Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MACF1	23499	broad.mit.edu	37	1	39761487	39761487	+	Missense_Mutation	SNP	T	G	G			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39761487T>G	uc010ois.1	+	21	2508	c.2303T>G	c.(2302-2304)TTG>TGG	p.L768W	MACF1_uc001cda.1_Missense_Mutation_p.L676W	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	768					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGTCCCAGTTGCAGTGGATG	0.433													16	49	---	---	---	---	capture	Missense_Mutation	SNP	39761487	39761487	MACF1	1	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	9059	154
C1orf163	65260	broad.mit.edu	37	1	53158443	53158443	+	Missense_Mutation	SNP	C	T	T			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53158443C>T	uc001cui.1	-	2	243	c.203G>A	c.(202-204)AGT>AAT	p.S68N		NM_023077	NP_075565	Q96BR5	SELR1_HUMAN	hypothetical protein LOC65260	68	Sel1-like 2.						binding				0						GCAGCTATCACTGTGCTGGTT	0.502													33	103	---	---	---	---	capture	Missense_Mutation	SNP	53158443	53158443	C1orf163	1	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	1993	154
ITIH2	3698	broad.mit.edu	37	10	7771922	7771922	+	Silent	SNP	A	T	T			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:7771922A>T	uc001ijs.2	+	12	1449	c.1287A>T	c.(1285-1287)CTA>CTT	p.L429L		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	429	VWFA.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						TAGGCGAACTAAAACTGTCAA	0.313													29	28	---	---	---	---	capture	Silent	SNP	7771922	7771922	ITIH2	10	A	T	T	T	1	0	0	0	0	0	0	0	1	158	13	4	4	7827	154
HEPHL1	341208	broad.mit.edu	37	11	93844970	93844970	+	Silent	SNP	G	A	A	rs118037969	by1000genomes	TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93844970G>A	uc001pep.2	+	20	3547	c.3390G>A	c.(3388-3390)ACG>ACA	p.T1130T	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	1130	Helical; (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TAATCACCACGGTGATTCTCT	0.507													10	105	---	---	---	---	capture	Silent	SNP	93844970	93844970	HEPHL1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6981	154
AMN1	196394	broad.mit.edu	37	12	31850308	31850308	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:31850308G>A	uc001rkq.3	-	5	744	c.578C>T	c.(577-579)GCG>GTG	p.A193V	AMN1_uc001rko.3_Missense_Mutation_p.A175V|AMN1_uc010skc.1_Missense_Mutation_p.A175V|AMN1_uc001rkp.3_Missense_Mutation_p.A175V|AMN1_uc009zjs.2_RNA|AMN1_uc009zjt.1_RNA	NM_001113402	NP_001106873	Q8IY45	AMN1_HUMAN	antagonist of mitotic exit network 1 homolog	193											0	all_cancers(9;7.41e-12)|all_epithelial(9;1.18e-11)|all_lung(12;1.14e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.162)		OV - Ovarian serous cystadenocarcinoma(6;0.0014)			TAATTTCTTCGCACAAGGTCC	0.338													8	47	---	---	---	---	capture	Missense_Mutation	SNP	31850308	31850308	AMN1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	581	154
MARCH9	92979	broad.mit.edu	37	12	58152585	58152585	+	Missense_Mutation	SNP	A	G	G			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58152585A>G	uc001spx.1	+	4	1358	c.946A>G	c.(946-948)ACA>GCA	p.T316A	MARCH9_uc001spy.2_Missense_Mutation_p.T203A	NM_138396	NP_612405	Q86YJ5	MARH9_HUMAN	membrane-associated RING-CH protein IX	316						Golgi membrane|Golgi stack|integral to membrane|lysosomal membrane|trans-Golgi network	ligase activity|zinc ion binding				0	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CTGCGGTTATACAATCTTGCA	0.652													11	66	---	---	---	---	capture	Missense_Mutation	SNP	58152585	58152585	MARCH9	12	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	9221	154
PMFBP1	83449	broad.mit.edu	37	16	72184633	72184633	+	Silent	SNP	C	T	T			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72184633C>T	uc002fcc.3	-	5	682	c.510G>A	c.(508-510)AAG>AAA	p.K170K	PMFBP1_uc002fcd.2_Silent_p.K170K|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Silent_p.K25K	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	170	Potential.									ovary(2)	2		Ovarian(137;0.179)				GAGAGGCGATCTTGTCCCCGG	0.498													31	93	---	---	---	---	capture	Silent	SNP	72184633	72184633	PMFBP1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	12037	154
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	A	A	rs121912651		TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577539G>A	uc002gim.2	-	7	936	c.742C>T	c.(742-744)CGG>TGG	p.R248W	TP53_uc002gig.1_Missense_Mutation_p.R248W|TP53_uc002gih.2_Missense_Mutation_p.R248W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116W|TP53_uc010cng.1_Missense_Mutation_p.R116W|TP53_uc002gii.1_Missense_Mutation_p.R116W|TP53_uc010cnh.1_Missense_Mutation_p.R248W|TP53_uc010cni.1_Missense_Mutation_p.R248W|TP53_uc002gij.2_Missense_Mutation_p.R248W|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155W|TP53_uc002gio.2_Missense_Mutation_p.R116W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(516)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATGGGCCTCCGGTTCATGCCG	0.577	R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO680N_OESOPHAGUS)|R248W(SW837_LARGE_INTESTINE)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(RD_SOFT_TISSUE)|R248W(VCAP_PROSTATE)|R248W(JIMT1_BREAST)|R248W(GCT_SOFT_TISSUE)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(786O_KIDNEY)|R248W(COLO320_LARGE_INTESTINE)|R248W(LXF289_LUNG)|R248W(LUDLU1_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(HCC2157_BREAST)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			41	37	---	---	---	---	capture	Missense_Mutation	SNP	7577539	7577539	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16264	154
BRIP1	83990	broad.mit.edu	37	17	59876469	59876469	+	Silent	SNP	G	A	A			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:59876469G>A	uc002izk.1	-	9	1473	c.1332C>T	c.(1330-1332)AGC>AGT	p.S444S		NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	444					DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						ACTTAATGAGGCTACAGCACA	0.358			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				8	41	---	---	---	---	capture	Silent	SNP	59876469	59876469	BRIP1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	1502	154
COLEC12	81035	broad.mit.edu	37	18	334801	334801	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:334801G>A	uc002kkm.2	-	6	1972	c.1757C>T	c.(1756-1758)TCA>TTA	p.S586L		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	586	Collagen-like 3.|Extracellular (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CACCGCTCCTGATGGGCCAGG	0.701													12	26	---	---	---	---	capture	Missense_Mutation	SNP	334801	334801	COLEC12	18	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	3677	154
ALK	238	broad.mit.edu	37	2	29917797	29917797	+	Missense_Mutation	SNP	G	A	A			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:29917797G>A	uc002rmy.2	-	3	1778	c.871C>T	c.(871-873)CGC>TGC	p.R291C		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	291	MAM 1.|Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	GGGATGCGGCGCCAGGACCAG	0.602			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				71	167	---	---	---	---	capture	Missense_Mutation	SNP	29917797	29917797	ALK	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	525	154
SFTPB	6439	broad.mit.edu	37	2	85892915	85892915	+	Silent	SNP	G	A	A			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85892915G>A	uc002sqh.2	-	5	402	c.396C>T	c.(394-396)GAC>GAT	p.D132D	SFTPB_uc002sqi.2_Silent_p.D144D|SFTPB_uc002sqj.2_Silent_p.D132D	NM_198843	NP_942140	P07988	PSPB_HUMAN	surfactant, pulmonary-associated protein B	132	Saposin B-type 1.				organ morphogenesis|respiratory gaseous exchange|sphingolipid metabolic process	extracellular space|lysosome				ovary(1)|central_nervous_system(1)	2						TGCCGTTTGAGTCCTGGGGCA	0.642													37	57	---	---	---	---	capture	Silent	SNP	85892915	85892915	SFTPB	2	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	14084	154
IDH1	3417	broad.mit.edu	37	2	209113113	209113113	+	Missense_Mutation	SNP	G	C	C	rs121913499		TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113113G>C	uc002vcs.2	-	4	640	c.394C>G	c.(394-396)CGT>GGT	p.R132G	IDH1_uc002vct.2_Missense_Mutation_p.R132G|IDH1_uc002vcu.2_Missense_Mutation_p.R132G	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TAAGCATGACGACCTATGATG	0.398			Mis		gliobastoma 								23	44	---	---	---	---	capture	Missense_Mutation	SNP	209113113	209113113	IDH1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	7419	154
DNAJC13	23317	broad.mit.edu	37	3	132198097	132198097	+	Silent	SNP	G	A	A	rs61748099	byFrequency;by1000genomes	TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:132198097G>A	uc003eor.2	+	25	2801	c.2736G>A	c.(2734-2736)AGG>AGA	p.R912R		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	912							heat shock protein binding			ovary(1)|breast(1)	2						AACGAGATAGGTTGATTCTCT	0.294													4	23	---	---	---	---	capture	Silent	SNP	132198097	132198097	DNAJC13	3	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	4588	154
WDR1	9948	broad.mit.edu	37	4	10080542	10080542	+	Silent	SNP	G	A	A			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:10080542G>A	uc003gmf.2	-	12	1651	c.1368C>T	c.(1366-1368)GGC>GGT	p.G456G	WDR1_uc003gmg.2_Silent_p.G316G|WDR1_uc010idm.2_RNA|hsa-mir-3138|MI0014161_5'Flank	NM_017491	NP_059830	O75083	WDR1_HUMAN	WD repeat-containing protein 1 isoform 1	456	WD 8.				platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding			ovary(2)|pancreas(1)	3				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CCGTGTCCCCGCCGGGGTGCA	0.592													17	51	---	---	---	---	capture	Silent	SNP	10080542	10080542	WDR1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17153	154
FRYL	285527	broad.mit.edu	37	4	48621289	48621289	+	Splice_Site	SNP	A	G	G			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48621289A>G	uc003gyh.1	-	7	1016	c.411_splice	c.e7+1	p.Q137_splice	FRYL_uc003gyk.2_Splice_Site_p.Q137_splice|FRYL_uc003gyl.1_Missense_Mutation_p.V189A	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						AAAAGAGCTTACCTGCTTTAG	0.363													9	41	---	---	---	---	capture	Splice_Site	SNP	48621289	48621289	FRYL	4	A	G	G	G	1	0	0	0	0	0	0	1	0	182	14	5	3	6007	154
NFKB1	4790	broad.mit.edu	37	4	103518775	103518775	+	Missense_Mutation	SNP	G	A	A	rs139575566		TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:103518775G>A	uc011ceq.1	+	15	2058	c.1591G>A	c.(1591-1593)GTC>ATC	p.V531I	NFKB1_uc011cep.1_Missense_Mutation_p.V532I|NFKB1_uc011cer.1_Missense_Mutation_p.V351I	NM_003998	NP_003989	P19838	NFKB1_HUMAN	nuclear factor kappa-B, subunit 1 isoform 1	531	Interaction with CFLAR.				anti-apoptosis|apoptosis|cellular response to mechanical stimulus|inflammatory response|innate immune response|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of calcidiol 1-monooxygenase activity|nerve growth factor receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter	cytosol|I-kappaB/NF-kappaB complex|mitochondrion|nucleoplasm	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|breast(2)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Dexamethasone(DB01234)|Pranlukast(DB01411)|Thalidomide(DB01041)	GCTGCTGGCCGTCCAGCGCCA	0.522													19	72	---	---	---	---	capture	Missense_Mutation	SNP	103518775	103518775	NFKB1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10282	154
GRINA	2907	broad.mit.edu	37	8	145065758	145065758	+	Missense_Mutation	SNP	C	G	G			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145065758C>G	uc003zan.1	+	2	533	c.367C>G	c.(367-369)CAA>GAA	p.Q123E	GRINA_uc003zao.1_Missense_Mutation_p.Q123E|GRINA_uc003zap.1_Missense_Mutation_p.Q123E	NM_001009184	NP_001009184	Q7Z429	GRINA_HUMAN	glutamate receptor, ionotropic, N-methyl	123	Pro-rich.					integral to membrane				central_nervous_system(1)	1	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTTCCCAGGACAAGACCCTGA	0.672													10	54	---	---	---	---	capture	Missense_Mutation	SNP	145065758	145065758	GRINA	8	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	6718	154
PRG4	10216	broad.mit.edu	37	1	186277611	186277614	+	Frame_Shift_Del	DEL	AGAA	-	-			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186277611_186277614delAGAA	uc001gru.3	+	7	2811_2814	c.2760_2763delAGAA	c.(2758-2763)ACAGAAfs	p.T920fs	PRG4_uc001grt.3_Frame_Shift_Del_p.T879fs|PRG4_uc009wyl.2_Frame_Shift_Del_p.T827fs|PRG4_uc009wym.2_Frame_Shift_Del_p.T786fs|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	920_921					cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACAAGACAACAGAAAGAGACTTAC	0.412													58	156	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	186277611	186277614	PRG4	1	AGAA	-	-	-	1	0	1	0	1	0	0	0	0	80	7	5	5	12377	154
CLPB	81570	broad.mit.edu	37	11	72012979	72012979	+	Frame_Shift_Del	DEL	G	-	-			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:72012979delG	uc001osj.2	-	12	1337	c.1287delC	c.(1285-1287)GGCfs	p.G429fs	CLPB_uc010rqx.1_Frame_Shift_Del_p.G384fs|CLPB_uc010rqy.1_Frame_Shift_Del_p.G370fs|CLPB_uc001osk.2_Frame_Shift_Del_p.G399fs|CLPB_uc009ytg.2_RNA|CLPB_uc010rqz.1_Frame_Shift_Del_p.G228fs|CLPB_uc001osi.2_Frame_Shift_Del_p.G37fs	NM_030813	NP_110440	Q9H078	CLPB_HUMAN	caseinolytic peptidase B	429					cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding			pancreas(1)	1						GGCCAACGTAGCCTGGTGGAG	0.522													7	242	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	72012979	72012979	CLPB	11	G	-	-	-	1	0	1	0	1	0	0	0	0	431	34	5	5	3516	154
PIK3R1	5295	broad.mit.edu	37	5	67591098	67591109	+	In_Frame_Del	DEL	ACAGCATTAAAC	-	-			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591098_67591109delACAGCATTAAAC	uc003jva.2	+	13	2251_2262	c.1691_1702delACAGCATTAAAC	c.(1690-1704)AACAGCATTAAACCA>ACA	p.564_568NSIKP>T	PIK3R1_uc003jvb.2_In_Frame_Del_p.564_568NSIKP>T|PIK3R1_uc003jvc.2_In_Frame_Del_p.264_268NSIKP>T|PIK3R1_uc003jvd.2_In_Frame_Del_p.294_298NSIKP>T|PIK3R1_uc003jve.2_In_Frame_Del_p.243_247NSIKP>T|PIK3R1_uc011crb.1_In_Frame_Del_p.234_238NSIKP>T	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	564_568					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.N564D(3)|p.D560_S565del(1)|p.N564K(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	AAACGTATGAACAGCATTAAACCAGACCTTAT	0.373			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			15	63	---	---	---	---	capture_indel	In_Frame_Del	DEL	67591098	67591109	PIK3R1	5	ACAGCATTAAAC	-	-	-	1	0	1	0	1	0	0	0	0	26	2	5	5	11821	154
TYRP1	7306	broad.mit.edu	37	9	12702411	12702414	+	Frame_Shift_Del	DEL	ACAA	-	-			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:12702411_12702414delACAA	uc003zkv.3	+	5	1232_1235	c.1054_1057delACAA	c.(1054-1059)ACAAACfs	p.T352fs		NM_000550	NP_000541	P17643	TYRP1_HUMAN	tyrosinase-related protein 1 precursor	352_353	Lumenal, melanosome (Potential).				melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity			lung(1)	1		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		TTCCAACTCTACAAACAGTTTCCG	0.387									Oculocutaneous_Albinism				9	10	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	12702411	12702414	TYRP1	9	ACAA	-	-	-	1	0	1	0	1	0	0	0	0	182	14	5	5	16698	154
ATRX	546	broad.mit.edu	37	X	76814207	76814208	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-15-1444-01	TCGA-15-1444-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76814207_76814208delTG	uc004ecp.3	-	29	6668_6669	c.6436_6437delCA	c.(6436-6438)CAGfs	p.Q2146fs	ATRX_uc004ecq.3_Frame_Shift_Del_p.Q2108fs|ATRX_uc004eco.3_Frame_Shift_Del_p.Q1931fs	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	2146	Helicase C-terminal.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	GAATATACTCTGGATGTCATAA	0.337			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						11	21	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	76814207	76814208	ATRX	23	TG	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	1199	154
