ujm.2_Missense_Mutation_p.L1032R	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1068	Interactions with RUVBL1 and RUVBL2.				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GAAGCCATCCTGCCGAAGGGC	0.542													55	71	---	---	---	---	capture	Missense_Mutation	SNP	132490816	132490816	EP400	12	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	5104	153
TSSK4	283629	broad.mit.edu	37	14	24675764	24675764	+	Missense_Mutation	SNP	T	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24675764T>C	uc001wng.2	+	2	443	c.275T>C	c.(274-276)ATT>ACT	p.I92T	TM9SF1_uc010tob.1_Intron|TSSK4_uc001wne.2_Missense_Mutation_p.I16T|TSSK4_uc001wnf.2_5'UTR|TSSK4_uc001wnh.2_Missense_Mutation_p.I92T	NM_174944	NP_777604	Q6SA08	TSSK4_HUMAN	testis-specific serine kinase 4	92	Protein kinase.				cell differentiation|multicellular organismal development|positive regulation of CREB transcription factor activity|spermatogenesis		ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity				0				GBM - Glioblastoma multiforme(265;0.018)		TATCGGGCCATTGAGAGCACA	0.532													5	177	---	---	---	---	capture	Missense_Mutation	SNP	24675764	24675764	TSSK4	14	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	16553	153
LTBP2	4053	broad.mit.edu	37	14	74969471	74969471	+	Silent	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74969471G>A	uc001xqa.2	-	34	5442	c.5055C>T	c.(5053-5055)ACC>ACT	p.T1685T		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1685					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GCTCAGGGACGGTGTCCTCGG	0.637													74	88	---	---	---	---	capture	Silent	SNP	74969471	74969471	LTBP2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8989	153
PROX2	283571	broad.mit.edu	37	14	75329549	75329549	+	Missense_Mutation	SNP	G	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75329549G>C	uc001xqr.1	-	1	989	c.989C>G	c.(988-990)GCA>GGA	p.A330G	PROX2_uc001xqq.1_Intron	NM_001080408	NP_001073877	Q3B8N5	PROX2_HUMAN	prospero homeobox 2	330					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		GGGAAAGTTTGCTGGGGGATC	0.502													81	91	---	---	---	---	capture	Missense_Mutation	SNP	75329549	75329549	PROX2	14	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	12457	153
MESDC2	23184	broad.mit.edu	37	15	81282094	81282094	+	Silent	SNP	C	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81282094C>A	uc002bfy.1	-	1	112	c.39G>T	c.(37-39)CTG>CTT	p.L13L	MESDC2_uc002bfx.2_RNA|MESDC2_uc010uno.1_RNA	NM_015154	NP_055969	Q14696	MESD_HUMAN	mesoderm development candidate 2	13	Chaperone domain (By similarity).				mesoderm development|protein folding|Wnt receptor signaling pathway	endoplasmic reticulum					0						AGGCACAAAGCAGGACCACGG	0.652													3	27	---	---	---	---	capture	Silent	SNP	81282094	81282094	MESDC2	15	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	9394	153
CPPED1	55313	broad.mit.edu	37	16	12875067	12875067	+	Silent	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:12875067G>A	uc002dca.3	-	2	375	c.264C>T	c.(262-264)TGC>TGT	p.C88C	CPPED1_uc002dcb.3_Silent_p.C88C	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain	88							hydrolase activity|metal ion binding				0						TGAGGTCGCCGCACAGAACGA	0.532													18	15	---	---	---	---	capture	Silent	SNP	12875067	12875067	CPPED1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	3787	153
CIRH1A	84916	broad.mit.edu	37	16	69201051	69201051	+	Missense_Mutation	SNP	G	A	A	rs34057086	byFrequency	TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:69201051G>A	uc002ews.3	+	16	2003	c.1907G>A	c.(1906-1908)CGC>CAC	p.R636H	CIRH1A_uc002ewr.2_3'UTR|CIRH1A_uc002ewt.3_Missense_Mutation_p.R553H|CIRH1A_uc010cfi.2_Missense_Mutation_p.R438H	NM_032830	NP_116219	Q969X6	CIR1A_HUMAN	cirhin	636						nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)		ATCCGGAGGCGCACAGCTCAT	0.348													65	95	---	---	---	---	capture	Missense_Mutation	SNP	69201051	69201051	CIRH1A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3399	153
MYH2	4620	broad.mit.edu	37	17	10430055	10430055	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10430055G>A	uc010coi.2	-	30	4176	c.4048C>T	c.(4048-4050)CGG>TGG	p.R1350W	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1350W|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1350	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TACTGTTCCCGCAGCAGGTCA	0.547													86	128	---	---	---	---	capture	Missense_Mutation	SNP	10430055	10430055	MYH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	9945	153
JMJD6	23210	broad.mit.edu	37	17	74721588	74721588	+	Missense_Mutation	SNP	A	G	G			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74721588A>G	uc002jso.2	-	2	803	c.479T>C	c.(478-480)CTT>CCT	p.L160P	JMJD6_uc002jsn.1_Missense_Mutation_p.L160P|JMJD6_uc010dgz.2_Missense_Mutation_p.L160P|C17orf95_uc002jsp.2_5'Flank|C17orf95_uc002jsq.2_5'Flank|C17orf95_uc002jsr.2_5'Flank|C17orf95_uc002jss.2_5'Flank|C17orf95_uc002jst.2_5'Flank|C17orf95_uc002jsu.2_5'Flank	NM_015167	NP_055982	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6 isoform 2	160	JmjC.				mRNA processing|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine|regulation of nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|sprouting angiogenesis|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-R2 specific)|histone demethylase activity (H4-R3 specific)|identical protein binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-lysine 5-dioxygenase activity|single-stranded RNA binding			skin(2)|ovary(1)	3						ATACTGGAAAAGGTCATCAGT	0.383													3	166	---	---	---	---	capture	Missense_Mutation	SNP	74721588	74721588	JMJD6	17	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	7876	153
PTPRM	5797	broad.mit.edu	37	18	7888281	7888281	+	Missense_Mutation	SNP	T	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7888281T>A	uc002knn.3	+	3	877	c.374T>A	c.(373-375)CTG>CAG	p.L125Q	PTPRM_uc010dkv.2_Missense_Mutation_p.L125Q	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	125	MAM.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				AACGGGCCACTGGGGAATCCT	0.453													88	121	---	---	---	---	capture	Missense_Mutation	SNP	7888281	7888281	PTPRM	18	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	12701	153
CTAGE1	64693	broad.mit.edu	37	18	19997860	19997860	+	Translation_Start_Site	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19997860G>A	uc002ktv.1	-	1	19	c.-85C>T	c.(-87--83)TACGG>TATGG			NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					AGGCTCCTCCGTAGCGCCAAG	0.587													15	18	---	---	---	---	capture	Translation_Start_Site	SNP	19997860	19997860	CTAGE1	18	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	3957	153
DCC	1630	broad.mit.edu	37	18	50734176	50734176	+	Missense_Mutation	SNP	C	G	G			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:50734176C>G	uc002lfe.1	+	11	2437	c.1850C>G	c.(1849-1851)ACA>AGA	p.T617R	DCC_uc010xdr.1_Missense_Mutation_p.T465R|DCC_uc010dpf.1_Missense_Mutation_p.T272R	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	617	Extracellular (Potential).				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ACAGTGGTTACACTTTCTGAC	0.338													126	129	---	---	---	---	capture	Missense_Mutation	SNP	50734176	50734176	DCC	18	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	4241	153
MUC16	94025	broad.mit.edu	37	19	9067947	9067947	+	Missense_Mutation	SNP	G	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9067947G>C	uc002mkp.2	-	3	19703	c.19499C>G	c.(19498-19500)ACA>AGA	p.T6500R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6502	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGGTGGGCTTGTCCCTGATAT	0.468													30	37	---	---	---	---	capture	Missense_Mutation	SNP	9067947	9067947	MUC16	19	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	9883	153
GAPDHS	26330	broad.mit.edu	37	19	36029512	36029512	+	Nonsense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36029512C>T	uc002oaf.1	+	4	492	c.376C>T	c.(376-378)CGA>TGA	p.R126*		NM_014364	NP_055179	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase,	126					gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)	CACCCACGGCCGATACAAGGG	0.522													19	24	---	---	---	---	capture	Nonsense_Mutation	SNP	36029512	36029512	GAPDHS	19	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	6177	153
NLRP5	126206	broad.mit.edu	37	19	56539808	56539808	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56539808C>T	uc002qmj.2	+	7	2209	c.2209C>T	c.(2209-2211)CGG>TGG	p.R737W	NLRP5_uc002qmi.2_Missense_Mutation_p.R718W	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	737	LRR 2.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GCGGAAAATTCGGGTGGATGT	0.498													139	177	---	---	---	---	capture	Missense_Mutation	SNP	56539808	56539808	NLRP5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	10387	153
LOXL3	84695	broad.mit.edu	37	2	74779634	74779634	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74779634C>T	uc002smp.1	-	2	200	c.128G>A	c.(127-129)CGG>CAG	p.R43Q	LOXL3_uc002smo.1_5'Flank|LOXL3_uc010ffm.1_Missense_Mutation_p.R43Q|LOXL3_uc002smq.1_Missense_Mutation_p.R43Q|LOXL3_uc010ffn.1_Missense_Mutation_p.R43Q|DOK1_uc002smr.2_Intron|DOK1_uc002sms.2_5'Flank|DOK1_uc010ffo.2_5'Flank|DOK1_uc002smt.2_5'Flank|DOK1_uc002smu.2_5'Flank|DOK1_uc010yrz.1_5'Flank|DOK1_uc002smv.2_5'Flank|DOK1_uc002smw.1_5'Flank	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	43						extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						CAGCCGGAACCGAAGCCCCTG	0.662													26	24	---	---	---	---	capture	Missense_Mutation	SNP	74779634	74779634	LOXL3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8817	153
LONRF2	164832	broad.mit.edu	37	2	100916305	100916305	+	Nonsense_Mutation	SNP	C	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:100916305C>A	uc002tal.3	-	5	1781	c.1141G>T	c.(1141-1143)GAA>TAA	p.E381*	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	381					proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						TTATCCTCTTCAAAGTGTAGA	0.413													69	63	---	---	---	---	capture	Nonsense_Mutation	SNP	100916305	100916305	LONRF2	2	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	8812	153
SLC20A1	6574	broad.mit.edu	37	2	113417335	113417335	+	Missense_Mutation	SNP	G	A	A	rs142437239		TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113417335G>A	uc002tib.2	+	8	2049	c.1603G>A	c.(1603-1605)GTA>ATA	p.V535I	SLC20A1_uc002tic.1_Missense_Mutation_p.V347I	NM_005415	NP_005406	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate	535	Extracellular (Potential).				phosphate metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to plasma membrane	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity			ovary(2)	2						TGGCAATGACGTAAGGTCAGT	0.458													5	244	---	---	---	---	capture	Missense_Mutation	SNP	113417335	113417335	SLC20A1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14331	153
LRP1B	53353	broad.mit.edu	37	2	141072536	141072536	+	Missense_Mutation	SNP	T	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141072536T>C	uc002tvj.1	-	83	13745	c.12773A>G	c.(12772-12774)CAG>CGG	p.Q4258R		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4258	Extracellular (Potential).|EGF-like 11.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCCTCCATTCTGGCAGTAGTT	0.373										TSP Lung(27;0.18)			47	68	---	---	---	---	capture	Missense_Mutation	SNP	141072536	141072536	LRP1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	8871	153
LRP1B	53353	broad.mit.edu	37	2	141072633	141072633	+	Missense_Mutation	SNP	T	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141072633T>C	uc002tvj.1	-	83	13648	c.12676A>G	c.(12676-12678)AGA>GGA	p.R4226G		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4226	Extracellular (Potential).|EGF-like 10.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAAATGCATCTTCCTCCATTT	0.343										TSP Lung(27;0.18)			48	51	---	---	---	---	capture	Missense_Mutation	SNP	141072633	141072633	LRP1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	726	56	3	3	8871	153
LRP1B	53353	broad.mit.edu	37	2	141092130	141092130	+	Splice_Site	SNP	T	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141092130T>C	uc002tvj.1	-	79	13089	c.12117_splice	c.e79-1	p.G4039_splice		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TACATCATCCTGAAGAGAGCG	0.358										TSP Lung(27;0.18)			60	82	---	---	---	---	capture	Splice_Site	SNP	141092130	141092130	LRP1B	2	T	C	C	C	1	0	0	0	0	0	0	1	0	715	55	5	3	8871	153
TMC2	117532	broad.mit.edu	37	20	2539347	2539347	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2539347C>T	uc002wgf.1	+	3	343	c.328C>T	c.(328-330)CGG>TGG	p.R110W	TMC2_uc002wgg.1_Missense_Mutation_p.R94W|TMC2_uc010zpw.1_5'UTR|TMC2_uc010zpx.1_5'UTR	NM_080751	NP_542789	Q8TDI7	TMC2_HUMAN	transmembrane cochlear-expressed protein 2	110	Arg/Asp/Glu/Lys-rich (highly charged).|Cytoplasmic (Potential).					integral to membrane				ovary(3)	3						CTTCCAGGAGCGGACAGCAGC	0.622													14	30	---	---	---	---	capture	Missense_Mutation	SNP	2539347	2539347	TMC2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15870	153
C20orf111	51526	broad.mit.edu	37	20	42826177	42826177	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42826177C>T	uc002xlk.2	-	4	531	c.394G>A	c.(394-396)GGA>AGA	p.G132R		NM_016470	NP_057554	Q9NX31	CT111_HUMAN	oxidative stress responsive 1	132											0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			GAGCTTTCTCCTGCACTGAAC	0.498													72	239	---	---	---	---	capture	Missense_Mutation	SNP	42826177	42826177	C20orf111	20	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	2062	153
PCK1	5105	broad.mit.edu	37	20	56138743	56138743	+	Silent	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56138743C>T	uc002xyn.3	+	6	1084	c.921C>T	c.(919-921)TGC>TGT	p.C307C	PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	307					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			AGGTTGAGTGCGTCGGGGATG	0.567													83	238	---	---	---	---	capture	Silent	SNP	56138743	56138743	PCK1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11484	153
C2CD2	25966	broad.mit.edu	37	21	43327136	43327136	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43327136C>T	uc002yzw.2	-	10	1525	c.1283G>A	c.(1282-1284)CGC>CAC	p.R428H	C2CD2_uc002yzt.2_Missense_Mutation_p.R44H|C2CD2_uc002yzu.2_Missense_Mutation_p.R260H|C2CD2_uc002yzv.2_Missense_Mutation_p.R273H|C2CD2_uc002yzx.1_Missense_Mutation_p.R273H	NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform	428						cytosol|extracellular region|nucleus				ovary(1)	1						CACGTCGACGCGAGGCTTGGT	0.592													43	82	---	---	---	---	capture	Missense_Mutation	SNP	43327136	43327136	C2CD2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2132	153
ABCG1	9619	broad.mit.edu	37	21	43711761	43711761	+	Silent	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43711761C>T	uc002zaq.2	+	13	1790	c.1684C>T	c.(1684-1686)CTG>TTG	p.L562L	ABCG1_uc002zan.2_Silent_p.L552L|ABCG1_uc002zam.2_Silent_p.L528L|ABCG1_uc002zao.2_Silent_p.L547L|ABCG1_uc002zap.2_Silent_p.L550L|ABCG1_uc002zar.2_Silent_p.L561L|ABCG1_uc011aev.1_Silent_p.L573L|ABCG1_uc010gpb.1_Missense_Mutation_p.P202L	NM_004915	NP_004906	P45844	ABCG1_HUMAN	ATP-binding cassette sub-family G member 1	562	ABC transmembrane type-2.|Cytoplasmic (Potential).				amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)	CTCCACGTCCCTGCAGGTGCC	0.677													12	16	---	---	---	---	capture	Silent	SNP	43711761	43711761	ABCG1	21	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	68	153
ITGB2	3689	broad.mit.edu	37	21	46320283	46320283	+	Silent	SNP	G	A	A	rs35013643	by1000genomes	TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46320283G>A	uc002zgd.2	-	6	893	c.849C>T	c.(847-849)GAC>GAT	p.D283D	ITGB2_uc002zge.2_Silent_p.D283D|ITGB2_uc002zgf.3_Silent_p.D283D|ITGB2_uc011afl.1_Silent_p.D205D|ITGB2_uc010gpw.2_Silent_p.D226D|ITGB2_uc002zgg.2_Silent_p.D283D	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	283	Extracellular (Potential).|VWFA.				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	GACAGCGGCCGTCGTTGGGGG	0.642													57	61	---	---	---	---	capture	Silent	SNP	46320283	46320283	ITGB2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7817	153
ITGB2	3689	broad.mit.edu	37	21	46320342	46320342	+	Missense_Mutation	SNP	C	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46320342C>A	uc002zgd.2	-	6	834	c.790G>T	c.(790-792)GAT>TAT	p.D264Y	ITGB2_uc002zge.2_Missense_Mutation_p.D264Y|ITGB2_uc002zgf.3_Missense_Mutation_p.D264Y|ITGB2_uc011afl.1_Missense_Mutation_p.D186Y|ITGB2_uc010gpw.2_Missense_Mutation_p.D207Y|ITGB2_uc002zgg.2_Missense_Mutation_p.D264Y	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	264	Extracellular (Potential).|VWFA.				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	AAGCCGTCATCAGTGGCAAAC	0.627													24	50	---	---	---	---	capture	Missense_Mutation	SNP	46320342	46320342	ITGB2	21	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	7817	153
INPP5J	27124	broad.mit.edu	37	22	31523945	31523945	+	Missense_Mutation	SNP	T	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31523945T>A	uc003aju.3	+	7	1888	c.1796T>A	c.(1795-1797)TTC>TAC	p.F599Y	INPP5J_uc003ajv.3_Missense_Mutation_p.F232Y|INPP5J_uc003ajs.3_Missense_Mutation_p.F232Y|INPP5J_uc011alk.1_Missense_Mutation_p.F532Y|INPP5J_uc010gwg.2_Missense_Mutation_p.F164Y|INPP5J_uc003ajw.2_Missense_Mutation_p.F35Y|INPP5J_uc003ajt.3_Missense_Mutation_p.F231Y|INPP5J_uc003ajx.2_5'UTR|INPP5J_uc003ajy.2_5'UTR|INPP5J_uc003ajz.2_5'UTR	NM_001002837	NP_001002837	Q15735	PI5PA_HUMAN	phosphatidylinositol (4,5) bisphosphate	599	Catalytic (Potential).					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						AGCCTCGTGTTCTGGTTCGGG	0.577													19	2	---	---	---	---	capture	Missense_Mutation	SNP	31523945	31523945	INPP5J	22	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	7682	153
DEPDC5	9681	broad.mit.edu	37	22	32239728	32239728	+	Nonsense_Mutation	SNP	G	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32239728G>T	uc003als.2	+	29	2846	c.2704G>T	c.(2704-2706)GAA>TAA	p.E902*	DEPDC5_uc011als.1_Nonsense_Mutation_p.E833*|DEPDC5_uc011alu.1_Nonsense_Mutation_p.E911*|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Nonsense_Mutation_p.E902*|DEPDC5_uc003alu.2_Nonsense_Mutation_p.E351*|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Nonsense_Mutation_p.E232*|DEPDC5_uc003alw.2_Nonsense_Mutation_p.E200*|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_5'Flank	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	902					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						ATTCTCCCACGAACGGCTGGA	0.498													6	81	---	---	---	---	capture	Nonsense_Mutation	SNP	32239728	32239728	DEPDC5	22	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	4400	153
CHL1	10752	broad.mit.edu	37	3	439999	439999	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:439999C>T	uc003bou.2	+	24	3407	c.3136C>T	c.(3136-3138)CGC>TGC	p.R1046C	CHL1_uc003bot.2_Missense_Mutation_p.R1062C|CHL1_uc003bow.1_Missense_Mutation_p.R1046C|CHL1_uc011asi.1_Intron	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	1046	Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		ACATATAGTTCGCCTAATGAC	0.388													32	56	---	---	---	---	capture	Missense_Mutation	SNP	439999	439999	CHL1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3314	153
NEK10	152110	broad.mit.edu	37	3	27233555	27233555	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:27233555C>T	uc010hfk.2	-	5	635	c.406G>A	c.(406-408)GTC>ATC	p.V136I	NEK10_uc003cds.1_Missense_Mutation_p.V221I|NEK10_uc010hfj.2_Missense_Mutation_p.V136I			Q6ZWH5	NEK10_HUMAN	RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;	824							ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						TGACATGTGACGGTGTTCCGG	0.438													71	64	---	---	---	---	capture	Missense_Mutation	SNP	27233555	27233555	NEK10	3	C	T	T	T	1	0	0	0	0	1	0	0	0	235	19	1	1	10229	153
SCN11A	11280	broad.mit.edu	37	3	38951639	38951639	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38951639G>A	uc011ays.1	-	8	1218	c.1019C>T	c.(1018-1020)ACG>ATG	p.T340M		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	340	I.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	p.T340T(1)		skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	GTCAAAATTCGTATAATTATA	0.358													52	70	---	---	---	---	capture	Missense_Mutation	SNP	38951639	38951639	SCN11A	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13806	153
PLSCR1	5359	broad.mit.edu	37	3	146239654	146239654	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:146239654C>T	uc003evx.3	-	6	930	c.542G>A	c.(541-543)TGT>TAT	p.C181Y	PLSCR1_uc003evy.3_Missense_Mutation_p.C174Y|PLSCR1_uc011bnn.1_Missense_Mutation_p.C100Y|PLSCR1_uc003evz.3_Intron	NM_021105	NP_066928	O15162	PLS1_HUMAN	phospholipid scramblase 1	181	Cytoplasmic.|Cys-rich.				phospholipid scrambling|platelet activation|response to virus	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding			ovary(2)	2						ACAGCTGCTACATCTTAGTGG	0.438													72	72	---	---	---	---	capture	Missense_Mutation	SNP	146239654	146239654	PLSCR1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12012	153
SI	6476	broad.mit.edu	37	3	164700076	164700076	+	Silent	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:164700076G>A	uc003fei.2	-	47	5432	c.5370C>T	c.(5368-5370)AAC>AAT	p.N1790N		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1790	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TTTTATTTCCGTTATACGTTA	0.348										HNSCC(35;0.089)			35	53	---	---	---	---	capture	Silent	SNP	164700076	164700076	SI	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14190	153
TMEM207	131920	broad.mit.edu	37	3	190147491	190147491	+	Missense_Mutation	SNP	C	G	G			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:190147491C>G	uc003fsj.2	-	5	401	c.334G>C	c.(334-336)GGA>CGA	p.G112R		NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor	112						integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		AGGTGAATTCCAACAGTTGGA	0.428													78	80	---	---	---	---	capture	Missense_Mutation	SNP	190147491	190147491	TMEM207	3	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	16015	153
CCDC158	339965	broad.mit.edu	37	4	77305567	77305567	+	Nonsense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77305567G>A	uc003hkb.3	-	5	553	c.400C>T	c.(400-402)CGA>TGA	p.R134*	CCDC158_uc003hkd.2_Nonsense_Mutation_p.R134*	NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	134	Potential.									skin(3)|ovary(2)|pancreas(1)	6						CTCTCCCTTCGTCTATGAAAT	0.313													40	60	---	---	---	---	capture	Nonsense_Mutation	SNP	77305567	77305567	CCDC158	4	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	2764	153
HEATR7B2	133558	broad.mit.edu	37	5	41051102	41051102	+	Missense_Mutation	SNP	G	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41051102G>T	uc003jmj.3	-	13	1811	c.1321C>A	c.(1321-1323)CCA>ACA	p.P441T	HEATR7B2_uc003jmi.3_5'UTR	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	441	HEAT 5.						binding			ovary(6)|central_nervous_system(2)	8						ATGACCAGTGGGTCCAGGGTT	0.408													22	21	---	---	---	---	capture	Missense_Mutation	SNP	41051102	41051102	HEATR7B2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	6961	153
SNX24	28966	broad.mit.edu	37	5	122281829	122281829	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:122281829G>A	uc011cwo.1	+	3	393	c.224G>A	c.(223-225)CGA>CAA	p.R75Q	SNX24_uc003ktf.2_Missense_Mutation_p.R75Q|SNX24_uc010jcy.2_Missense_Mutation_p.R75Q	NM_014035	NP_054754	Q9Y343	SNX24_HUMAN	SBBI31 protein	75	PX.				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		GAACAGCGACGACAAGGCTTG	0.348													37	47	---	---	---	---	capture	Missense_Mutation	SNP	122281829	122281829	SNX24	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14787	153
SLC25A2	83884	broad.mit.edu	37	5	140682773	140682773	+	Silent	SNP	T	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140682773T>C	uc003ljf.2	-	1	840	c.660A>G	c.(658-660)GGA>GGG	p.G220G		NM_031947	NP_114153	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 member 2	220	Solcar 3.|Helical; Name=5; (Potential).				mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity			ovary(1)	1		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	ACAGGCAAATTCCAGCAACTC	0.443													3	169	---	---	---	---	capture	Silent	SNP	140682773	140682773	SLC25A2	5	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	14374	153
G3BP1	10146	broad.mit.edu	37	5	151170550	151170550	+	Missense_Mutation	SNP	A	G	G			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151170550A>G	uc003lun.2	+	4	449	c.278A>G	c.(277-279)CAG>CGG	p.Q93R	G3BP1_uc010jhy.1_Missense_Mutation_p.Q93R|G3BP1_uc003lum.2_Missense_Mutation_p.Q93R|G3BP1_uc011dcu.1_5'UTR|G3BP1_uc010jhz.2_5'UTR	NM_005754	NP_005745	Q13283	G3BP1_HUMAN	Ras-GTPase-activating protein SH3-domain-binding	93	NTF2.				Ras protein signal transduction|transport	cytosol|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|endonuclease activity|protein binding|RNA binding			skin(3)|ovary(1)	4		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			GTGGTAGTCCAGGTGATGGGG	0.453													85	126	---	---	---	---	capture	Missense_Mutation	SNP	151170550	151170550	G3BP1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	6083	153
MDC1	9656	broad.mit.edu	37	6	30671524	30671524	+	Missense_Mutation	SNP	C	G	G			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30671524C>G	uc003nrg.3	-	10	5876	c.5436G>C	c.(5434-5436)AAG>AAC	p.K1812N	MDC1_uc003nrf.3_Missense_Mutation_p.K443N|MDC1_uc011dmp.1_Missense_Mutation_p.K1419N	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1812	Required for nuclear localization (NLS2).				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						CTAAAGACCTCTTGCGGCTTT	0.498								Other_conserved_DNA_damage_response_genes					141	176	---	---	---	---	capture	Missense_Mutation	SNP	30671524	30671524	MDC1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	9316	153
KIAA1586	57691	broad.mit.edu	37	6	56918065	56918065	+	Missense_Mutation	SNP	A	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56918065A>C	uc003pdj.2	+	4	938	c.768A>C	c.(766-768)TTA>TTC	p.L256F	KIAA1586_uc011dxm.1_Missense_Mutation_p.L229F	NM_020931	NP_065982	Q9HCI6	K1586_HUMAN	hypothetical protein LOC57691	256							nucleic acid binding				0	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TTTACAGTTTAGTAAAACATA	0.279													19	27	---	---	---	---	capture	Missense_Mutation	SNP	56918065	56918065	KIAA1586	6	A	C	C	C	1	0	0	0	0	1	0	0	0	193	15	4	4	8167	153
KCNQ5	56479	broad.mit.edu	37	6	73904449	73904449	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:73904449C>T	uc003pgk.2	+	14	2458	c.2111C>T	c.(2110-2112)GCG>GTG	p.A704V	KCNQ5_uc011dyh.1_Missense_Mutation_p.A723V|KCNQ5_uc011dyi.1_Missense_Mutation_p.A714V|KCNQ5_uc010kat.2_Missense_Mutation_p.A695V|KCNQ5_uc011dyj.1_Missense_Mutation_p.A594V|KCNQ5_uc011dyk.1_Missense_Mutation_p.A454V	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	704					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		ACTTTCTACGCGCTTAGCCCT	0.488													66	21	---	---	---	---	capture	Missense_Mutation	SNP	73904449	73904449	KCNQ5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8008	153
IMPG1	3617	broad.mit.edu	37	6	76751736	76751736	+	Nonsense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76751736G>A	uc003pik.1	-	2	305	c.175C>T	c.(175-177)CGA>TGA	p.R59*		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	59					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TCGAATATTCGTCTCATAGTT	0.363													99	17	---	---	---	---	capture	Nonsense_Mutation	SNP	76751736	76751736	IMPG1	6	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	7651	153
NOX3	50508	broad.mit.edu	37	6	155776184	155776184	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155776184G>A	uc003qqm.2	-	2	231	c.128C>T	c.(127-129)ACA>ATA	p.T43I		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	43	Extracellular (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		AATAACTCGTGTGTAATGGAA	0.343													29	6	---	---	---	---	capture	Missense_Mutation	SNP	155776184	155776184	NOX3	6	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	10464	153
EGFR	1956	broad.mit.edu	37	7	55238894	55238894	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55238894G>A	uc003tqk.2	+	16	2153	c.1907G>A	c.(1906-1908)TGT>TAT	p.C636Y	EGFR_uc010kzg.1_Missense_Mutation_p.C591Y|EGFR_uc011kco.1_Missense_Mutation_p.C583Y|EGFR_uc011kcp.1_RNA|EGFR_uc011kcq.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	636	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.C636Y(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CTTGAAGGCTGTCCAACGAAT	0.423		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			903	36	---	---	---	---	capture	Missense_Mutation	SNP	55238894	55238894	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4922	153
CCL24	6369	broad.mit.edu	37	7	75442963	75442963	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75442963G>A	uc011kga.1	-	1	71	c.71C>T	c.(70-72)ACG>ATG	p.T24M		NM_002991	NP_002982	O00175	CCL24_HUMAN	small inducible cytokine A24 precursor	24					cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0						GGTCTTACCCGTAGGGATGAT	0.612													75	157	---	---	---	---	capture	Missense_Mutation	SNP	75442963	75442963	CCL24	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2869	153
HGF	3082	broad.mit.edu	37	7	81331979	81331979	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81331979C>T	uc003uhl.2	-	18	2270	c.2105G>A	c.(2104-2106)CGT>CAT	p.R702H	HGF_uc003uhm.2_Missense_Mutation_p.R697H	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	702	Peptidase S1.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						AATACCAGGACGATTTGGAAT	0.403													43	99	---	---	---	---	capture	Missense_Mutation	SNP	81331979	81331979	HGF	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7010	153
ZNF804B	219578	broad.mit.edu	37	7	88963595	88963595	+	Silent	SNP	C	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:88963595C>A	uc011khi.1	+	4	1837	c.1299C>A	c.(1297-1299)ACC>ACA	p.T433T		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	433						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAGCATGTACCCATAATGTGG	0.373										HNSCC(36;0.09)			49	115	---	---	---	---	capture	Silent	SNP	88963595	88963595	ZNF804B	7	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	18047	153
COL1A2	1278	broad.mit.edu	37	7	94055328	94055328	+	Missense_Mutation	SNP	G	C	C			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94055328G>C	uc003ung.1	+	45	3433	c.2962G>C	c.(2962-2964)GGT>CGT	p.G988R	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	988					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGTCCTGTTGGTCCTGCTGG	0.478										HNSCC(75;0.22)			9	239	---	---	---	---	capture	Missense_Mutation	SNP	94055328	94055328	COL1A2	7	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	3643	153
SLC26A3	1811	broad.mit.edu	37	7	107434196	107434196	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107434196C>T	uc003ver.2	-	3	473	c.262G>A	c.(262-264)GTA>ATA	p.V88I	SLC26A3_uc003ves.2_Missense_Mutation_p.V53I	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	88	Helical; (Potential).				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						ccttGTAGTACGGCCACAATC	0.254													22	56	---	---	---	---	capture	Missense_Mutation	SNP	107434196	107434196	SLC26A3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14410	153
SPAM1	6677	broad.mit.edu	37	7	123595133	123595133	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123595133G>A	uc003vld.2	+	5	1439	c.1037G>A	c.(1036-1038)CGA>CAA	p.R346Q	SPAM1_uc003vle.2_Missense_Mutation_p.R346Q|SPAM1_uc011koa.1_Missense_Mutation_p.R2Q|SPAM1_uc003vlf.3_Missense_Mutation_p.R346Q|SPAM1_uc010lku.2_Missense_Mutation_p.R346Q	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	346					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	AGTATAATGCGAAGTATGGTA	0.294													96	207	---	---	---	---	capture	Missense_Mutation	SNP	123595133	123595133	SPAM1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14878	153
SVOPL	136306	broad.mit.edu	37	7	138310791	138310791	+	Missense_Mutation	SNP	C	T	T	rs144549446		TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138310791C>T	uc011kqh.1	-	12	1186	c.1186G>A	c.(1186-1188)GGC>AGC	p.G396S	SVOPL_uc003vue.2_Missense_Mutation_p.G244S	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1	396	Helical; (Potential).					integral to membrane	transmembrane transporter activity				0						CCAATCAGGCCGGCACTAGAA	0.507													13	50	---	---	---	---	capture	Missense_Mutation	SNP	138310791	138310791	SVOPL	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15312	153
RIMS2	9699	broad.mit.edu	37	8	105001550	105001550	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105001550G>A	uc003yls.2	+	15	2520	c.2279G>A	c.(2278-2280)GGG>GAG	p.G760E	RIMS2_uc003ylp.2_Missense_Mutation_p.G982E|RIMS2_uc003ylw.2_Missense_Mutation_p.G774E|RIMS2_uc003ylq.2_Missense_Mutation_p.G774E|RIMS2_uc003ylr.2_Missense_Mutation_p.G821E	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1044					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTGGAACAGGGGCTTCGAGGG	0.398										HNSCC(12;0.0054)			67	145	---	---	---	---	capture	Missense_Mutation	SNP	105001550	105001550	RIMS2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	13260	153
CSMD3	114788	broad.mit.edu	37	8	114290824	114290824	+	Missense_Mutation	SNP	C	T	T			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:114290824C>T	uc003ynu.2	-	3	670	c.511G>A	c.(511-513)GAA>AAA	p.E171K	CSMD3_uc003ynt.2_Missense_Mutation_p.E131K|CSMD3_uc011lhx.1_Missense_Mutation_p.E171K|CSMD3_uc010mcx.1_Missense_Mutation_p.E171K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	171	Extracellular (Potential).|CUB 1.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CACTTACCTTCGTAATATACC	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			29	25	---	---	---	---	capture	Missense_Mutation	SNP	114290824	114290824	CSMD3	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3911	153
IFNA21	3452	broad.mit.edu	37	9	21166247	21166247	+	Missense_Mutation	SNP	C	G	G			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21166247C>G	uc003zom.2	-	1	413	c.365G>C	c.(364-366)TGC>TCC	p.C122S		NM_002175	NP_002166	P01568	IFN21_HUMAN	interferon, alpha 21 precursor	122					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding			central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(5;1.93e-187)|Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CTGTATCACGCAGGCTTCCAG	0.463													175	14	---	---	---	---	capture	Missense_Mutation	SNP	21166247	21166247	IFNA21	9	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	7463	153
S1PR3	1903	broad.mit.edu	37	9	91616623	91616623	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:91616623G>A	uc004aqe.2	+	2	904	c.508G>A	c.(508-510)GCC>ACC	p.A170T		NM_005226	NP_005217	Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	170	Helical; Name=4; (By similarity).				anatomical structure morphogenesis|elevation of cytosolic calcium ion concentration|inflammatory response|positive regulation of cell proliferation	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity	p.A170A(1)		ovary(2)|lung(1)|central_nervous_system(1)|skin(1)	5						CACGCTGGGCGCCCTGCCCAT	0.557											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	61	57	---	---	---	---	capture	Missense_Mutation	SNP	91616623	91616623	S1PR3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13687	153
SURF4	6836	broad.mit.edu	37	9	136230519	136230519	+	Silent	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136230519G>A	uc004cdj.2	-	6	790	c.660C>T	c.(658-660)AAC>AAT	p.N220N	SURF4_uc011mda.1_Silent_p.N211N|SURF4_uc010nal.2_3'UTR|SURF4_uc011mdb.1_Silent_p.N177N|SURF4_uc011mdc.1_Silent_p.N177N|SURF4_uc011mdd.1_3'UTR	NM_033161	NP_149351	O15260	SURF4_HUMAN	surfeit 4	220	Helical; (Potential).					endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		TCCAGAAGGCGTTGAAATATA	0.488													46	11	---	---	---	---	capture	Silent	SNP	136230519	136230519	SURF4	9	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15293	153
LCN1	3933	broad.mit.edu	37	9	138415760	138415760	+	Silent	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138415760G>A	uc004cfz.1	+	4	385	c.327G>A	c.(325-327)TCG>TCA	p.S109S	LCN1_uc004cga.1_Silent_p.S109S	NM_002297	NP_002288	P31025	LCN1_HUMAN	lipocalin 1 precursor	109					proteolysis|response to stimulus|sensory perception of taste	extracellular region	cysteine-type endopeptidase inhibitor activity|transporter activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		TCATCAGGTCGCACGTGAAGG	0.602													3	36	---	---	---	---	capture	Silent	SNP	138415760	138415760	LCN1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8600	153
MAGEB1	4112	broad.mit.edu	37	X	30269614	30269614	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30269614G>A	uc004dcc.2	+	4	1324	c.1004G>A	c.(1003-1005)CGT>CAT	p.R335H	MAGEB1_uc004dcd.2_Missense_Mutation_p.R335H|MAGEB1_uc004dce.2_Missense_Mutation_p.R335H	NM_002363	NP_002354	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	335											0						TTTAGAGCGCGTTCTAGAGCC	0.507													57	8	---	---	---	---	capture	Missense_Mutation	SNP	30269614	30269614	MAGEB1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9086	153
GRIA3	2892	broad.mit.edu	37	X	122460032	122460032	+	Missense_Mutation	SNP	G	A	A			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122460032G>A	uc004etq.3	+	5	957	c.664G>A	c.(664-666)GAA>AAA	p.E222K	GRIA3_uc004etr.3_Missense_Mutation_p.E222K|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.E206K	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	222	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	GATTGACTGCGAAGTCGAAAG	0.423													92	6	---	---	---	---	capture	Missense_Mutation	SNP	122460032	122460032	GRIA3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6702	153
RPL11	6135	broad.mit.edu	37	1	24019182	24019185	+	Frame_Shift_Del	DEL	AGAC	-	-			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24019182_24019185delAGAC	uc001bhk.2	+	2	110_113	c.90_93delAGAC	c.(88-93)GGAGACfs	p.G30fs	RPL11_uc001bhl.2_Frame_Shift_Del_p.G29fs|RPL11_uc001bhm.2_Frame_Shift_Del_p.G19fs|RPL11_uc001bhn.1_Frame_Shift_Del_p.G19fs	NM_000975	NP_000966	P62913	RL11_HUMAN	ribosomal protein L11	30_31				D -> G (in Ref. 1; CAA55816).	endocrine pancreas development|protein localization to nucleus|protein targeting|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|rRNA binding|structural constituent of ribosome			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		GGGAGAGTGGAGACAGACTGACGC	0.544													14	410	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	24019182	24019185	RPL11	1	AGAC	-	-	-	1	0	1	0	1	0	0	0	0	132	11	5	5	13449	153
PIK3CA	5290	broad.mit.edu	37	3	178916851	178916853	+	In_Frame_Del	DEL	GAA	-	-			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916851_178916853delGAA	uc003fjk.2	+	2	395_397	c.238_240delGAA	c.(238-240)GAAdel	p.E81del		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	81	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E81K(2)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AGCAGAAAGGGAAGAATTTTTTG	0.365		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			62	91	---	---	---	---	capture_indel	In_Frame_Del	DEL	178916851	178916853	PIK3CA	3	GAA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	11816	153
CPEB2	132864	broad.mit.edu	37	4	15005738	15005739	+	In_Frame_Ins	INS	-	GCG	GCG			TCGA-15-0742-01	TCGA-15-0742-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15005738_15005739insGCG	uc003gni.1	+	1	217_218	c.130_131insGCG	c.(130-132)AGC>AGCGGC	p.50_51insG	uc003gng.3_5'Flank|uc003gnh.1_5'Flank|CPEB2_uc003gnj.1_In_Frame_Ins_p.50_51insG|CPEB2_uc003gnk.1_In_Frame_Ins_p.50_51insG|CPEB2_uc003gnl.1_In_Frame_Ins_p.50_51insG|CPEB2_uc003gnm.1_In_Frame_Ins_p.50_51insG|CPEB2_uc003gnn.1_In_Frame_Ins_p.50_51insG	NM_182485	NP_872291	Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding	50_51	Pro-rich.				regulation of translation	cytoplasm	nucleotide binding|RNA binding			skin(1)	1						CGTTCCGACGAgcggcggcggc	0.545													4	9	---	---	---	---	capture_indel	In_Frame_Ins	INS	15005738	15005739	CPEB2	4	-	GCG	GCG	GCG	1	0	1	1	0	0	0	0	0	143	11	5	5	3766	153
