Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DNAJC6	9829	broad.mit.edu	37	1	65845142	65845142	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:65845142G>A	uc001dcd.1	+	5	594	c.430G>A	c.(430-432)GTG>ATG	p.V144M	DNAJC6_uc001dcc.1_Missense_Mutation_p.V175M|DNAJC6_uc010opc.1_Missense_Mutation_p.V131M|DNAJC6_uc001dce.1_Missense_Mutation_p.V201M	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	144	Phosphatase tensin-type.				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						CCTTTTTGCTGTGTGTCGGAA	0.458													111	157	---	---	---	---	capture	Missense_Mutation	SNP	65845142	65845142	DNAJC6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4609	156
VAV3	10451	broad.mit.edu	37	1	108417540	108417540	+	Missense_Mutation	SNP	C	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:108417540C>A	uc001dvk.1	-	2	358	c.304G>T	c.(304-306)GTT>TTT	p.V102F	VAV3_uc010ouw.1_Missense_Mutation_p.V102F|VAV3_uc001dvl.1_5'UTR|VAV3_uc010oux.1_Missense_Mutation_p.V102F	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	102	CH.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		AAGTCACGAACATCAAACAAG	0.358													35	66	---	---	---	---	capture	Missense_Mutation	SNP	108417540	108417540	VAV3	1	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	17015	156
FLG	2312	broad.mit.edu	37	1	152284952	152284952	+	Nonsense_Mutation	SNP	C	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152284952C>A	uc001ezu.1	-	3	2446	c.2410G>T	c.(2410-2412)GAG>TAG	p.E804*	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	804	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGGAGGACTCAGACTGTTTA	0.572									Ichthyosis				210	290	---	---	---	---	capture	Nonsense_Mutation	SNP	152284952	152284952	FLG	1	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	5867	156
CD1E	913	broad.mit.edu	37	1	158323687	158323687	+	Translation_Start_Site	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158323687C>T	uc001fse.2	+	1	148	c.-91C>T	c.(-93--89)GACGA>GATGA		CD1E_uc010pid.1_Intron|CD1E_uc010pie.1_Translation_Start_Site|CD1E_uc010pif.1_Translation_Start_Site|CD1E_uc001fsd.2_Translation_Start_Site|CD1E_uc001fsk.2_Translation_Start_Site|CD1E_uc001fsj.2_Translation_Start_Site|CD1E_uc001fsc.2_Translation_Start_Site|CD1E_uc010pig.1_RNA|CD1E_uc001fsa.2_Translation_Start_Site|CD1E_uc001fsf.2_Translation_Start_Site|CD1E_uc001fry.2_Translation_Start_Site|CD1E_uc001fsg.2_Translation_Start_Site|CD1E_uc001fsh.2_Translation_Start_Site|CD1E_uc001fsi.2_Translation_Start_Site|CD1E_uc009wsv.2_Translation_Start_Site|CD1E_uc001frz.2_Translation_Start_Site|CD1E_uc009wsw.2_5'Flank	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor						antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					GGAAGTCAGACGAGAGTGCAA	0.542													15	19	---	---	---	---	capture	Translation_Start_Site	SNP	158323687	158323687	CD1E	1	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	2949	156
BTRC	8945	broad.mit.edu	37	10	103281492	103281492	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103281492T>G	uc001kta.2	+	5	534	c.421T>G	c.(421-423)TTT>GTT	p.F141V	BTRC_uc001ktb.2_Missense_Mutation_p.F105V|BTRC_uc001ktc.2_Missense_Mutation_p.F115V	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing protein	141	Homodimerization domain D.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		TGTCAAATACTTTGAGCAGTG	0.413													56	10	---	---	---	---	capture	Missense_Mutation	SNP	103281492	103281492	BTRC	10	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	1557	156
PITX3	5309	broad.mit.edu	37	10	103990780	103990780	+	Missense_Mutation	SNP	C	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103990780C>A	uc001kuu.1	-	4	554	c.400G>T	c.(400-402)GCG>TCG	p.A134S		NM_005029	NP_005020	O75364	PITX3_HUMAN	paired-like homeodomain 3	134					dopaminergic neuron differentiation|lens morphogenesis in camera-type eye|midbrain development|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		AGCGGCGCCGCGAAGCTGCCT	0.711													6	0	---	---	---	---	capture	Missense_Mutation	SNP	103990780	103990780	PITX3	10	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	11859	156
C11orf30	56946	broad.mit.edu	37	11	76164415	76164415	+	Missense_Mutation	SNP	A	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76164415A>C	uc001oxl.2	+	4	371	c.228A>C	c.(226-228)TTA>TTC	p.L76F	C11orf30_uc001oxj.2_Missense_Mutation_p.L76F|C11orf30_uc001oxk.2_Missense_Mutation_p.L76F|C11orf30_uc009yuj.1_Missense_Mutation_p.L76F|C11orf30_uc010rsa.1_Missense_Mutation_p.L76F|C11orf30_uc001oxm.2_Missense_Mutation_p.L76F|C11orf30_uc010rsb.1_Missense_Mutation_p.L76F|C11orf30_uc010rsc.1_Missense_Mutation_p.L76F|C11orf30_uc001oxn.2_Missense_Mutation_p.L76F|C11orf30_uc010rsd.1_Missense_Mutation_p.L76F	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	76	Interaction with BRCA2.|ENT.				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						ATGAACGGTTAACAACAATTG	0.403													22	24	---	---	---	---	capture	Missense_Mutation	SNP	76164415	76164415	C11orf30	11	A	C	C	C	1	0	0	0	0	1	0	0	0	167	13	4	4	1622	156
ELMOD1	55531	broad.mit.edu	37	11	107518220	107518220	+	Silent	SNP	T	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:107518220T>A	uc010rvs.1	+	7	851	c.447T>A	c.(445-447)ACT>ACA	p.T149T	ELMOD1_uc001pjm.2_Silent_p.T149T|ELMOD1_uc010rvt.1_Silent_p.T143T	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1	149	ELMO.				phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		AGCCCAATACTCCACTGGAAT	0.383													17	72	---	---	---	---	capture	Silent	SNP	107518220	107518220	ELMOD1	11	T	A	A	A	1	0	0	0	0	0	0	0	1	691	54	4	4	5023	156
WNK1	65125	broad.mit.edu	37	12	998382	998382	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:998382C>T	uc001qio.3	+	21	5948	c.5441C>T	c.(5440-5442)GCG>GTG	p.A1814V	WNK1_uc001qip.3_Missense_Mutation_p.A1567V|WNK1_uc001qir.3_Missense_Mutation_p.A987V	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1814					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GTGACTTCTGCGGTTGGTGTA	0.368													55	125	---	---	---	---	capture	Missense_Mutation	SNP	998382	998382	WNK1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17258	156
RERG	85004	broad.mit.edu	37	12	15262109	15262109	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:15262109G>A	uc001rcs.2	-	4	675	c.535C>T	c.(535-537)CGA>TGA	p.R179*	RERG_uc001rct.2_Nonsense_Mutation_p.R179*|RERG_uc010shu.1_Nonsense_Mutation_p.R160*	NM_032918	NP_116307	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	179					negative regulation of cell growth|negative regulation of cell proliferation|response to hormone stimulus|small GTPase mediated signal transduction	cytosol|membrane|nucleus	estrogen receptor binding|GDP binding|GTP binding|GTPase activity			lung(1)	1						GAGCTGCGTCGCCTCGTCTTG	0.532													65	28	---	---	---	---	capture	Nonsense_Mutation	SNP	15262109	15262109	RERG	12	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	13127	156
AVPR1A	552	broad.mit.edu	37	12	63543857	63543857	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:63543857G>A	uc001sro.1	-	1	2734	c.760C>T	c.(760-762)CGC>TGC	p.R254C		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	254	Cytoplasmic (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	TTGCTCTGGCGCGACGCCGTC	0.617													114	146	---	---	---	---	capture	Missense_Mutation	SNP	63543857	63543857	AVPR1A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1221	156
SYT1	6857	broad.mit.edu	37	12	79693293	79693293	+	Nonsense_Mutation	SNP	G	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:79693293G>T	uc001sys.2	+	9	1443	c.772G>T	c.(772-774)GAG>TAG	p.E258*	SYT1_uc001syt.2_Nonsense_Mutation_p.E258*|SYT1_uc001syu.2_Nonsense_Mutation_p.E255*|SYT1_uc001syv.2_Nonsense_Mutation_p.E258*	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I	258	Cytoplasmic (Potential).|Phospholipid binding (Probable).				detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						CCATGTAACTGAGGAATGGCG	0.418													76	111	---	---	---	---	capture	Nonsense_Mutation	SNP	79693293	79693293	SYT1	12	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	15353	156
KSR2	283455	broad.mit.edu	37	12	118198971	118198971	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118198971C>T	uc001two.2	-	4	799	c.744G>A	c.(742-744)CCG>CCA	p.P248P		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	277	Pro-rich.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCCTCATGGGCGGCGTGCCCG	0.701													130	179	---	---	---	---	capture	Silent	SNP	118198971	118198971	KSR2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8502	156
ZNF268	10795	broad.mit.edu	37	12	133780200	133780200	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133780200A>G	uc010tcf.1	+	6	2258	c.1928A>G	c.(1927-1929)AAT>AGT	p.N643S	ZNF268_uc010tbv.1_Missense_Mutation_p.N482S|ZNF268_uc010tbw.1_Missense_Mutation_p.N482S|ZNF268_uc010tbx.1_Missense_Mutation_p.N503S|ZNF268_uc010tby.1_Missense_Mutation_p.N482S|ZNF268_uc010tbz.1_Missense_Mutation_p.N482S|ZNF268_uc010tca.1_Missense_Mutation_p.N482S|ZNF268_uc010tcb.1_Missense_Mutation_p.N503S|ZNF268_uc010tcc.1_Missense_Mutation_p.N482S|ZNF268_uc010tcd.1_Missense_Mutation_p.N482S|ZNF268_uc010tce.1_Missense_Mutation_p.N482S|ZNF268_uc010tcg.1_Missense_Mutation_p.N482S|ZNF268_uc010tch.1_Missense_Mutation_p.N643S	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a	643	C2H2-type 14.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TATAGTTGTAATGAATGTGGA	0.383													3	4	---	---	---	---	capture	Missense_Mutation	SNP	133780200	133780200	ZNF268	12	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	17687	156
MTUS2	23281	broad.mit.edu	37	13	29675102	29675102	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:29675102C>T	uc001usl.3	+	3	2727	c.2669C>T	c.(2668-2670)GCC>GTC	p.A890V		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	880	Sufficient for interaction with KIF2C.|Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						GGCCGGCCAGCCACCCGTAAG	0.582													3	1	---	---	---	---	capture	Missense_Mutation	SNP	29675102	29675102	MTUS2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9876	156
PDS5B	23047	broad.mit.edu	37	13	33327545	33327545	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:33327545G>C	uc010abf.2	+	25	2970	c.2812G>C	c.(2812-2814)GAG>CAG	p.E938Q	PDS5B_uc010abg.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	938					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GCTTCCACTTGAGTATATGGC	0.413													67	94	---	---	---	---	capture	Missense_Mutation	SNP	33327545	33327545	PDS5B	13	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	11595	156
GPR180	160897	broad.mit.edu	37	13	95275364	95275364	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:95275364G>C	uc001vly.2	+	7	974	c.896G>C	c.(895-897)AGT>ACT	p.S299T	GPR180_uc001vlz.2_Missense_Mutation_p.S198T|GPR180_uc010afi.2_Missense_Mutation_p.S60T	NM_180989	NP_851320	Q86V85	GP180_HUMAN	G protein-coupled receptor 180 precursor	299	Helical; (Potential).					integral to membrane				breast(1)	1	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CTTTTGCAGAGTGTTTTGCTA	0.299													6	227	---	---	---	---	capture	Missense_Mutation	SNP	95275364	95275364	GPR180	13	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	6610	156
GZMB	3002	broad.mit.edu	37	14	25101153	25101153	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:25101153G>A	uc001wps.2	-	4	577	c.511C>T	c.(511-513)CGA>TGA	p.R171*	GZMB_uc010ama.2_Nonsense_Mutation_p.R159*|GZMB_uc010amb.2_RNA	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor	171	Peptidase S1.				activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.028)		TCGCACTTTCGATCTTCCTGC	0.517													97	55	---	---	---	---	capture	Nonsense_Mutation	SNP	25101153	25101153	GZMB	14	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	6845	156
NIN	51199	broad.mit.edu	37	14	51239167	51239167	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:51239167C>T	uc001wym.2	-	9	1024	c.833G>A	c.(832-834)CGA>CAA	p.R278Q	NIN_uc001wyi.2_Missense_Mutation_p.R278Q|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.R278Q|NIN_uc010tqp.1_Missense_Mutation_p.R284Q|NIN_uc001wyo.2_Missense_Mutation_p.R278Q|NIN_uc001wyp.1_Missense_Mutation_p.R240Q	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	278					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					TGTGGTACGTCGTCCACTCTC	0.498			T	PDGFRB	MPD								27	19	---	---	---	---	capture	Missense_Mutation	SNP	51239167	51239167	NIN	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10324	156
SMEK1	55671	broad.mit.edu	37	14	91948148	91948148	+	Silent	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:91948148A>G	uc001xzn.2	-	4	1509	c.687T>C	c.(685-687)GCT>GCC	p.A229A	SMEK1_uc001xzm.2_Silent_p.A229A|SMEK1_uc001xzo.2_Silent_p.A229A|SMEK1_uc010atz.2_Intron|SMEK1_uc001xzp.1_RNA|SMEK1_uc001xzq.1_Silent_p.A105A	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1	229						microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		GTTGTGATAAAGCAGGATCAT	0.353													77	22	---	---	---	---	capture	Silent	SNP	91948148	91948148	SMEK1	14	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	14685	156
C15orf2	23742	broad.mit.edu	37	15	24921847	24921847	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24921847C>T	uc001ywo.2	+	1	1307	c.833C>T	c.(832-834)GCG>GTG	p.A278V		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	278					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		AAGTTGGCTGCGGAAGTGCTG	0.602													39	60	---	---	---	---	capture	Missense_Mutation	SNP	24921847	24921847	C15orf2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1770	156
MAPKBP1	23005	broad.mit.edu	37	15	42109162	42109162	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42109162C>T	uc001zok.3	+	15	1944	c.1658C>T	c.(1657-1659)GCC>GTC	p.A553V	MAPKBP1_uc001zoj.3_Missense_Mutation_p.A547V|MAPKBP1_uc010bcj.2_Missense_Mutation_p.A54V|MAPKBP1_uc010bci.2_Missense_Mutation_p.A547V|MAPKBP1_uc010udb.1_Missense_Mutation_p.A386V|MAPKBP1_uc010bck.2_5'UTR|MAPKBP1_uc010bcl.2_Missense_Mutation_p.A54V	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein	553	WD 8.									central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GTGCTGGATGCCGGGCGGGAG	0.582													5	146	---	---	---	---	capture	Missense_Mutation	SNP	42109162	42109162	MAPKBP1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9205	156
TLN2	83660	broad.mit.edu	37	15	63127965	63127965	+	Silent	SNP	C	T	T	rs139730009		TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63127965C>T	uc002alb.3	+	53	7158	c.7158C>T	c.(7156-7158)GAC>GAT	p.D2386D	TLN2_uc002alc.3_Silent_p.D779D|TLN2_uc010uic.1_Translation_Start_Site|uc002ale.1_5'Flank	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	2386	I/LWEQ.				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						ATGCTGCAGACGACGGACAGT	0.597													74	128	---	---	---	---	capture	Silent	SNP	63127965	63127965	TLN2	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15833	156
SV2B	9899	broad.mit.edu	37	15	91811770	91811770	+	Silent	SNP	C	T	T	rs140230861		TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91811770C>T	uc002bqv.2	+	8	1699	c.1308C>T	c.(1306-1308)TAC>TAT	p.Y436Y	SV2B_uc002bqt.2_Silent_p.Y436Y|SV2B_uc010uqv.1_Silent_p.Y285Y|SV2B_uc002bqu.3_RNA	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog	436	Extracellular (Potential).				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			AGCATGTGTACGGCGCCACAA	0.418													95	104	---	---	---	---	capture	Silent	SNP	91811770	91811770	SV2B	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15306	156
CREBBP	1387	broad.mit.edu	37	16	3820625	3820625	+	Silent	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3820625A>G	uc002cvv.2	-	14	3030	c.2826T>C	c.(2824-2826)CCT>CCC	p.P942P	CREBBP_uc002cvw.2_Silent_p.P904P	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	942					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GCGATGACTGAGGGGTAGCCA	0.627			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				8	115	---	---	---	---	capture	Silent	SNP	3820625	3820625	CREBBP	16	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	3826	156
ATXN2L	11273	broad.mit.edu	37	16	28844550	28844550	+	Silent	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28844550A>T	uc002drc.2	+	14	1998	c.1830A>T	c.(1828-1830)CCA>CCT	p.P610P	uc010vct.1_Intron|ATXN2L_uc010byl.1_Silent_p.P586P|ATXN2L_uc002drb.2_Silent_p.P610P|ATXN2L_uc002dqy.2_Silent_p.P610P|ATXN2L_uc002dra.2_Silent_p.P610P|ATXN2L_uc002dqz.2_Silent_p.P610P|ATXN2L_uc010vdb.1_Silent_p.P616P|ATXN2L_uc002dre.2_Silent_p.P610P|ATXN2L_uc002drf.2_Silent_p.P19P|ATXN2L_uc002drg.2_5'Flank	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	610						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AGGACAAACCACCCCTGGCAC	0.592													53	94	---	---	---	---	capture	Silent	SNP	28844550	28844550	ATXN2L	16	A	T	T	T	1	0	0	0	0	0	0	0	1	67	6	4	4	1203	156
CCDC135	84229	broad.mit.edu	37	16	57741548	57741548	+	Silent	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57741548G>A	uc002emi.2	+	7	1124	c.1035G>A	c.(1033-1035)AAG>AAA	p.K345K	CCDC135_uc002emj.2_Silent_p.K345K|CCDC135_uc002emk.2_Silent_p.K280K	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	345						cytoplasm				central_nervous_system(1)	1						GGAACCACAAGAACTACTGGA	0.552													20	38	---	---	---	---	capture	Silent	SNP	57741548	57741548	CCDC135	16	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	2743	156
GUCY2D	3000	broad.mit.edu	37	17	7909994	7909994	+	Missense_Mutation	SNP	C	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7909994C>G	uc002gjt.2	+	4	1414	c.1340C>G	c.(1339-1341)CCC>CGC	p.P447R		NM_000180	NP_000171	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	447	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			skin(1)	1		Prostate(122;0.157)				GGACCTGACCCCTCGTGCTGG	0.612													14	16	---	---	---	---	capture	Missense_Mutation	SNP	7909994	7909994	GUCY2D	17	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	6826	156
HS3ST3A1	9955	broad.mit.edu	37	17	13400013	13400013	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:13400013A>G	uc002gob.1	-	2	1520	c.722T>C	c.(721-723)GTG>GCG	p.V241A		NM_006042	NP_006033	Q9Y663	HS3SA_HUMAN	heparan sulfate D-glucosaminyl	241	Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity			ovary(1)|central_nervous_system(1)	2		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTCCCGCACCACCACGATGAG	0.632													27	133	---	---	---	---	capture	Missense_Mutation	SNP	13400013	13400013	HS3ST3A1	17	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	7290	156
MRC2	9902	broad.mit.edu	37	17	60757258	60757258	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60757258G>A	uc002jad.2	+	14	2695	c.2293G>A	c.(2293-2295)GTA>ATA	p.V765I	MRC2_uc010ddq.1_RNA|MRC2_uc002jae.2_5'Flank|MRC2_uc002jaf.2_5'Flank	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	765	Extracellular (Potential).|C-type lectin 4.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GAGCGACGGCGTAGGGGTGAG	0.662													23	25	---	---	---	---	capture	Missense_Mutation	SNP	60757258	60757258	MRC2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9668	156
ARHGAP28	79822	broad.mit.edu	37	18	6894892	6894892	+	Splice_Site	SNP	T	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6894892T>C	uc010wzi.1	+	14	1612	c.1374_splice	c.e14+2	p.M458_splice	ARHGAP28_uc002knc.2_Splice_Site_p.M583_splice|ARHGAP28_uc002knd.2_Splice_Site_p.M476_splice|ARHGAP28_uc002kne.2_Splice_Site_p.M476_splice|ARHGAP28_uc002knf.2_Splice_Site_p.M467_splice			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				AGACGAATGGTAAGAAAAATA	0.289													52	60	---	---	---	---	capture	Splice_Site	SNP	6894892	6894892	ARHGAP28	18	T	C	C	C	1	0	0	0	0	0	0	1	0	741	57	5	3	870	156
KIAA0802	23255	broad.mit.edu	37	18	8783917	8783917	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:8783917G>C	uc002knr.2	+	6	949	c.807G>C	c.(805-807)GAG>GAC	p.E269D	KIAA0802_uc002knq.2_Missense_Mutation_p.E269D|KIAA0802_uc010dkw.1_Missense_Mutation_p.E107D	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	620	Potential.										0						ACTCCCTGGAGTCCTCCACTG	0.637													7	282	---	---	---	---	capture	Missense_Mutation	SNP	8783917	8783917	KIAA0802	18	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	8116	156
CIDEA	1149	broad.mit.edu	37	18	12274219	12274219	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:12274219A>T	uc002kqt.3	+	4	523	c.458A>T	c.(457-459)GAG>GTG	p.E153V	CIDEA_uc002kqu.3_Missense_Mutation_p.E187V|CIDEA_uc010dlc.2_RNA	NM_001279	NP_001270	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a isoform	153					DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change|lipid metabolic process|lipid storage|negative regulation of apoptosis|negative regulation of cytokine secretion|negative regulation of lipid catabolic process|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of sequestering of triglyceride|temperature homeostasis	mitochondrial envelope|nucleus	protein homodimerization activity			ovary(1)|central_nervous_system(1)	2						ACCATGTATGAGATGTACTCC	0.587													41	110	---	---	---	---	capture	Missense_Mutation	SNP	12274219	12274219	CIDEA	18	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	3390	156
DSC1	1823	broad.mit.edu	37	18	28736015	28736015	+	Silent	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28736015G>A	uc002kwn.2	-	4	724	c.462C>T	c.(460-462)CAC>CAT	p.H154H	DSC1_uc002kwm.2_Silent_p.H154H	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	154	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			CCTGCTGAACGTGTTGTGGAA	0.403													47	62	---	---	---	---	capture	Silent	SNP	28736015	28736015	DSC1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4720	156
DCC	1630	broad.mit.edu	37	18	50977004	50977004	+	Missense_Mutation	SNP	A	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:50977004A>C	uc002lfe.1	+	23	3951	c.3364A>C	c.(3364-3366)ACC>CCC	p.T1122P	DCC_uc010dpf.1_Missense_Mutation_p.T757P	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	1122	Helical; (Potential).				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGTGATTTGCACCCGACGCTC	0.483													6	41	---	---	---	---	capture	Missense_Mutation	SNP	50977004	50977004	DCC	18	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	4241	156
ZFR2	23217	broad.mit.edu	37	19	3825268	3825268	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3825268C>T	uc002lyw.2	-	7	1185	c.1173G>A	c.(1171-1173)GCG>GCA	p.A391A	ZFR2_uc010xhx.1_Intron	NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1	391						intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		TCTTGGCCAGCGCTGGCCTGC	0.672													3	7	---	---	---	---	capture	Silent	SNP	3825268	3825268	ZFR2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	17540	156
INSR	3643	broad.mit.edu	37	19	7184472	7184472	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7184472C>T	uc002mgd.1	-	3	938	c.829G>A	c.(829-831)GAC>AAC	p.D277N	INSR_uc002mge.1_Missense_Mutation_p.D277N|INSR_uc002mgf.2_Missense_Mutation_p.D277N	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	277	Cys-rich.				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CAGCGCCAGTCCTGGAAGTGG	0.602													32	50	---	---	---	---	capture	Missense_Mutation	SNP	7184472	7184472	INSR	19	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	7696	156
RAB11B	9230	broad.mit.edu	37	19	8468383	8468383	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8468383G>A	uc002mju.3	+	5	694	c.598G>A	c.(598-600)GTG>ATG	p.V200M		NM_004218	NP_004209	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	200					cell cycle|protein transport|small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity				0						GGACATCAGCGTGCCGCCCAC	0.647													44	79	---	---	---	---	capture	Missense_Mutation	SNP	8468383	8468383	RAB11B	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12787	156
ZNF527	84503	broad.mit.edu	37	19	37879435	37879435	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37879435G>C	uc010efk.1	+	5	595	c.484G>C	c.(484-486)GAC>CAC	p.D162H	ZNF527_uc002ogf.3_Missense_Mutation_p.D130H|ZNF527_uc010xtq.1_RNA	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527	162					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGGGAAAAGAGACAATGAATT	0.378													51	68	---	---	---	---	capture	Missense_Mutation	SNP	37879435	37879435	ZNF527	19	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	17847	156
EHD3	30845	broad.mit.edu	37	2	31467312	31467312	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31467312A>T	uc002rnu.2	+	2	1008	c.400A>T	c.(400-402)AAC>TAC	p.N134Y	EHD3_uc010ymt.1_Missense_Mutation_p.N134Y	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	134					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					CGCCTTCTTGAACAGGTGAGT	0.537													26	47	---	---	---	---	capture	Missense_Mutation	SNP	31467312	31467312	EHD3	2	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	4934	156
BIRC6	57448	broad.mit.edu	37	2	32774411	32774411	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:32774411G>A	uc010ezu.2	+	65	13141	c.13007G>A	c.(13006-13008)AGT>AAT	p.S4336N		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4336					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CCCGTCAGTAGTGCGGTAAAT	0.398													37	71	---	---	---	---	capture	Missense_Mutation	SNP	32774411	32774411	BIRC6	2	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	1426	156
TUBA3D	113457	broad.mit.edu	37	2	132237806	132237806	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:132237806C>T	uc002tsu.3	+	4	647	c.540C>T	c.(538-540)GCC>GCT	p.A180A		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	180					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)		TCTCCACAGCCGTGGTGGAGC	0.547													98	286	---	---	---	---	capture	Silent	SNP	132237806	132237806	TUBA3D	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16629	156
LY75	4065	broad.mit.edu	37	2	160729003	160729003	+	Silent	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160729003A>G	uc002ubc.3	-	13	2145	c.2076T>C	c.(2074-2076)GAT>GAC	p.D692D	LY75_uc002ubb.3_Silent_p.D692D|LY75_uc010fos.2_Silent_p.D692D|LY75_uc010fot.1_Silent_p.D692D	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	692	Extracellular (Potential).|C-type lectin 4.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		CCTTTATTTCATCCACATGGC	0.378													102	117	---	---	---	---	capture	Silent	SNP	160729003	160729003	LY75	2	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	9014	156
LRP2	4036	broad.mit.edu	37	2	170009391	170009391	+	Missense_Mutation	SNP	G	A	A	rs148356370	byFrequency	TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170009391G>A	uc002ues.2	-	67	12592	c.12379C>T	c.(12379-12381)CGC>TGC	p.R4127C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4127	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AGATTATTGCGGCCGGATTCA	0.468													188	278	---	---	---	---	capture	Missense_Mutation	SNP	170009391	170009391	LRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8872	156
PDE11A	50940	broad.mit.edu	37	2	178969184	178969184	+	Missense_Mutation	SNP	T	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:178969184T>C	uc002ulr.2	-	2	106	c.7A>G	c.(7-9)AAG>GAG	p.K3E	PDE11A_uc002ult.1_Missense_Mutation_p.K3E	NM_001077197	NP_001070665	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 3	Error:Variant_position_missing_in_Q9HCR9_after_alignment					platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			CTTGCCTGCTTCAGCATCTCC	0.408									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				4	181	---	---	---	---	capture	Missense_Mutation	SNP	178969184	178969184	PDE11A	2	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	11534	156
TTN	7273	broad.mit.edu	37	2	179442852	179442852	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179442852G>A	uc010zfg.1	-	271	60910	c.60686C>T	c.(60685-60687)CCG>CTG	p.P20229L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P13924L|TTN_uc010zfi.1_Missense_Mutation_p.P13857L|TTN_uc010zfj.1_Missense_Mutation_p.P13732L|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21156							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCCTTATCGGAGTCTTGTT	0.418													71	111	---	---	---	---	capture	Missense_Mutation	SNP	179442852	179442852	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16617	156
PTPRN	5798	broad.mit.edu	37	2	220159756	220159756	+	Silent	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220159756G>A	uc002vkz.2	-	19	2705	c.2616C>T	c.(2614-2616)TTC>TTT	p.F872F	PTPRN_uc010zlc.1_Silent_p.F782F|PTPRN_uc002vla.2_Silent_p.F843F|uc010zld.1_5'Flank|MIR153-1_hsa-mir-153-1|MI0000463_5'Flank	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	872	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GCCAGCTGAGGAAGTGGAACT	0.687													7	24	---	---	---	---	capture	Silent	SNP	220159756	220159756	PTPRN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	12702	156
GSS	2937	broad.mit.edu	37	20	33516696	33516696	+	Missense_Mutation	SNP	T	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33516696T>A	uc002xbg.2	-	13	1440	c.1360A>T	c.(1360-1362)ATC>TTC	p.I454F	GSS_uc010zun.1_Missense_Mutation_p.I326F|GSS_uc010zuo.1_Missense_Mutation_p.I343F|GSS_uc010zup.1_Missense_Mutation_p.I385F|GSS_uc002xbh.2_RNA	NM_000178	NP_000169	P48637	GSHB_HUMAN	glutathione synthetase	454					nervous system development|response to oxidative stress|xenobiotic metabolic process	cytosol	ATP binding|glutathione binding|glutathione synthase activity|magnesium ion binding|protein homodimerization activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(18;0.035)		Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	GCATGCTCGATGGCTTTGGTT	0.562													57	113	---	---	---	---	capture	Missense_Mutation	SNP	33516696	33516696	GSS	20	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	6761	156
MED15	51586	broad.mit.edu	37	22	20939408	20939408	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20939408G>A	uc002zsp.2	+	16	2065	c.1985G>A	c.(1984-1986)CGG>CAG	p.R662Q	MED15_uc002zsq.2_Missense_Mutation_p.R622Q|MED15_uc010gso.2_Missense_Mutation_p.R605Q|MED15_uc002zsr.2_Missense_Mutation_p.R596Q|MED15_uc011ahs.1_Missense_Mutation_p.R596Q|MED15_uc002zss.2_Missense_Mutation_p.R541Q|MED15_uc011ahu.1_Missense_Mutation_p.R372Q|MED15_uc002zst.2_Missense_Mutation_p.R278Q|MED15_uc002zsu.2_Missense_Mutation_p.R267Q	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	662					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			GTGTGCACCCGGAAGCGCAGG	0.682													3	97	---	---	---	---	capture	Missense_Mutation	SNP	20939408	20939408	MED15	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9346	156
NCAPH2	29781	broad.mit.edu	37	22	50956414	50956414	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50956414A>G	uc003blr.3	+	6	555	c.433A>G	c.(433-435)ATC>GTC	p.I145V	NCAPH2_uc003blq.3_Missense_Mutation_p.I145V|NCAPH2_uc003blv.2_Missense_Mutation_p.I145V|NCAPH2_uc010hbb.2_5'UTR|NCAPH2_uc003blu.3_RNA|NCAPH2_uc003bls.3_RNA|NCAPH2_uc003blt.3_RNA|NCAPH2_uc003blw.3_RNA|NCAPH2_uc003blx.3_Missense_Mutation_p.I145V|NCAPH2_uc003bly.3_RNA	NM_152299	NP_689512	Q6IBW4	CNDH2_HUMAN	kleisin beta isoform 2	145					chromosome condensation	chromosome|nucleus				ovary(1)|skin(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		GGTCCTCATCATCCCCCTCCT	0.612													33	108	---	---	---	---	capture	Missense_Mutation	SNP	50956414	50956414	NCAPH2	22	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	10117	156
DLEC1	9940	broad.mit.edu	37	3	38139020	38139020	+	Silent	SNP	T	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38139020T>C	uc003cho.1	+	17	2478	c.2457T>C	c.(2455-2457)TTT>TTC	p.F819F	DLEC1_uc003chp.1_Silent_p.F819F|DLEC1_uc010hgv.1_Silent_p.F819F|DLEC1_uc003chr.1_5'UTR|DLEC1_uc010hgx.1_RNA	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	819					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TCGGGGATTTTGAGTTGAACT	0.562													34	53	---	---	---	---	capture	Silent	SNP	38139020	38139020	DLEC1	3	T	C	C	C	1	0	0	0	0	0	0	0	1	816	63	3	3	4510	156
ATP6V1A	523	broad.mit.edu	37	3	113503555	113503555	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:113503555A>G	uc003eao.2	+	5	505	c.439A>G	c.(439-441)ATC>GTC	p.I147V	ATP6V1A_uc011bik.1_Missense_Mutation_p.I114V	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A	147					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						TGGTAGTCATATCACTGGCGG	0.373													6	129	---	---	---	---	capture	Missense_Mutation	SNP	113503555	113503555	ATP6V1A	3	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	1168	156
FRYL	285527	broad.mit.edu	37	4	48575256	48575256	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48575256G>C	uc003gyh.1	-	26	3456	c.2851C>G	c.(2851-2853)CTA>GTA	p.L951V	FRYL_uc003gyk.2_Missense_Mutation_p.L951V	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	951					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TCCTCTATTAGTTCCCTGGAA	0.348													53	73	---	---	---	---	capture	Missense_Mutation	SNP	48575256	48575256	FRYL	4	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	6007	156
PITX2	5308	broad.mit.edu	37	4	111539315	111539315	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:111539315C>T	uc003iad.2	-	5	1502	c.920G>A	c.(919-921)AGT>AAT	p.S307N	PITX2_uc003iac.2_Missense_Mutation_p.S314N|PITX2_uc003iae.2_Missense_Mutation_p.S261N|PITX2_uc010iml.2_Missense_Mutation_p.S178N|PITX2_uc003iaf.2_Missense_Mutation_p.S307N	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2	307					determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		CTGGCAAGCACTCAGGTTGGA	0.632													4	79	---	---	---	---	capture	Missense_Mutation	SNP	111539315	111539315	PITX2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	11858	156
FGA	2243	broad.mit.edu	37	4	155508007	155508007	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155508007C>T	uc003iod.1	-	5	632	c.574G>A	c.(574-576)GTA>ATA	p.V192I	FGA_uc003ioe.1_Missense_Mutation_p.V192I|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	192	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TTCAGATCTACTTCACGAGCT	0.418													64	101	---	---	---	---	capture	Missense_Mutation	SNP	155508007	155508007	FGA	4	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	5776	156
DNAH5	1767	broad.mit.edu	37	5	13829731	13829731	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13829731C>T	uc003jfd.2	-	38	6374	c.6332G>A	c.(6331-6333)CGT>CAT	p.R2111H		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2111	AAA 1 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GATAATCTGACGGTCAGGCAC	0.463									Kartagener_syndrome				53	78	---	---	---	---	capture	Missense_Mutation	SNP	13829731	13829731	DNAH5	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4561	156
CMYA5	202333	broad.mit.edu	37	5	79030268	79030268	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79030268T>G	uc003kgc.2	+	2	5752	c.5680T>G	c.(5680-5682)TGG>GGG	p.W1894G		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1894						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GGATGAAAACTGGATGTTGGG	0.423													7	76	---	---	---	---	capture	Missense_Mutation	SNP	79030268	79030268	CMYA5	5	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	3555	156
ZNF608	57507	broad.mit.edu	37	5	123983427	123983427	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:123983427C>T	uc003ktq.1	-	4	2773	c.2650G>A	c.(2650-2652)GAT>AAT	p.D884N	ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_Missense_Mutation_p.D884N|ZNF608_uc003ktt.1_Missense_Mutation_p.D884N	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	884						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TAAACCTTATCGGCCTCAGCT	0.532													68	75	---	---	---	---	capture	Missense_Mutation	SNP	123983427	123983427	ZNF608	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17912	156
PCDHB15	56121	broad.mit.edu	37	5	140625602	140625602	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140625602T>G	uc003lje.2	+	1	456	c.456T>G	c.(454-456)TTT>TTG	p.F152L		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	152	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGACTGTGTTTCCTCTGAAAA	0.438													79	118	---	---	---	---	capture	Missense_Mutation	SNP	140625602	140625602	PCDHB15	5	T	G	G	G	1	0	0	0	0	1	0	0	0	803	62	4	4	11443	156
ARHGEF37	389337	broad.mit.edu	37	5	148997790	148997790	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148997790G>A	uc003lra.1	+	6	774	c.710G>A	c.(709-711)CGC>CAC	p.R237H		NM_001001669	NP_001001669	A1IGU5	ARH37_HUMAN	hypothetical protein LOC389337	237					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0						CGGCTGGCCCGCATCAACACA	0.632													5	133	---	---	---	---	capture	Missense_Mutation	SNP	148997790	148997790	ARHGEF37	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	899	156
CLINT1	9685	broad.mit.edu	37	5	157232966	157232966	+	Missense_Mutation	SNP	T	C	C			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:157232966T>C	uc003lxj.1	-	7	1040	c.850A>G	c.(850-852)ACC>GCC	p.T284A	CLINT1_uc003lxi.1_Missense_Mutation_p.T266A|CLINT1_uc011ddv.1_Missense_Mutation_p.T284A	NM_014666	NP_055481	Q14677	EPN4_HUMAN	epsin 4	284					endocytosis|post-Golgi vesicle-mediated transport	clathrin-coated vesicle|cytosol|Golgi apparatus|membrane|perinuclear region of cytoplasm	clathrin binding|lipid binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGATCAATGGTTTTGGAAGGA	0.473													3	119	---	---	---	---	capture	Missense_Mutation	SNP	157232966	157232966	CLINT1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	3496	156
N4BP3	23138	broad.mit.edu	37	5	177548865	177548865	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:177548865G>A	uc003mik.1	+	5	1745	c.1498G>A	c.(1498-1500)GTG>ATG	p.V500M	N4BP3_uc003mil.1_Missense_Mutation_p.V169M	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3	500	Potential.					cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAGGAGCGCGTGCTGCGCTA	0.687													5	7	---	---	---	---	capture	Missense_Mutation	SNP	177548865	177548865	N4BP3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10023	156
RASGEF1C	255426	broad.mit.edu	37	5	179555514	179555514	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179555514G>T	uc003mlq.2	-	4	832	c.535C>A	c.(535-537)CCC>ACC	p.P179T	RASGEF1C_uc003mlr.2_Missense_Mutation_p.P179T|RASGEF1C_uc003mlp.3_Missense_Mutation_p.P28T	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	179					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TAGGAGATGGGCTTGTCGGCA	0.637													32	42	---	---	---	---	capture	Missense_Mutation	SNP	179555514	179555514	RASGEF1C	5	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	12966	156
DST	667	broad.mit.edu	37	6	56342227	56342227	+	Silent	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56342227G>A	uc003pdf.2	-	85	15262	c.15234C>T	c.(15232-15234)GGC>GGT	p.G5078G	DST_uc003pcz.3_Silent_p.G4900G|DST_uc011dxj.1_Silent_p.G4929G|DST_uc011dxk.1_Silent_p.G4940G|DST_uc003pcy.3_Silent_p.G4574G	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6986	Spectrin 20.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAACGGTGTCGCCCATAGTGG	0.458													63	104	---	---	---	---	capture	Silent	SNP	56342227	56342227	DST	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4738	156
ME1	4199	broad.mit.edu	37	6	84056002	84056002	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84056002A>T	uc003pjy.2	-	5	596	c.490T>A	c.(490-492)TGT>AGT	p.C164S	ME1_uc011dzb.1_Missense_Mutation_p.C89S|ME1_uc011dzc.1_5'UTR	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1	164					carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)	ATTCCATTACAGCCAAGGTCT	0.448													13	42	---	---	---	---	capture	Missense_Mutation	SNP	84056002	84056002	ME1	6	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	9330	156
SAMD9	54809	broad.mit.edu	37	7	92732691	92732691	+	Missense_Mutation	SNP	C	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92732691C>A	uc003umf.2	-	3	2976	c.2720G>T	c.(2719-2721)GGG>GTG	p.G907V	SAMD9_uc003umg.2_Missense_Mutation_p.G907V	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	907						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			AATATTCTGCCCTTTCAGGAT	0.333													25	72	---	---	---	---	capture	Missense_Mutation	SNP	92732691	92732691	SAMD9	7	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	13718	156
AZGP1	563	broad.mit.edu	37	7	99569575	99569575	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99569575A>T	uc003ush.2	-	2	175	c.131T>A	c.(130-132)GTC>GAC	p.V44D		NM_001185	NP_001176	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc	44					antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					AAACGCGGGGACGTCTTCAAC	0.502													6	136	---	---	---	---	capture	Missense_Mutation	SNP	99569575	99569575	AZGP1	7	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	1229	156
IQUB	154865	broad.mit.edu	37	7	123152166	123152166	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123152166G>T	uc003vkn.2	-	2	806	c.229C>A	c.(229-231)CAA>AAA	p.Q77K	IQUB_uc003vko.2_Missense_Mutation_p.Q77K|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.Q77K|IQUB_uc003vkq.2_Missense_Mutation_p.Q77K	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	77										ovary(3)|large_intestine(1)	4						TCCATGAGTTGTTCATTGTCT	0.413													116	168	---	---	---	---	capture	Missense_Mutation	SNP	123152166	123152166	IQUB	7	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	7743	156
FAM71F1	84691	broad.mit.edu	37	7	128370003	128370003	+	Missense_Mutation	SNP	C	T	T	rs140953386	byFrequency;by1000genomes	TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128370003C>T	uc003vno.1	+	6	954	c.901C>T	c.(901-903)CGT>TGT	p.R301C	FAM71F1_uc003vnm.1_RNA|FAM71F1_uc003vnn.1_Missense_Mutation_p.R200C|FAM71F1_uc003vnp.1_Missense_Mutation_p.R299C	NM_032599	NP_115988	Q96KD3	F71F1_HUMAN	testes development-related NYD-SP18	301										skin(1)	1						CTGTGACCTACGTTGGAGGGC	0.547													17	220	---	---	---	---	capture	Missense_Mutation	SNP	128370003	128370003	FAM71F1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5560	156
HIPK2	28996	broad.mit.edu	37	7	139416741	139416741	+	Silent	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139416741C>T	uc003vvf.3	-	2	267	c.93G>A	c.(91-93)CTG>CTA	p.L31L	HIPK2_uc003vvd.3_Silent_p.L31L	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	31					apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					GCTCTATTTTCAGTTTCTTCA	0.493													5	49	---	---	---	---	capture	Silent	SNP	139416741	139416741	HIPK2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	7042	156
CNTNAP2	26047	broad.mit.edu	37	7	146829418	146829418	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:146829418C>T	uc003weu.1	+	8	1681	c.1165C>T	c.(1165-1167)CGG>TGG	p.R389W		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	389	Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	p.R389Q(1)		ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGTGCCCGGACGGCTTAACCA	0.468										HNSCC(39;0.1)			90	140	---	---	---	---	capture	Missense_Mutation	SNP	146829418	146829418	CNTNAP2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	3612	156
IARS	3376	broad.mit.edu	37	9	95007245	95007246	+	Missense_Mutation	DNP	GC	AA	AA			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95007245_95007246GC>AA	uc004art.1	-	27	3156_3157	c.2899_2900GC>TT	c.(2899-2901)GCT>TTT	p.A967F	IARS_uc004ars.1_Missense_Mutation_p.A812F|IARS_uc004aru.3_Missense_Mutation_p.A967F|IARS_uc010mqr.2_Missense_Mutation_p.A857F|IARS_uc010mqt.2_Missense_Mutation_p.A190F	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	967					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	AAATACCTGAGCATCTGAGTGT	0.446													52	76	---	---	---	---	capture	Missense_Mutation	DNP	95007245	95007246	IARS	9	GC	AA	AA	AA	1	0	0	0	0	1	0	0	0	442	34	2	2	7398	156
LPAR1	1902	broad.mit.edu	37	9	113703772	113703772	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113703772C>T	uc004bfa.2	-	4	977	c.722G>A	c.(721-723)CGG>CAG	p.R241Q	LPAR1_uc011lwm.1_Missense_Mutation_p.R242Q|LPAR1_uc004bfb.2_Missense_Mutation_p.R241Q|LPAR1_uc004bfc.2_Missense_Mutation_p.R241Q|LPAR1_uc011lwn.1_Missense_Mutation_p.R223Q|LPAR1_uc011lwo.1_Missense_Mutation_p.R242Q|LPAR1_uc010mub.2_Missense_Mutation_p.R241Q	NM_057159	NP_476500	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	241	Cytoplasmic (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2						AGAACTATGCCGAGACATTCT	0.468													7	148	---	---	---	---	capture	Missense_Mutation	SNP	113703772	113703772	LPAR1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8820	156
SUSD1	64420	broad.mit.edu	37	9	114860875	114860875	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114860875G>T	uc004bfu.2	-	10	1390	c.1349C>A	c.(1348-1350)ACG>AAG	p.T450K	SUSD1_uc010mui.2_Missense_Mutation_p.T450K|SUSD1_uc010muj.2_Missense_Mutation_p.T450K	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor	450	Extracellular (Potential).					integral to membrane	calcium ion binding				0						TTGTTCCCTCGTTGTGAAGTT	0.443													78	102	---	---	---	---	capture	Missense_Mutation	SNP	114860875	114860875	SUSD1	9	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	15295	156
F9	2158	broad.mit.edu	37	X	138643014	138643014	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138643014G>A	uc004fas.1	+	7	867	c.838G>A	c.(838-840)GGT>AGT	p.G280S	F9_uc004fat.1_Missense_Mutation_p.G242S	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	280	Peptidase S1.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	AGTTGTCGCAGGTAAATACAC	0.343													70	21	---	---	---	---	capture	Missense_Mutation	SNP	138643014	138643014	F9	23	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	5305	156
ATP11C	286410	broad.mit.edu	37	X	138864837	138864837	+	Silent	SNP	A	G	G			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138864837A>G	uc004faz.2	-	18	1929	c.1830T>C	c.(1828-1830)GAT>GAC	p.D610D	ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Silent_p.D610D	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	610	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					TTCTTTCATAATCATCTGGAG	0.353													54	32	---	---	---	---	capture	Silent	SNP	138864837	138864837	ATP11C	23	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	1112	156
PTEN	5728	broad.mit.edu	37	10	89685315	89685318	+	Splice_Site	DEL	GTAA	-	-			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89685315_89685318delGTAA	uc001kfb.2	+	4	1240	c.209_splice	c.e4+1	p.L70_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(15)|p.R55fs*1(4)|p.L70fs*7(2)|p.Y27fs*1(2)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TATACAATCTGTAAGTATGTTTTC	0.275		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			14	10	---	---	---	---	capture_indel	Splice_Site	DEL	89685315	89685318	PTEN	10	GTAA	-	-	-	1	0	1	0	1	0	0	1	0	624	48	5	5	12633	156
HEATR5A	25938	broad.mit.edu	37	14	31852819	31852835	+	Frame_Shift_Del	DEL	GTGAAGACTTATGTCCA	-	-			TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31852819_31852835delGTGAAGACTTATGTCCA	uc001wrf.3	-	4	686_702	c.609_625delTGGACATAAGTCTTCAC	c.(607-627)ACTGGACATAAGTCTTCACCTfs	p.T203fs	HEATR5A_uc010ami.2_Frame_Shift_Del_p.T101fs|HEATR5A_uc001wrg.1_Frame_Shift_Del_p.T85fs|HEATR5A_uc010tpk.1_Frame_Shift_Del_p.T496fs	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	490_496							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		ACTGCTTCAGGTGAAGACTTATGTCCAGTAAGCCGTT	0.461													65	68	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	31852819	31852835	HEATR5A	14	GTGAAGACTTATGTCCA	-	-	-	1	0	1	0	1	0	0	0	0	572	44	5	5	6958	156
DBR1	51163	broad.mit.edu	37	3	137880741	137880743	+	In_Frame_Del	DEL	TCG	-	-	rs150114751;rs2622736	byFrequency;by1000genomes	TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137880741_137880743delTCG	uc003erv.2	-	8	1759_1761	c.1623_1625delCGA	c.(1621-1626)GATGAT>GAT	p.541_542DD>D	DBR1_uc003eru.2_In_Frame_Del_p.490_491DD>D|DBR1_uc003ert.2_In_Frame_Del_p.309_310DD>D	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1	541_542						nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						TTAAGCTGCATCGTCATCATCAT	0.251													14	224	---	---	---	---	capture_indel	In_Frame_Del	DEL	137880741	137880743	DBR1	3	TCG	-	-	-	1	0	1	0	1	0	0	0	0	650	50	5	5	4216	156
AASS	10157	broad.mit.edu	37	7	121717919	121717920	+	Frame_Shift_Ins	INS	-	G	G	rs147476318	by1000genomes	TCGA-16-0861-01	TCGA-16-0861-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121717919_121717920insG	uc003vka.2	-	22	2730_2731	c.2634_2635insC	c.(2632-2637)ACCGCCfs	p.T878fs	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Frame_Shift_Ins_p.T878fs|AASS_uc011knw.1_Frame_Shift_Ins_p.T366fs	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	878_879	Saccharopine dehydrogenase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	GCTGCCATGGCGGTGGGTAACC	0.460													9	473	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	121717919	121717920	AASS	7	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	24	156
