Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHA10	284656	broad.mit.edu	37	1	38227511	38227511	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38227511C>T	uc009vvi.2	-	3	502	c.416G>A	c.(415-417)CGT>CAT	p.R139H	EPHA10_uc001cbw.3_Missense_Mutation_p.R139H	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	139	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGGACGCCCACGGCCCAGGTC	0.657													45	9	---	---	---	---	capture	Missense_Mutation	SNP	38227511	38227511	EPHA10	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5121	159
KIAA0467	23334	broad.mit.edu	37	1	43905598	43905598	+	Silent	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43905598G>A	uc001cjk.1	+	36	4854	c.4392G>A	c.(4390-4392)GGG>GGA	p.G1464G		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	2363						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGGAAAAGGGGAACATTAGTA	0.567													41	9	---	---	---	---	capture	Silent	SNP	43905598	43905598	KIAA0467	1	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	8100	159
DAB1	1600	broad.mit.edu	37	1	57535099	57535099	+	Splice_Site	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57535099C>T	uc001cys.1	-	10	1272	c.598_splice	c.e10-1	p.Y200_splice	DAB1_uc001cyt.1_Splice_Site_p.Y200_splice|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Splice_Site_p.Y200_splice	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						ACACAATGTACTATTACAGGA	0.413													49	12	---	---	---	---	capture	Splice_Site	SNP	57535099	57535099	DAB1	1	C	T	T	T	1	0	0	0	0	0	0	1	0	260	20	5	2	4177	159
TNNI3K	51086	broad.mit.edu	37	1	74665467	74665467	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:74665467C>T	uc001dge.1	+	2	218	c.202C>T	c.(202-204)CTT>TTT	p.L68F	LRRIQ3_uc001dfy.3_5'Flank|LRRIQ3_uc001dfz.3_5'Flank|TNNI3K_uc001dgc.1_Missense_Mutation_p.L68F|TNNI3K_uc001dgd.2_Missense_Mutation_p.L68F|FPGT_uc010oqt.1_5'UTR|FPGT_uc010oqu.1_Missense_Mutation_p.L68F|FPGT_uc001dgb.1_Missense_Mutation_p.L68F|FPGT_uc010oqv.1_Missense_Mutation_p.L68F	NM_001112808	NP_001106279	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform a	Error:Variant_position_missing_in_Q59H18_after_alignment						cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						GGAGTTACCCCTTGGAGTTCA	0.403													83	25	---	---	---	---	capture	Missense_Mutation	SNP	74665467	74665467	TNNI3K	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	16212	159
ST6GALNAC3	256435	broad.mit.edu	37	1	76877752	76877752	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:76877752C>T	uc001dhh.2	+	3	436	c.273C>T	c.(271-273)GGC>GGT	p.G91G	ST6GALNAC3_uc001dhg.3_Silent_p.G91G|ST6GALNAC3_uc010orh.1_Silent_p.G26G	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1	91	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						AGATGGTTGGCCAGAAGGTGG	0.448													53	13	---	---	---	---	capture	Silent	SNP	76877752	76877752	ST6GALNAC3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	15115	159
PDE4DIP	9659	broad.mit.edu	37	1	144854614	144854614	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144854614C>T	uc001elw.3	-	42	7147	c.6856G>A	c.(6856-6858)GTA>ATA	p.V2286I	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.V2180I|PDE4DIP_uc001elv.3_Missense_Mutation_p.V1293I	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2286	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGTTTGGATACTTTGGTTCTC	0.498			T	PDGFRB	MPD								48	196	---	---	---	---	capture	Missense_Mutation	SNP	144854614	144854614	PDE4DIP	1	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	11546	159
LCE1E	353135	broad.mit.edu	37	1	152760044	152760044	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152760044C>A	uc001fan.2	+	2	322	c.269C>A	c.(268-270)CCC>CAC	p.P90H		NM_178353	NP_848130	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	90	Cys-rich.				keratinization						0	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTCACAGACCCCAGAGCTCT	0.687													56	42	---	---	---	---	capture	Missense_Mutation	SNP	152760044	152760044	LCE1E	1	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	8583	159
RGS4	5999	broad.mit.edu	37	1	163044110	163044110	+	Splice_Site	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:163044110G>A	uc009wuy.2	+	5	890	c.379_splice	c.e5-1	p.V127_splice	RGS4_uc001gcl.3_Splice_Site_p.V224_splice|RGS4_uc009wuz.2_Splice_Site_p.C71_splice|RGS4_uc009wva.2_Splice_Site_p.V109_splice	NM_005613	NP_005604	P49798	RGS4_HUMAN	regulator of G-protein signaling 4 isoform 2						inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity			ovary(2)|central_nervous_system(1)	3						TTGCCCCTCAGGTGAACCTGG	0.488													9	207	---	---	---	---	capture	Splice_Site	SNP	163044110	163044110	RGS4	1	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	13199	159
C1orf129	80133	broad.mit.edu	37	1	170928687	170928687	+	Silent	SNP	T	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:170928687T>G	uc001ghg.2	+	5	367	c.237T>G	c.(235-237)CTT>CTG	p.L79L	C1orf129_uc009wvy.2_5'UTR|C1orf129_uc010plz.1_Silent_p.L79L	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	79							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGCCAAGTCTTGACAAAGTAA	0.363													14	49	---	---	---	---	capture	Silent	SNP	170928687	170928687	C1orf129	1	T	G	G	G	1	0	0	0	0	0	0	0	1	808	63	4	4	1978	159
CACNA1E	777	broad.mit.edu	37	1	181693656	181693656	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:181693656G>A	uc001gow.2	+	17	2290	c.2125G>A	c.(2125-2127)GCC>ACC	p.A709T	CACNA1E_uc009wxs.2_Missense_Mutation_p.A616T	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	709	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TCTCGCCAACGCCCAGGAACT	0.463													7	10	---	---	---	---	capture	Missense_Mutation	SNP	181693656	181693656	CACNA1E	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2518	159
C4BPA	722	broad.mit.edu	37	1	207300203	207300203	+	Silent	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207300203T>C	uc001hfo.2	+	7	1046	c.852T>C	c.(850-852)GAT>GAC	p.D284D		NM_000715	NP_000706	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	284	Sushi 4.				complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						GTGATGCTGATAGCAAATGGA	0.403													68	68	---	---	---	---	capture	Silent	SNP	207300203	207300203	C4BPA	1	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	2227	159
PARP1	142	broad.mit.edu	37	1	226550806	226550806	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226550806C>T	uc001hqd.3	-	21	3013	c.2842G>A	c.(2842-2844)GTC>ATC	p.V948I		NM_001618	NP_001609	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase family, member 1	948	PARP catalytic.				cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		TTACCTTTGACACTGTGCTTG	0.527								Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					5	121	---	---	---	---	capture	Missense_Mutation	SNP	226550806	226550806	PARP1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	11357	159
RYR2	6262	broad.mit.edu	37	1	237789020	237789020	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237789020C>T	uc001hyl.1	+	40	6202	c.6082C>T	c.(6082-6084)CGT>TGT	p.R2028C		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2028	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AATTAGAGGGCGTCTGCTATC	0.393													49	25	---	---	---	---	capture	Missense_Mutation	SNP	237789020	237789020	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13661	159
OR2T27	403239	broad.mit.edu	37	1	248814164	248814164	+	Missense_Mutation	SNP	C	T	T	rs144642254		TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248814164C>T	uc010pzo.1	-	1	22	c.22G>A	c.(22-24)GTG>ATG	p.V8M		NM_001001824	NP_001001824	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCGGCATACACGGAATAATTG	0.433													9	33	---	---	---	---	capture	Missense_Mutation	SNP	248814164	248814164	OR2T27	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10925	159
KIAA1462	57608	broad.mit.edu	37	10	30315264	30315264	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:30315264C>T	uc001iux.2	-	2	3872	c.3813G>A	c.(3811-3813)ATG>ATA	p.M1271I	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.M1133I|KIAA1462_uc009xle.1_Missense_Mutation_p.M1271I	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	1271										ovary(4)	4						TCAGGACTCTCATCCGTGACA	0.582													55	64	---	---	---	---	capture	Missense_Mutation	SNP	30315264	30315264	KIAA1462	10	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	8156	159
RET	5979	broad.mit.edu	37	10	43604497	43604497	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:43604497A>T	uc001jal.2	+	6	1272	c.1082A>T	c.(1081-1083)AAC>ATC	p.N361I	RET_uc001jak.1_Missense_Mutation_p.N361I|RET_uc010qez.1_Missense_Mutation_p.N107I	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	361	Extracellular (Potential).				homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	CTCAACCGGAACCTCTCCATC	0.597		1	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				30	35	---	---	---	---	capture	Missense_Mutation	SNP	43604497	43604497	RET	10	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	13130	159
GPRIN2	9721	broad.mit.edu	37	10	47000008	47000008	+	Silent	SNP	G	A	A	rs111800394		TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:47000008G>A	uc001jec.2	+	3	1263	c.1128G>A	c.(1126-1128)CCG>CCA	p.P376P	GPRIN2_uc010qfq.1_Silent_p.P139P	NM_014696	NP_055511	O60269	GRIN2_HUMAN	G protein-regulated inducer of neurite outgrowth	376											0						AGGAGGTGCCGTCCCCTGTGC	0.657													27	128	---	---	---	---	capture	Silent	SNP	47000008	47000008	GPRIN2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	6663	159
ATRNL1	26033	broad.mit.edu	37	10	117061475	117061475	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:117061475C>T	uc001lcg.2	+	17	3126	c.2740C>T	c.(2740-2742)CGA>TGA	p.R914*	ATRNL1_uc010qsm.1_Nonsense_Mutation_p.R89*|ATRNL1_uc010qsn.1_RNA	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	914	PSI 4.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CAGTACGAAACGATGTGTTGA	0.453													75	97	---	---	---	---	capture	Nonsense_Mutation	SNP	117061475	117061475	ATRNL1	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	1198	159
TSPAN4	7106	broad.mit.edu	37	11	866600	866600	+	Silent	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:866600A>G	uc001lsd.1	+	9	896	c.687A>G	c.(685-687)CAA>CAG	p.Q229Q	TSPAN4_uc001lse.1_Silent_p.Q165Q|TSPAN4_uc001lsf.1_Silent_p.Q229Q|TSPAN4_uc001lsg.1_Silent_p.Q229Q|TSPAN4_uc001lsh.1_Silent_p.Q229Q|TSPAN4_uc001lsi.1_Silent_p.Q229Q|TSPAN4_uc001lsj.1_Silent_p.Q229Q	NM_003271	NP_003262	O14817	TSN4_HUMAN	tetraspanin 4 isoform a	229	Cytoplasmic (Potential).				protein complex assembly	integral to plasma membrane				breast(1)	1		all_cancers(49;2.64e-08)|all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)		all cancers(45;4.32e-25)|Epithelial(43;3.29e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTACTGCCAAGTGGTCAAGG	0.642													8	27	---	---	---	---	capture	Silent	SNP	866600	866600	TSPAN4	11	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	16532	159
OR51S1	119692	broad.mit.edu	37	11	4870245	4870245	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4870245C>T	uc010qyo.1	-	1	194	c.194G>A	c.(193-195)CGC>CAC	p.R65H		NM_001004758	NP_001004758	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGCATTGGGCGGTGCAGGGC	0.572													25	53	---	---	---	---	capture	Missense_Mutation	SNP	4870245	4870245	OR51S1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11009	159
RCN1	5954	broad.mit.edu	37	11	32119964	32119964	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:32119964A>G	uc010reb.1	+	3	783	c.517A>G	c.(517-519)AGA>GGA	p.R173G	RCN1_uc010rea.1_Missense_Mutation_p.R122G|RCN1_uc001mtk.2_Missense_Mutation_p.R7G	NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor	173	EF-hand 3.					endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					ACGTGATGAGAGAAGATTCAA	0.433													30	34	---	---	---	---	capture	Missense_Mutation	SNP	32119964	32119964	RCN1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	13074	159
OR4C16	219428	broad.mit.edu	37	11	55340233	55340233	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55340233C>T	uc010rih.1	+	1	630	c.630C>T	c.(628-630)GTC>GTT	p.V210V		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	210	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)				TGAGTTATGTCATGCTAATAT	0.433													48	49	---	---	---	---	capture	Silent	SNP	55340233	55340233	OR4C16	11	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	10953	159
OR5D18	219438	broad.mit.edu	37	11	55587827	55587827	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55587827C>A	uc010rin.1	+	1	722	c.722C>A	c.(721-723)ACC>AAC	p.T241N		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				GCCTTCTCCACCTGTGCCTCC	0.507													41	41	---	---	---	---	capture	Missense_Mutation	SNP	55587827	55587827	OR5D18	11	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	11061	159
LPXN	9404	broad.mit.edu	37	11	58295179	58295179	+	Silent	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58295179A>G	uc001nmw.2	-	9	1054	c.909T>C	c.(907-909)TTT>TTC	p.F303F	LPXN_uc009ymp.2_Silent_p.F173F|LPXN_uc010rkj.1_Silent_p.F308F|LPXN_uc010rkk.1_Silent_p.F283F	NM_004811	NP_004802	O60711	LPXN_HUMAN	leupaxin isoform 2	303	LIM zinc-binding 3.				cell adhesion|protein complex assembly|signal transduction	cytoplasm	zinc ion binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AGCCAGTAGAAAAACTGGTGA	0.473													4	39	---	---	---	---	capture	Silent	SNP	58295179	58295179	LPXN	11	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	8845	159
TYR	7299	broad.mit.edu	37	11	88911588	88911588	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:88911588A>G	uc001pcs.2	+	1	549	c.467A>G	c.(466-468)TAT>TGT	p.Y156C		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	156	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	ATAGGGACCTATGGCCAAATG	0.408									Oculocutaneous_Albinism				49	123	---	---	---	---	capture	Missense_Mutation	SNP	88911588	88911588	TYR	11	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	16695	159
FAT3	120114	broad.mit.edu	37	11	92577445	92577445	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92577445G>C	uc001pdj.3	+	18	10929	c.10912G>C	c.(10912-10914)GAG>CAG	p.E3638Q	FAT3_uc001pdi.3_Missense_Mutation_p.E78Q	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3638	Cadherin 33.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CGTGCATGTGGAGCAGTTGGT	0.557										TCGA Ovarian(4;0.039)			4	172	---	---	---	---	capture	Missense_Mutation	SNP	92577445	92577445	FAT3	11	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	5637	159
OR10G8	219869	broad.mit.edu	37	11	123901051	123901051	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123901051C>G	uc001pzp.1	+	1	722	c.722C>G	c.(721-723)GCC>GGC	p.A241G		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CAGACCTGTGCCTCCCACTGT	0.547													61	44	---	---	---	---	capture	Missense_Mutation	SNP	123901051	123901051	OR10G8	11	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	10807	159
CACNA1C	775	broad.mit.edu	37	12	2675631	2675631	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:2675631C>T	uc009zdu.1	+	12	1865	c.1552C>T	c.(1552-1554)CGC>TGC	p.R518C	CACNA1C_uc009zdv.1_Missense_Mutation_p.R515C|CACNA1C_uc001qkb.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkc.2_Missense_Mutation_p.R518C|CACNA1C_uc001qke.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkf.2_Missense_Mutation_p.R518C|CACNA1C_uc001qjz.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkd.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkg.2_Missense_Mutation_p.R518C|CACNA1C_uc009zdw.1_Missense_Mutation_p.R518C|CACNA1C_uc001qkh.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkl.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkn.2_Missense_Mutation_p.R518C|CACNA1C_uc001qko.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkp.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkr.2_Missense_Mutation_p.R518C|CACNA1C_uc001qku.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkq.2_Missense_Mutation_p.R518C|CACNA1C_uc001qks.2_Missense_Mutation_p.R518C|CACNA1C_uc001qkt.2_Missense_Mutation_p.R518C|CACNA1C_uc001qka.1_Missense_Mutation_p.R53C|CACNA1C_uc001qki.1_Missense_Mutation_p.R254C|CACNA1C_uc001qkj.1_Missense_Mutation_p.R254C|CACNA1C_uc001qkk.1_Missense_Mutation_p.R254C|CACNA1C_uc001qkm.1_Missense_Mutation_p.R254C|CACNA1C_uc009zdy.1_Missense_Mutation_p.R183C|CACNA1C_uc001qkv.1_Missense_Mutation_p.R88C	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	518	II.|Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	AAGGAAGTGCCGCGCCGCAGT	0.562													4	1	---	---	---	---	capture	Missense_Mutation	SNP	2675631	2675631	CACNA1C	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2516	159
CREBL2	1389	broad.mit.edu	37	12	12765120	12765120	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:12765120A>C	uc001rap.1	+	1	290	c.14A>C	c.(13-15)AAG>ACG	p.K5T		NM_001310	NP_001301	O60519	CRBL2_HUMAN	cAMP responsive element binding protein-like 2	5					cell cycle|signal transduction	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Prostate(47;0.0684)		BRCA - Breast invasive adenocarcinoma(232;0.0503)		GATGACAGTAAGGTAAGTCTT	0.677													47	36	---	---	---	---	capture	Missense_Mutation	SNP	12765120	12765120	CREBL2	12	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	3827	159
CNTN1	1272	broad.mit.edu	37	12	41410534	41410534	+	Silent	SNP	A	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:41410534A>T	uc001rmm.1	+	19	2348	c.2235A>T	c.(2233-2235)GCA>GCT	p.A745A	CNTN1_uc001rmn.1_Silent_p.A734A	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	745	Fibronectin type-III 2.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ACATAGTGGCATTTAAGCCAT	0.368													28	76	---	---	---	---	capture	Silent	SNP	41410534	41410534	CNTN1	12	A	T	T	T	1	0	0	0	0	0	0	0	1	93	8	4	4	3605	159
SRGAP1	57522	broad.mit.edu	37	12	64491111	64491111	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:64491111C>T	uc010ssp.1	+	15	1825	c.1769C>T	c.(1768-1770)CCC>CTC	p.P590L	SRGAP1_uc001srv.2_Missense_Mutation_p.P527L	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	590	Rho-GAP.				axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CTGGAAAACCCCCTCTTTCCT	0.378													55	33	---	---	---	---	capture	Missense_Mutation	SNP	64491111	64491111	SRGAP1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15037	159
PTPRB	5787	broad.mit.edu	37	12	70949684	70949684	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70949684C>T	uc001swb.3	-	17	4335	c.4305G>A	c.(4303-4305)GAG>GAA	p.E1435E	PTPRB_uc010sto.1_Silent_p.E1345E|PTPRB_uc010stp.1_Silent_p.E1345E|PTPRB_uc001swc.3_Silent_p.E1653E|PTPRB_uc001swa.3_Silent_p.E1565E	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1435	Fibronectin type-III 16.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTTCAACCACCTCGCTGGTCA	0.527													9	37	---	---	---	---	capture	Silent	SNP	70949684	70949684	PTPRB	12	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	12691	159
PABPC3	5042	broad.mit.edu	37	13	25671682	25671682	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25671682G>A	uc001upy.2	+	1	1407	c.1346G>A	c.(1345-1347)CGC>CAC	p.R449H		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	449					mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGTGCTATCCGCCCAGGTGCT	0.502													97	207	---	---	---	---	capture	Missense_Mutation	SNP	25671682	25671682	PABPC3	13	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11269	159
ATP8A2	51761	broad.mit.edu	37	13	26273468	26273468	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:26273468C>T	uc001uqk.2	+	25	2511	c.2369C>T	c.(2368-2370)GCG>GTG	p.A790V	ATP8A2_uc010tdi.1_Missense_Mutation_p.A750V|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.A340V	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	750	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TCGTGCAAAGCGGTCATATGC	0.522													29	37	---	---	---	---	capture	Missense_Mutation	SNP	26273468	26273468	ATP8A2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1184	159
RNASEH2B	79621	broad.mit.edu	37	13	51530575	51530575	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:51530575G>C	uc001vfa.3	+	11	1225	c.904G>C	c.(904-906)GGG>CGG	p.G302R	RNASEH2B_uc001vfb.3_Intron	NM_024570	NP_078846	Q5TBB1	RNH2B_HUMAN	ribonuclease H2, subunit B isoform 1	302					RNA catabolic process	nucleus|ribonuclease H2 complex					0		Acute lymphoblastic leukemia(7;1.03e-07)|Breast(56;0.00122)|Lung NSC(96;0.00143)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;9e-08)		TACCTTTTTTGGGGTAAAAAA	0.299													12	35	---	---	---	---	capture	Missense_Mutation	SNP	51530575	51530575	RNASEH2B	13	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	13305	159
PCDH20	64881	broad.mit.edu	37	13	61985658	61985658	+	Silent	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:61985658T>C	uc001vid.3	-	2	2938	c.2574A>G	c.(2572-2574)AGA>AGG	p.R858R	PCDH20_uc010thj.1_Silent_p.R858R	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	831	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CTGGTTCTTTTCTTAAAAGAC	0.408													25	95	---	---	---	---	capture	Silent	SNP	61985658	61985658	PCDH20	13	T	C	C	C	1	0	0	0	0	0	0	0	1	803	62	3	3	11418	159
MYO16	23026	broad.mit.edu	37	13	109859100	109859100	+	Silent	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:109859100T>C	uc001vqt.1	+	35	5619	c.5493T>C	c.(5491-5493)CCT>CCC	p.P1831P	MYO16_uc010agk.1_Silent_p.P1853P	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1831					cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCCCACCACCTTGCAAGAAGC	0.597													18	68	---	---	---	---	capture	Silent	SNP	109859100	109859100	MYO16	13	T	C	C	C	1	0	0	0	0	0	0	0	1	717	56	3	3	9974	159
FKBP3	2287	broad.mit.edu	37	14	45587256	45587256	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:45587256C>T	uc010tqf.1	-	6	668	c.595G>A	c.(595-597)GGA>AGA	p.G199R		NM_002013	NP_002004	Q00688	FKBP3_HUMAN	FK506 binding protein 3, 25kDa	199	PPIase FKBP-type.				protein folding	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|receptor activity				0						CCTTTCTTTCCGTAAGCCCAT	0.378													5	161	---	---	---	---	capture	Missense_Mutation	SNP	45587256	45587256	FKBP3	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5854	159
SPINT1	6692	broad.mit.edu	37	15	41146113	41146113	+	Missense_Mutation	SNP	C	T	T	rs145193299		TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41146113C>T	uc001zna.2	+	5	1151	c.947C>T	c.(946-948)GCG>GTG	p.A316V	SPINT1_uc001znb.2_Intron|SPINT1_uc001znc.2_Intron|SPINT1_uc010ucs.1_Missense_Mutation_p.A316V	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	316						extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GGGGCTCAGGCGACTTTCCCC	0.592													6	112	---	---	---	---	capture	Missense_Mutation	SNP	41146113	41146113	SPINT1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14960	159
PLA2G4D	283748	broad.mit.edu	37	15	42364081	42364081	+	Silent	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42364081G>A	uc001zox.2	-	15	1559	c.1464C>T	c.(1462-1464)GTC>GTT	p.V488V		NM_178034	NP_828848	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD	488	PLA2c.				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity			large_intestine(1)|skin(1)	2		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		TCAGGAAACCGACCTCATAGG	0.607													26	16	---	---	---	---	capture	Silent	SNP	42364081	42364081	PLA2G4D	15	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	11907	159
ATP8B4	79895	broad.mit.edu	37	15	50211036	50211036	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50211036C>A	uc001zxu.2	-	19	2177	c.2035G>T	c.(2035-2037)GAA>TAA	p.E679*	ATP8B4_uc010ber.2_Nonsense_Mutation_p.E552*|ATP8B4_uc010ufd.1_Nonsense_Mutation_p.E489*|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	679	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TTCAAGTTACCTTGTTTGTCT	0.318													35	83	---	---	---	---	capture	Nonsense_Mutation	SNP	50211036	50211036	ATP8B4	15	C	A	A	A	1	0	0	0	0	0	1	0	0	312	24	5	4	1188	159
ADAM10	102	broad.mit.edu	37	15	58925426	58925426	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:58925426G>A	uc002afd.1	-	9	1589	c.1145C>T	c.(1144-1146)GCT>GTT	p.A382V	ADAM10_uc010bgc.1_RNA|ADAM10_uc010ugz.1_Missense_Mutation_p.A81V|ADAM10_uc002afe.1_Intron	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor	382	Peptidase M12B.|Extracellular (Potential).				cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		AACTTCGTGAGCAAAAGTAAT	0.328													3	46	---	---	---	---	capture	Missense_Mutation	SNP	58925426	58925426	ADAM10	15	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	234	159
TMEM202	338949	broad.mit.edu	37	15	72700088	72700088	+	Missense_Mutation	SNP	G	A	A	rs143076809		TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72700088G>A	uc002auq.2	+	5	676	c.676G>A	c.(676-678)GTC>ATC	p.V226I	TMEM202_uc002aur.2_RNA	NM_001080462	NP_001073931	A6NGA9	TM202_HUMAN	transmembrane protein 202	226						integral to membrane				central_nervous_system(1)|skin(1)	2						TGATGAAAACGTCACTGTGAT	0.478													52	40	---	---	---	---	capture	Missense_Mutation	SNP	72700088	72700088	TMEM202	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16010	159
SCAMP5	192683	broad.mit.edu	37	15	75305137	75305137	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75305137C>T	uc002azk.1	+	3	289	c.127C>T	c.(127-129)CTC>TTC	p.L43F	SCAMP5_uc002azl.1_Missense_Mutation_p.L43F|SCAMP5_uc002azm.1_Missense_Mutation_p.L43F|SCAMP5_uc002azn.1_Missense_Mutation_p.L43F|SCAMP5_uc010uly.1_Missense_Mutation_p.P24L	NM_138967	NP_620417	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	43	Helical; (Potential).				exocytosis|negative regulation of endocytosis|positive regulation of calcium ion-dependent exocytosis|positive regulation of cytokine secretion|protein transport|response to endoplasmic reticulum stress	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						CCTCTACTACCTCTGGATGTG	0.607													22	29	---	---	---	---	capture	Missense_Mutation	SNP	75305137	75305137	SCAMP5	15	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	13766	159
CORO1A	11151	broad.mit.edu	37	16	30198720	30198720	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30198720C>T	uc002dww.2	+	6	776	c.654C>T	c.(652-654)CAC>CAT	p.H218H	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CORO1A_uc010bzq.2_Silent_p.H218H|CORO1A_uc010bzr.2_Silent_p.H218H|CORO1A_uc002dwx.2_Silent_p.H112H|CORO1A_uc002dwy.1_Silent_p.H62H|LOC606724_uc002dwz.1_5'Flank	NM_007074	NP_009005	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	218	WD 5.				cell-substrate adhesion|innate immune response|leukocyte chemotaxis|negative regulation of actin nucleation|phagolysosome assembly|positive chemotaxis|regulation of cell shape|uropod organization	actin filament|cortical actin cytoskeleton|lamellipodium|phagocytic cup|phagocytic vesicle membrane	actin filament binding|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein homodimerization activity				0						ACCGTCCCCACGAGGGGACCC	0.667													34	24	---	---	---	---	capture	Silent	SNP	30198720	30198720	CORO1A	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3718	159
ARMC5	79798	broad.mit.edu	37	16	31471307	31471307	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31471307C>T	uc002ecc.2	+	1	991	c.462C>T	c.(460-462)GGC>GGT	p.G154G	ARMC5_uc010vfn.1_Silent_p.G249G|ARMC5_uc010vfo.1_Silent_p.G186G|ARMC5_uc002eca.3_Silent_p.G154G|ARMC5_uc010vfp.1_Silent_p.G154G|ARMC5_uc002ecb.2_Silent_p.G154G	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN	armadillo repeat containing 5 isoform a	154	ARM 1.						binding			pancreas(1)	1						GACTCGGAGGCATACTCCCTT	0.597													42	75	---	---	---	---	capture	Silent	SNP	31471307	31471307	ARMC5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	947	159
LRRC50	123872	broad.mit.edu	37	16	84203678	84203678	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84203678C>T	uc002fhl.3	+	8	1425	c.1244C>T	c.(1243-1245)ACC>ATC	p.T415I	LRRC50_uc010vnw.1_Missense_Mutation_p.T179I	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50	415	Pro-rich.				axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						CCAGAGGGGACCCTCCCAGCT	0.617									Kartagener_syndrome				15	63	---	---	---	---	capture	Missense_Mutation	SNP	84203678	84203678	LRRC50	16	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	8924	159
TP53	7157	broad.mit.edu	37	17	7578268	7578268	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578268A>C	uc002gim.2	-	6	775	c.581T>G	c.(580-582)CTT>CGT	p.L194R	TP53_uc002gig.1_Missense_Mutation_p.L194R|TP53_uc002gih.2_Missense_Mutation_p.L194R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.L62R|TP53_uc010cng.1_Missense_Mutation_p.L62R|TP53_uc002gii.1_Missense_Mutation_p.L62R|TP53_uc010cnh.1_Missense_Mutation_p.L194R|TP53_uc010cni.1_Missense_Mutation_p.L194R|TP53_uc002gij.2_Missense_Mutation_p.L194R|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.L101R|TP53_uc002gio.2_Missense_Mutation_p.L62R|TP53_uc010vug.1_Missense_Mutation_p.L155R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	194	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		L -> H (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> F (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.L194R(31)|p.L194F(16)|p.L194P(8)|p.0?(7)|p.L194H(5)|p.L194L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191fs*53(2)|p.L194fs*15(2)|p.K164_P219del(1)|p.A189fs*53(1)|p.L194V(1)|p.L194fs*14(1)|p.P191fs*6(1)|p.I195fs*52(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.L194I(1)|p.L194fs*52(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CACTCGGATAAGATGCTGAGG	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			12	71	---	---	---	---	capture	Missense_Mutation	SNP	7578268	7578268	TP53	17	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	16264	159
TP53	7157	broad.mit.edu	37	17	7578542	7578542	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578542G>A	uc002gim.2	-	5	582	c.388C>T	c.(388-390)CTC>TTC	p.L130F	TP53_uc002gig.1_Missense_Mutation_p.L130F|TP53_uc002gih.2_Missense_Mutation_p.L130F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'UTR|TP53_uc010cng.1_5'UTR|TP53_uc002gii.1_5'UTR|TP53_uc010cnh.1_Missense_Mutation_p.L130F|TP53_uc010cni.1_Missense_Mutation_p.L130F|TP53_uc002gij.2_Missense_Mutation_p.L130F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.L37F|TP53_uc002gio.2_5'UTR|TP53_uc010vug.1_Missense_Mutation_p.L91F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	130	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		L -> H (in sporadic cancers; somatic mutation).|L -> F (in sporadic cancers; somatic mutation).|L -> I (in a sporadic cancer; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.L130V(11)|p.L130F(7)|p.L130R(7)|p.0?(7)|p.Y126_K132delYSPALNK(6)|p.L130L(4)|p.L130H(3)|p.Y126_N131delYSPALN(3)|p.L130fs*19(2)|p.L130fs*41(2)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.A129_L130insXX(1)|p.A129_N131delALN(1)|p.L130P(1)|p.V73fs*9(1)|p.Y126fs*18(1)|p.L130fs*39(1)|p.L130fs*16(1)|p.A129_K132delALNK(1)|p.L130_M133delLNKM(1)|p.N131fs*27(1)|p.P13fs*18(1)|p.S127fs*36(1)|p.L130del(1)|p.L130fs*40(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATCTTGTTGAGGGCAGGGGAG	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			25	17	---	---	---	---	capture	Missense_Mutation	SNP	7578542	7578542	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	16264	159
RCVRN	5957	broad.mit.edu	37	17	9808118	9808118	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9808118A>G	uc002gme.1	-	1	567	c.380T>C	c.(379-381)ATG>ACG	p.M127T		NM_002903	NP_002894	P35243	RECO_HUMAN	recoverin	127	EF-hand 3.				visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						GAGACTGACCATGACGATCTC	0.642													38	115	---	---	---	---	capture	Missense_Mutation	SNP	9808118	9808118	RCVRN	17	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	13081	159
MYH4	4622	broad.mit.edu	37	17	10358321	10358321	+	Missense_Mutation	SNP	C	T	T	rs144778193	by1000genomes	TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10358321C>T	uc002gmn.2	-	21	2483	c.2372G>A	c.(2371-2373)CGC>CAC	p.R791H	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	791	IQ.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GGCTTGAGTGCGCGTGATGAG	0.463													4	69	---	---	---	---	capture	Missense_Mutation	SNP	10358321	10358321	MYH4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9947	159
MYH1	4619	broad.mit.edu	37	17	10419368	10419368	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10419368T>A	uc002gmo.2	-	5	474	c.380A>T	c.(379-381)AAC>ATC	p.N127I	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	127	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						CTTGTAGGGGTTGACAGTGAC	0.488													93	43	---	---	---	---	capture	Missense_Mutation	SNP	10419368	10419368	MYH1	17	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	9939	159
ACCN1	40	broad.mit.edu	37	17	31341024	31341024	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:31341024G>T	uc002hhu.2	-	10	1772	c.1498C>A	c.(1498-1500)CTG>ATG	p.L500M	ACCN1_uc002hht.2_Missense_Mutation_p.L551M	NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	500	Cytoplasmic (By similarity).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GTCGTCTGCAGGGGCACGTTC	0.557													14	5	---	---	---	---	capture	Missense_Mutation	SNP	31341024	31341024	ACCN1	17	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	128	159
ERBB2	2064	broad.mit.edu	37	17	37866667	37866667	+	Silent	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37866667G>A	uc002hso.2	+	7	1072	c.834G>A	c.(832-834)ACG>ACA	p.T278T	ERBB2_uc002hsm.2_Silent_p.T248T|ERBB2_uc010cwa.2_Silent_p.T263T|ERBB2_uc002hsp.2_Silent_p.T81T|ERBB2_uc010cwb.2_Silent_p.T278T|ERBB2_uc010wek.1_Intron|ERBB2_uc002hsl.2_Silent_p.T248T|ERBB2_uc002hsn.1_Silent_p.T278T	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	278	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	ACACAGACACGTTTGAGTCCA	0.582		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			62	35	---	---	---	---	capture	Silent	SNP	37866667	37866667	ERBB2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	5161	159
DNAH17	8632	broad.mit.edu	37	17	76457727	76457727	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76457727C>T	uc010dhp.1	-	3	460	c.238G>A	c.(238-240)GCA>ACA	p.A80T	DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGTTGGTCTGCGCTCTCATTC	0.527													16	5	---	---	---	---	capture	Missense_Mutation	SNP	76457727	76457727	DNAH17	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4558	159
DSG3	1830	broad.mit.edu	37	18	29046572	29046572	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29046572C>T	uc002kws.2	+	11	1600	c.1491C>T	c.(1489-1491)CTC>CTT	p.L497L		NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	497	Cadherin 4.|Extracellular (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CAGCTGTCCTCGAAAAAGATG	0.418													84	100	---	---	---	---	capture	Silent	SNP	29046572	29046572	DSG3	18	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	4733	159
DSG3	1830	broad.mit.edu	37	18	29055684	29055684	+	Missense_Mutation	SNP	G	A	A	rs148716637		TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29055684G>A	uc002kws.2	+	16	2570	c.2461G>A	c.(2461-2463)GCA>ACA	p.A821T	DSG3_uc002kwt.2_Missense_Mutation_p.A103T	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	821	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TAATGAAGGCGCAGATGCCAC	0.468													73	53	---	---	---	---	capture	Missense_Mutation	SNP	29055684	29055684	DSG3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4733	159
SERPINB12	89777	broad.mit.edu	37	18	61232706	61232706	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61232706C>T	uc010xen.1	+	6	674	c.674C>T	c.(673-675)ACG>ATG	p.T225M	SERPINB12_uc010xeo.1_Missense_Mutation_p.T245M	NM_080474	NP_536722	Q96P63	SPB12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	225					negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity				0						AAGATGATGACGCAAAAAGGC	0.488													32	86	---	---	---	---	capture	Missense_Mutation	SNP	61232706	61232706	SERPINB12	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13992	159
VMAC	400673	broad.mit.edu	37	19	5909016	5909016	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5909016G>A	uc002mds.3	+	2	423	c.373G>A	c.(373-375)GAG>AAG	p.E125K		NM_001017921	NP_001017921	Q2NL98	VMAC_HUMAN	vimentin-type IF-associated coiled-coil protein	125						cytoplasm					0						GGCTGAGGCTGAGCGCCTGGG	0.721													4	5	---	---	---	---	capture	Missense_Mutation	SNP	5909016	5909016	VMAC	19	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	17058	159
LASS4	79603	broad.mit.edu	37	19	8316117	8316117	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8316117C>T	uc002mjg.2	+	3	477	c.157C>T	c.(157-159)CGC>TGC	p.R53C	LASS4_uc002mjh.2_Missense_Mutation_p.R2C|LASS4_uc002mji.2_Intron|LASS4_uc010dvz.2_Missense_Mutation_p.R53C	NM_024552	NP_078828	Q9HA82	CERS4_HUMAN	LAG1 homolog, ceramide synthase 4	53						endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(1)	1						CCTGGCCATGCGCCTTGCCTT	0.627													4	206	---	---	---	---	capture	Missense_Mutation	SNP	8316117	8316117	LASS4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8561	159
MUC16	94025	broad.mit.edu	37	19	8966765	8966765	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8966765C>T	uc002mkp.2	-	81	43392	c.43188G>A	c.(43186-43188)TCG>TCA	p.S14396S	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.S1196S|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAGCCAGTGGCGAGAAGTTAC	0.527													5	14	---	---	---	---	capture	Silent	SNP	8966765	8966765	MUC16	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9883	159
MUC16	94025	broad.mit.edu	37	19	9057573	9057573	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9057573G>A	uc002mkp.2	-	3	30077	c.29873C>T	c.(29872-29874)ACC>ATC	p.T9958I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9960	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACTTTTTTGGGTGGTGATGGT	0.488													142	341	---	---	---	---	capture	Missense_Mutation	SNP	9057573	9057573	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9883	159
ZNF443	10224	broad.mit.edu	37	19	12543219	12543219	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12543219G>T	uc002mtu.2	-	3	361	c.163C>A	c.(163-165)CAA>AAA	p.Q55K		NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	55	KRAB.				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						TATCTATATTGATCTTCAATG	0.294													45	69	---	---	---	---	capture	Missense_Mutation	SNP	12543219	12543219	ZNF443	19	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	17796	159
OR7A17	26333	broad.mit.edu	37	19	14991689	14991689	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14991689C>A	uc010xob.1	-	1	479	c.479G>T	c.(478-480)AGC>ATC	p.S160I		NM_030901	NP_112163	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A,	160	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					TACCATTAAGCTTTGTGACAA	0.483													67	130	---	---	---	---	capture	Missense_Mutation	SNP	14991689	14991689	OR7A17	19	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	11119	159
ZNF208	7757	broad.mit.edu	37	19	22155210	22155210	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22155210G>T	uc002nqp.2	-	5	2475	c.2326C>A	c.(2326-2328)CTT>ATT	p.L776I	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGATAACTAAGGGTTGAGGGC	0.363													40	97	---	---	---	---	capture	Missense_Mutation	SNP	22155210	22155210	ZNF208	19	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	17646	159
MAG	4099	broad.mit.edu	37	19	35801000	35801000	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35801000C>T	uc002nyy.1	+	8	1604	c.1455C>T	c.(1453-1455)CGC>CGT	p.R485R	MAG_uc002nyx.1_Silent_p.R485R|MAG_uc010eds.1_Silent_p.R460R|MAG_uc002nyz.1_Silent_p.R485R	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	485	Ig-like C2-type 4.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCCCGCCCCGCGTCATCTGCA	0.697													10	28	---	---	---	---	capture	Silent	SNP	35801000	35801000	MAG	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9076	159
CGB7	94027	broad.mit.edu	37	19	49557640	49557640	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49557640G>A	uc002pmd.2	-	3	771	c.406C>T	c.(406-408)CAG>TAG	p.Q136*	CGB_uc010yad.1_Intron|CGB8_uc002pmc.2_Intron|CGB7_uc002pme.2_Nonsense_Mutation_p.Q136*	NM_033142	NP_149133	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 7	136					apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	GAGGAGGCCTGGAAGCGGGGG	0.647													24	32	---	---	---	---	capture	Nonsense_Mutation	SNP	49557640	49557640	CGB7	19	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	3266	159
ZNF28	7576	broad.mit.edu	37	19	53304049	53304049	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53304049G>T	uc002qad.2	-	4	1169	c.1049C>A	c.(1048-1050)ACT>AAT	p.T350N	ZNF28_uc002qac.2_Missense_Mutation_p.T297N|ZNF28_uc010eqe.2_Missense_Mutation_p.T296N	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	350					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TTTCTCTCCAGTGTGAATTAT	0.373													61	55	---	---	---	---	capture	Missense_Mutation	SNP	53304049	53304049	ZNF28	19	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	17693	159
NLRP7	199713	broad.mit.edu	37	19	55451268	55451268	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55451268T>C	uc002qih.3	-	4	995	c.919A>G	c.(919-921)AGG>GGG	p.R307G	NLRP7_uc002qig.3_Missense_Mutation_p.R307G|NLRP7_uc002qii.3_Missense_Mutation_p.R307G|NLRP7_uc010esk.2_Missense_Mutation_p.R307G|NLRP7_uc010esl.2_Missense_Mutation_p.R335G	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	307	NACHT.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		TGGAGGTCCCTCAGTGCCCTG	0.617													12	23	---	---	---	---	capture	Missense_Mutation	SNP	55451268	55451268	NLRP7	19	T	C	C	C	1	0	0	0	0	1	0	0	0	700	54	3	3	10389	159
NLRP5	126206	broad.mit.edu	37	19	56549462	56549462	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56549462T>C	uc002qmj.2	+	10	2687	c.2687T>C	c.(2686-2688)CTG>CCG	p.L896P	NLRP5_uc002qmi.2_Missense_Mutation_p.L877P	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	896	LRR 7.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TCCCCCAGCCTGAAATCTCTG	0.547													3	101	---	---	---	---	capture	Missense_Mutation	SNP	56549462	56549462	NLRP5	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	10387	159
NCOA1	8648	broad.mit.edu	37	2	24929877	24929877	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:24929877C>T	uc002rfk.2	+	11	1796	c.1538C>T	c.(1537-1539)TCG>TTG	p.S513L	NCOA1_uc010eye.2_Missense_Mutation_p.S513L|NCOA1_uc002rfi.2_Missense_Mutation_p.S362L|NCOA1_uc002rfj.2_Missense_Mutation_p.S513L|NCOA1_uc002rfl.2_Missense_Mutation_p.S513L	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	513	Interaction with STAT3.|Ser-rich.								PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTAATATTTCGACATTAAGC	0.418			T	PAX3	alveolar rhadomyosarcoma								37	93	---	---	---	---	capture	Missense_Mutation	SNP	24929877	24929877	NCOA1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10135	159
FAM179A	165186	broad.mit.edu	37	2	29268218	29268218	+	Silent	SNP	T	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:29268218T>A	uc010ezl.2	+	19	3015	c.2664T>A	c.(2662-2664)GCT>GCA	p.A888A	FAM179A_uc010ymm.1_Silent_p.A833A|FAM179A_uc002rmr.3_Silent_p.A415A|FAM179A_uc002rms.1_Silent_p.A186A	NM_199280	NP_954974	Q6ZUX3	F179A_HUMAN	hypothetical protein LOC165186	888							binding			ovary(3)|skin(1)	4						CAGCGCTTGCTGGGCGAGTGC	0.627													25	85	---	---	---	---	capture	Silent	SNP	29268218	29268218	FAM179A	2	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	5457	159
CYP1B1	1545	broad.mit.edu	37	2	38302345	38302345	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:38302345C>T	uc002rqo.2	-	3	590	c.187G>A	c.(187-189)GCG>ACG	p.A63T		NM_000104	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B,	63					visual perception|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			ovary(1)|central_nervous_system(1)	2		all_hematologic(82;0.21)			Estrone(DB00655)	ACCGCCGCCGCGTTTCCGATC	0.721													4	4	---	---	---	---	capture	Missense_Mutation	SNP	38302345	38302345	CYP1B1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4111	159
ALMS1	7840	broad.mit.edu	37	2	73651879	73651879	+	Silent	SNP	T	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73651879T>A	uc002sje.1	+	6	1200	c.1089T>A	c.(1087-1089)GCT>GCA	p.A363A	ALMS1_uc002sjf.1_Silent_p.A320A	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	362					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						ACAATTTAGCTGATAAAGATC	0.358													23	58	---	---	---	---	capture	Silent	SNP	73651879	73651879	ALMS1	2	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	535	159
DQX1	165545	broad.mit.edu	37	2	74747143	74747143	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74747143C>T	uc010yrw.1	-	9	1679	c.1514G>A	c.(1513-1515)CGT>CAT	p.R505H	DQX1_uc002smc.2_Missense_Mutation_p.R66H	NM_133637	NP_598376	Q8TE96	DQX1_HUMAN	DEAQ box polypeptide 1 (RNA-dependent ATPase)	505						nucleus	ATP binding|helicase activity|nucleic acid binding			ovary(2)	2						GAGTGGAGGACGGGTAAACCC	0.527													27	78	---	---	---	---	capture	Missense_Mutation	SNP	74747143	74747143	DQX1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4706	159
MRPL30	51263	broad.mit.edu	37	2	99811636	99811636	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:99811636G>C	uc002szu.2	+	5	499	c.337G>C	c.(337-339)GTT>CTT	p.V113L	MRPL30_uc002szl.1_RNA|MRPL30_uc002szr.2_Missense_Mutation_p.V113L|MRPL30_uc002szt.1_RNA|MRPL30_uc002szv.2_Missense_Mutation_p.V113L	NM_145213	NP_660214	Q8TCC3	RM30_HUMAN	RecName: Full=39S ribosomal protein L30, mitochondrial;          Short=L30mt; AltName: Full=MRP-L30; AltName: Full=MRP-L28; Flags: Precursor;	113					translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1						ATTGAAAGTAGTTAAGCATTT	0.333													34	92	---	---	---	---	capture	Missense_Mutation	SNP	99811636	99811636	MRPL30	2	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	9704	159
IL1F6	27179	broad.mit.edu	37	2	113763644	113763644	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113763644G>A	uc010yxr.1	+	2	104	c.104G>A	c.(103-105)AGG>AAG	p.R35K		NM_014440	NP_055255	Q9UHA7	IL36A_HUMAN	interleukin 1 family, member 6 (epsilon)	35					immune response|inflammatory response	extracellular space	cytokine activity|interleukin-1 receptor binding				0						GCAGTCCCGAGGAAGGACCGT	0.512													21	44	---	---	---	---	capture	Missense_Mutation	SNP	113763644	113763644	IL1F6	2	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	7577	159
THSD7B	80731	broad.mit.edu	37	2	138420998	138420998	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:138420998T>C	uc002tva.1	+	25	4417	c.4417T>C	c.(4417-4419)TCA>CCA	p.S1473P	THSD7B_uc010zbj.1_RNA	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GATAATGAAATCAAATGGTTT	0.383													2	8	---	---	---	---	capture	Missense_Mutation	SNP	138420998	138420998	THSD7B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	15765	159
XIRP2	129446	broad.mit.edu	37	2	168106391	168106391	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168106391G>A	uc002udx.2	+	8	8507	c.8489G>A	c.(8488-8490)CGA>CAA	p.R2830Q	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.R2655Q|XIRP2_uc010fpq.2_Missense_Mutation_p.R2608Q|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.R176Q	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2655					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATGATTGGTCGAAAAGAAGAG	0.398													28	69	---	---	---	---	capture	Missense_Mutation	SNP	168106391	168106391	XIRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17311	159
TTN	7273	broad.mit.edu	37	2	179431720	179431720	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179431720A>G	uc010zfg.1	-	275	71659	c.71435T>C	c.(71434-71436)ATG>ACG	p.M23812T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.M17507T|TTN_uc010zfi.1_Missense_Mutation_p.M17440T|TTN_uc010zfj.1_Missense_Mutation_p.M17315T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24739							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGATTTTTCATTAGTACTGG	0.403													57	117	---	---	---	---	capture	Missense_Mutation	SNP	179431720	179431720	TTN	2	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	16617	159
TTN	7273	broad.mit.edu	37	2	179456867	179456867	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179456867C>T	uc010zfg.1	-	251	52284	c.52060G>A	c.(52060-52062)GCC>ACC	p.A17354T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A11049T|TTN_uc010zfi.1_Missense_Mutation_p.A10982T|TTN_uc010zfj.1_Missense_Mutation_p.A10857T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18281							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACCACTGGGCGCTGGCAACA	0.448													13	29	---	---	---	---	capture	Missense_Mutation	SNP	179456867	179456867	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16617	159
TTN	7273	broad.mit.edu	37	2	179579856	179579856	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179579856C>T	uc010zfg.1	-	87	22549	c.22325G>A	c.(22324-22326)GGC>GAC	p.G7442D	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G4103D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8369							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTACTTCTTGCCGCTCCTAAG	0.443													6	290	---	---	---	---	capture	Missense_Mutation	SNP	179579856	179579856	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16617	159
SMARCAL1	50485	broad.mit.edu	37	2	217329391	217329391	+	Splice_Site	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:217329391G>A	uc002vgc.3	+	13	2471	c.2141_splice	c.e13+1	p.I714_splice	SMARCAL1_uc010fvf.2_Splice_Site|SMARCAL1_uc002vgd.3_Splice_Site_p.I714_splice|SMARCAL1_uc010fvg.2_Splice_Site_p.I692_splice	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated						chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CATCTGTCATGTAAGTGGTCA	0.363									Schimke_Immuno-Osseous_Dysplasia				72	55	---	---	---	---	capture	Splice_Site	SNP	217329391	217329391	SMARCAL1	2	G	A	A	A	1	0	0	0	0	0	0	1	0	624	48	5	2	14665	159
BPIL3	128859	broad.mit.edu	37	20	31630672	31630672	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31630672C>A	uc010zuc.1	+	13	1240	c.1240C>A	c.(1240-1242)CCA>ACA	p.P414T	BPIL3_uc010zud.1_Missense_Mutation_p.P353T	NM_174897	NP_777557	Q8NFQ5	BPIL3_HUMAN	bactericidal/permeability-increasing	414						extracellular region	lipid binding			ovary(1)|pancreas(1)	2						AGCCTACATCCCAGTTGTCAA	0.473													48	44	---	---	---	---	capture	Missense_Mutation	SNP	31630672	31630672	BPIL3	20	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	1481	159
CBFA2T2	9139	broad.mit.edu	37	20	32232172	32232172	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:32232172G>A	uc002wzg.1	+	12	2072	c.1535G>A	c.(1534-1536)CGC>CAC	p.R512H	CBFA2T2_uc010zug.1_Missense_Mutation_p.R286H|CBFA2T2_uc002wze.1_Missense_Mutation_p.R503H|CBFA2T2_uc002wzf.1_RNA|CBFA2T2_uc002wzh.1_Missense_Mutation_p.R483H|CBFA2T2_uc002wzi.1_RNA|CBFA2T2_uc002wzj.1_RNA|CBFA2T2_uc002wzk.1_Missense_Mutation_p.R60H	NM_005093	NP_005084	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit	512						nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2						AACTGTGGCCGCAAAGCCAGC	0.542													3	69	---	---	---	---	capture	Missense_Mutation	SNP	32232172	32232172	CBFA2T2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2673	159
TSHZ2	128553	broad.mit.edu	37	20	51870661	51870661	+	Missense_Mutation	SNP	G	A	A	rs141167641	by1000genomes	TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51870661G>A	uc002xwo.2	+	2	1620	c.664G>A	c.(664-666)GCG>ACG	p.A222T		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	222	C2H2-type 1.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.A222T(1)		ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			ACAGTGCAGCGCGGCCTATGA	0.562													7	40	---	---	---	---	capture	Missense_Mutation	SNP	51870661	51870661	TSHZ2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16507	159
GRIK1	2897	broad.mit.edu	37	21	30949385	30949385	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:30949385C>G	uc002yno.1	-	14	2493	c.2029G>C	c.(2029-2031)GAG>CAG	p.E677Q	GRIK1_uc002ynn.2_Missense_Mutation_p.E662Q|GRIK1_uc011acs.1_Missense_Mutation_p.E677Q|GRIK1_uc011act.1_Missense_Mutation_p.E538Q	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	677	Extracellular (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	TCCATTCTCTCTACTGTCAAG	0.448													82	92	---	---	---	---	capture	Missense_Mutation	SNP	30949385	30949385	GRIK1	21	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	6706	159
C21orf29	54084	broad.mit.edu	37	21	45949800	45949800	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45949800T>C	uc002zfe.1	-	5	737	c.671A>G	c.(670-672)GAC>GGC	p.D224G	C21orf29_uc010gpv.1_Missense_Mutation_p.D156G	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	224					cell adhesion	extracellular region	structural molecule activity				0						TGGGGTGGCGTCTGAGCCCGG	0.677													20	27	---	---	---	---	capture	Missense_Mutation	SNP	45949800	45949800	C21orf29	21	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	2105	159
ALS2CL	259173	broad.mit.edu	37	3	46720751	46720751	+	Silent	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46720751G>A	uc003cqa.1	-	15	1765	c.1575C>T	c.(1573-1575)GAC>GAT	p.D525D	ALS2CL_uc003cpx.1_5'Flank|ALS2CL_uc003cpy.1_5'Flank|ALS2CL_uc003cpz.1_Silent_p.D40D|ALS2CL_uc003cqb.1_Silent_p.D525D|ALS2CL_uc003cqc.1_RNA	NM_147129	NP_667340	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like isoform 1	525	MORN 7.				endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)|central_nervous_system(2)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		ACAGGGAGTCGTCTTCAGAGA	0.627													8	11	---	---	---	---	capture	Silent	SNP	46720751	46720751	ALS2CL	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	551	159
MORC1	27136	broad.mit.edu	37	3	108778663	108778663	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108778663C>A	uc003dxl.2	-	12	1108	c.1021G>T	c.(1021-1023)GAG>TAG	p.E341*	MORC1_uc011bhn.1_Nonsense_Mutation_p.E341*	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	341	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						CTTTGTTTCTCTTTAAGATTC	0.368													21	41	---	---	---	---	capture	Nonsense_Mutation	SNP	108778663	108778663	MORC1	3	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	9613	159
GOLGB1	2804	broad.mit.edu	37	3	121410932	121410932	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121410932C>T	uc003eei.3	-	14	7390	c.7264G>A	c.(7264-7266)GAG>AAG	p.E2422K	GOLGB1_uc010hrc.2_Missense_Mutation_p.E2427K|GOLGB1_uc003eej.3_Missense_Mutation_p.E2388K	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2422	Cytoplasmic (Potential).|Potential.|Poly-Glu.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		ATATTCTCCTCTTCCTCCTGG	0.398													96	106	---	---	---	---	capture	Missense_Mutation	SNP	121410932	121410932	GOLGB1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	6499	159
CASR	846	broad.mit.edu	37	3	122004023	122004023	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122004023C>T	uc003eev.3	+	7	3594	c.3222C>T	c.(3220-3222)AAC>AAT	p.N1074N	CASR_uc003eew.3_Silent_p.N1084N	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	1074	Cytoplasmic (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TTACAGAAAACGTAGTGAATT	0.522													64	103	---	---	---	---	capture	Silent	SNP	122004023	122004023	CASR	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2658	159
TLR1	7096	broad.mit.edu	37	4	38798595	38798595	+	Missense_Mutation	SNP	G	A	A	rs144775976	byFrequency	TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38798595G>A	uc003gtl.2	-	4	2132	c.1858C>T	c.(1858-1860)CGG>TGG	p.R620W		NM_003263	NP_003254	Q15399	TLR1_HUMAN	toll-like receptor 1 precursor	620	Cytoplasmic (Potential).				cellular response to triacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|inflammatory response|innate immune response|macrophage activation|positive regulation of interleukin-6 biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	integral to plasma membrane|phagocytic vesicle membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	protein heterodimerization activity|transmembrane receptor activity			lung(2)|skin(2)|prostate(1)	5						GCCCTGCGCCGGGTCTGGGTC	0.517													91	108	---	---	---	---	capture	Missense_Mutation	SNP	38798595	38798595	TLR1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	15834	159
PDGFRA	5156	broad.mit.edu	37	4	55138611	55138611	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55138611G>A	uc003han.3	+	9	1619	c.1288G>A	c.(1288-1290)GGA>AGA	p.G430R	PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Missense_Mutation_p.G324R|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	430	Ig-like C2-type 5.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CTCAACTGGGGGACAGACGGT	0.473			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			554	203	---	---	---	---	capture	Missense_Mutation	SNP	55138611	55138611	PDGFRA	4	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11564	159
PDGFRA	5156	broad.mit.edu	37	4	55138664	55138664	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55138664G>C	uc003han.3	+	9	1672	c.1341G>C	c.(1339-1341)TGG>TGC	p.W447C	PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Missense_Mutation_p.W341C|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	447	Ig-like C2-type 5.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	ATATTGAGTGGATGATATGCA	0.438			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			442	193	---	---	---	---	capture	Missense_Mutation	SNP	55138664	55138664	PDGFRA	4	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	11564	159
FRAS1	80144	broad.mit.edu	37	4	79418093	79418093	+	Silent	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79418093C>A	uc003hlb.2	+	60	9533	c.9093C>A	c.(9091-9093)ATC>ATA	p.I3031I	FRAS1_uc003hlc.1_Silent_p.I33I	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	3026	Calx-beta 5.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TGGCCACCATCACCATATCCA	0.408													4	123	---	---	---	---	capture	Silent	SNP	79418093	79418093	FRAS1	4	C	A	A	A	1	0	0	0	0	0	0	0	1	369	29	4	4	5986	159
LARP7	51574	broad.mit.edu	37	4	113568448	113568448	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113568448G>A	uc003iay.2	+	7	1018	c.740G>A	c.(739-741)AGC>AAC	p.S247N	LARP7_uc003iaz.2_Missense_Mutation_p.S254N|LARP7_uc003iba.2_Missense_Mutation_p.S168N|LARP7_uc003ibb.2_Missense_Mutation_p.S247N	NM_016648	NP_057732	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	247	Lys-rich.				RNA processing	nucleoplasm|ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(3)	3		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		agcaacaCCAGCATCAGTAAA	0.234													3	57	---	---	---	---	capture	Missense_Mutation	SNP	113568448	113568448	LARP7	4	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	8553	159
ARFIP1	27236	broad.mit.edu	37	4	153809448	153809448	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:153809448G>A	uc003imz.2	+	8	1231	c.955G>A	c.(955-957)GAA>AAA	p.E319K	ARFIP1_uc003inb.2_Missense_Mutation_p.E287K|ARFIP1_uc003ina.2_Missense_Mutation_p.E287K|ARFIP1_uc003inc.2_Missense_Mutation_p.E319K|ARFIP1_uc011cij.1_Missense_Mutation_p.E139K	NM_001025595	NP_001020766	P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	319	AH.				intracellular protein transport|regulation of protein secretion	cytosol|Golgi membrane				ovary(1)	1	all_hematologic(180;0.093)					GAAATTTCTAGAAGAAAATAA	0.353													19	21	---	---	---	---	capture	Missense_Mutation	SNP	153809448	153809448	ARFIP1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	847	159
ACCN5	51802	broad.mit.edu	37	4	156764950	156764950	+	Silent	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:156764950G>A	uc003ipe.1	-	5	791	c.744C>T	c.(742-744)TTC>TTT	p.F248F		NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,	248	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)		CAGCATCAACGAAACCAAGGG	0.413													34	50	---	---	---	---	capture	Silent	SNP	156764950	156764950	ACCN5	4	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	132	159
FSTL5	56884	broad.mit.edu	37	4	162459448	162459448	+	Silent	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:162459448A>G	uc003iqh.2	-	10	1618	c.1182T>C	c.(1180-1182)AAT>AAC	p.N394N	FSTL5_uc003iqi.2_Silent_p.N393N|FSTL5_uc010iqv.2_Silent_p.N393N	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	394	Ig-like 2.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CCTCACTGCCATTTGCTGAAA	0.408													115	127	---	---	---	---	capture	Silent	SNP	162459448	162459448	FSTL5	4	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	6022	159
IRX2	153572	broad.mit.edu	37	5	2749779	2749779	+	Silent	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:2749779G>A	uc003jda.2	-	2	614	c.372C>T	c.(370-372)GAC>GAT	p.D124D	C5orf38_uc003jdc.2_5'Flank|C5orf38_uc011cmg.1_5'Flank|C5orf38_uc011cmh.1_5'Flank|C5orf38_uc011cmi.1_5'Flank|C5orf38_uc011cmj.1_5'Flank|IRX2_uc003jdb.2_Silent_p.D124D	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	124	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1				GBM - Glioblastoma multiforme(108;0.204)		TGGCCGTGGCGTCCCGCGTGG	0.652													42	51	---	---	---	---	capture	Silent	SNP	2749779	2749779	IRX2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7767	159
BDP1	55814	broad.mit.edu	37	5	70813215	70813215	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:70813215G>A	uc003kbp.1	+	22	5190	c.4927G>A	c.(4927-4929)GAA>AAA	p.E1643K	BDP1_uc003kbo.2_Missense_Mutation_p.E1643K	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	1643					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CAGAATGTATGAAAATCAAAG	0.303													49	68	---	---	---	---	capture	Missense_Mutation	SNP	70813215	70813215	BDP1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	1384	159
JMY	133746	broad.mit.edu	37	5	78612055	78612055	+	Silent	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:78612055T>C	uc003kfx.3	+	10	3412	c.2892T>C	c.(2890-2892)CTT>CTC	p.L964L		NM_152405	NP_689618	Q8N9B5	JMY_HUMAN	junction-mediating and regulatory protein	964					'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity				0		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		ATGAAGCTCTTAGAAGAATTA	0.438													27	27	---	---	---	---	capture	Silent	SNP	78612055	78612055	JMY	5	T	C	C	C	1	0	0	0	0	0	0	0	1	782	61	3	3	7880	159
HOMER1	9456	broad.mit.edu	37	5	78697771	78697771	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:78697771T>C	uc003kfy.2	-	6	1738	c.635A>G	c.(634-636)AAA>AGA	p.K212R	HOMER1_uc010jab.2_Intron|HOMER1_uc010jac.2_Intron|HOMER1_uc010jad.2_Missense_Mutation_p.K38R	NM_004272	NP_004263	Q86YM7	HOME1_HUMAN	homer 1	212	Potential.				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		AAGTTGCTGTTTCCATTGTTT	0.478													129	139	---	---	---	---	capture	Missense_Mutation	SNP	78697771	78697771	HOMER1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	7203	159
ELL2	22936	broad.mit.edu	37	5	95234136	95234136	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:95234136G>T	uc003klr.3	-	8	1683	c.1333C>A	c.(1333-1335)CTA>ATA	p.L445I		NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	445					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		GGACACTTTAGTAGAACGGAA	0.373													64	223	---	---	---	---	capture	Missense_Mutation	SNP	95234136	95234136	ELL2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	5018	159
APC	324	broad.mit.edu	37	5	112174282	112174282	+	Silent	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:112174282T>C	uc010jby.2	+	16	3371	c.2991T>C	c.(2989-2991)TAT>TAC	p.Y997Y	APC_uc011cvt.1_Silent_p.Y979Y|APC_uc003kpz.3_Silent_p.Y997Y|APC_uc003kpy.3_Silent_p.Y997Y|APC_uc010jbz.2_Silent_p.Y714Y|APC_uc010jca.2_Silent_p.Y297Y	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	997	Ser-rich.|Responsible for down-regulation through a process mediated by direct ubiquitination.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.Y997fs*8(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTGCAGTTATGGTCAATACC	0.343		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			74	80	---	---	---	---	capture	Silent	SNP	112174282	112174282	APC	5	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	756	159
MAML1	9794	broad.mit.edu	37	5	179201677	179201677	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179201677C>T	uc003mkm.2	+	5	3113	c.2850C>T	c.(2848-2850)GGC>GGT	p.G950G	MAML1_uc003mkn.1_Intron	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	950					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACAGATGGGCGGTCGGGCGG	0.706													15	19	---	---	---	---	capture	Silent	SNP	179201677	179201677	MAML1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9119	159
MYLK4	340156	broad.mit.edu	37	6	2685573	2685573	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:2685573C>A	uc003mty.3	-	6	799	c.502G>T	c.(502-504)GAT>TAT	p.D168Y		NM_001012418	NP_001012418	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	168	Protein kinase.						ATP binding|protein serine/threonine kinase activity			breast(3)|ovary(1)	4	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				TCGAAGGCATCGTACAGCTGG	0.557													124	154	---	---	---	---	capture	Missense_Mutation	SNP	2685573	2685573	MYLK4	6	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	9969	159
HIVEP1	3096	broad.mit.edu	37	6	12164550	12164550	+	Silent	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:12164550T>C	uc003nac.2	+	9	8192	c.8013T>C	c.(8011-8013)GTT>GTC	p.V2671V	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	2671					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ATTCTGAAGTTTTTACAAAGC	0.577													13	17	---	---	---	---	capture	Silent	SNP	12164550	12164550	HIVEP1	6	T	C	C	C	1	0	0	0	0	0	0	0	1	821	64	3	3	7111	159
RNF5	6048	broad.mit.edu	37	6	32147882	32147882	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32147882G>A	uc003oaj.3	+	5	551	c.424G>A	c.(424-426)GAG>AAG	p.E142K	AGPAT1_uc003oaf.2_5'Flank|AGPAT1_uc003oag.2_5'Flank|AGPAT1_uc003oah.2_5'Flank	NM_006913	NP_008844	Q99942	RNF5_HUMAN	ring finger protein 5	142					ER-associated misfolded protein catabolic process|protein K48-linked ubiquitination|protein K63-linked ubiquitination	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						CAATGCCCATGAGCCTTTCCG	0.557													73	146	---	---	---	---	capture	Missense_Mutation	SNP	32147882	32147882	RNF5	6	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	13389	159
COL11A2	1302	broad.mit.edu	37	6	33133402	33133402	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33133402C>A	uc003ocx.1	-	63	4902	c.4674G>T	c.(4672-4674)AGG>AGT	p.R1558S	COL11A2_uc010jul.1_Missense_Mutation_p.R128S|COL11A2_uc003ocy.1_Missense_Mutation_p.R1472S|COL11A2_uc003ocz.1_Missense_Mutation_p.R1451S	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1558	Fibrillar collagen NC1.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						CTGTTGGCCGCCTCATCTGCT	0.662													49	86	---	---	---	---	capture	Missense_Mutation	SNP	33133402	33133402	COL11A2	6	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	3633	159
TFEB	7942	broad.mit.edu	37	6	41654875	41654875	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41654875G>A	uc003oqs.1	-	8	1062	c.760C>T	c.(760-762)CGC>TGC	p.R254C	TFEB_uc003oqt.1_Missense_Mutation_p.R254C|TFEB_uc003oqu.1_Missense_Mutation_p.R268C|TFEB_uc003oqv.1_Missense_Mutation_p.R254C|TFEB_uc003oqr.1_Missense_Mutation_p.R169C	NM_007162	NP_009093	P19484	TFEB_HUMAN	transcription factor EB	254	Helix-loop-helix motif.				embryonic placenta development|humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TCCTTGATGCGGTCATTGATG	0.537			T	ALPHA	renal (childhood epithelioid)								19	36	---	---	---	---	capture	Missense_Mutation	SNP	41654875	41654875	TFEB	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15686	159
C7orf31	136895	broad.mit.edu	37	7	25182279	25182279	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:25182279G>A	uc003sxn.1	-	8	1400	c.839C>T	c.(838-840)TCG>TTG	p.S280L	C7orf31_uc003sxm.1_Missense_Mutation_p.S122L	NM_138811	NP_620166	Q8N865	CG031_HUMAN	hypothetical protein LOC136895	280											0						ATGAGTGTACGAAGTGAGCCA	0.368													35	131	---	---	---	---	capture	Missense_Mutation	SNP	25182279	25182279	C7orf31	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2364	159
VPS41	27072	broad.mit.edu	37	7	38816326	38816326	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38816326C>T	uc003tgy.2	-	11	861	c.835G>A	c.(835-837)GAT>AAT	p.D279N	VPS41_uc003tgz.2_Missense_Mutation_p.D254N|VPS41_uc010kxn.2_Missense_Mutation_p.D190N	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	279					Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						ACAAGCTGATCACAGAGAGGT	0.413													17	55	---	---	---	---	capture	Missense_Mutation	SNP	38816326	38816326	VPS41	7	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	17092	159
URGCP	55665	broad.mit.edu	37	7	43917540	43917540	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43917540C>T	uc003tiw.2	-	6	1579	c.1522G>A	c.(1522-1524)GAG>AAG	p.E508K	URGCP_uc003tiu.2_Missense_Mutation_p.E465K|URGCP_uc003tiv.2_Missense_Mutation_p.E433K|URGCP_uc003tix.2_Missense_Mutation_p.E499K|URGCP_uc003tiy.2_Missense_Mutation_p.E465K|URGCP_uc003tiz.2_Missense_Mutation_p.E465K|URGCP_uc011kbj.1_Missense_Mutation_p.E465K	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	508					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						AACTCCTTCTCCACTTGGGCT	0.607													25	129	---	---	---	---	capture	Missense_Mutation	SNP	43917540	43917540	URGCP	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	16908	159
POM121L12	285877	broad.mit.edu	37	7	53103790	53103790	+	Silent	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103790G>A	uc003tpz.2	+	1	442	c.426G>A	c.(424-426)GCG>GCA	p.A142A		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	142											0						TCGGGATCGCGCCCCCTGAGC	0.587													23	42	---	---	---	---	capture	Silent	SNP	53103790	53103790	POM121L12	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12143	159
POM121L12	285877	broad.mit.edu	37	7	53103915	53103915	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103915A>T	uc003tpz.2	+	1	567	c.551A>T	c.(550-552)CAG>CTG	p.Q184L		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	184											0						GCGCTCAGCCAGTGCCCCAAG	0.577													10	81	---	---	---	---	capture	Missense_Mutation	SNP	53103915	53103915	POM121L12	7	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	12143	159
DUS4L	11062	broad.mit.edu	37	7	107217955	107217955	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107217955T>G	uc003veh.2	+	8	1237	c.904T>G	c.(904-906)TCA>GCA	p.S302A	DUS4L_uc003veg.2_Missense_Mutation_p.S181A|DUS4L_uc011klw.1_RNA|DUS4L_uc011klx.1_Missense_Mutation_p.S181A|DUS4L_uc010ljl.2_Missense_Mutation_p.S212A|BCAP29_uc003vej.2_5'Flank|BCAP29_uc011kly.1_5'Flank|BCAP29_uc011klz.1_5'Flank	NM_181581	NP_853559	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like	302					tRNA processing		flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0						TAATGCTCTGTCAAGCACATC	0.353													42	106	---	---	---	---	capture	Missense_Mutation	SNP	107217955	107217955	DUS4L	7	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	4763	159
TES	26136	broad.mit.edu	37	7	115889257	115889257	+	Silent	SNP	T	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:115889257T>A	uc003vho.2	+	3	478	c.297T>A	c.(295-297)GCT>GCA	p.A99A	TES_uc011kmx.1_Silent_p.A99A|TES_uc011kmy.1_Intron|TES_uc010lka.1_Silent_p.A90A|TES_uc003vhp.2_Silent_p.A90A	NM_015641	NP_056456	Q9UGI8	TES_HUMAN	testin isoform 1	99	PET.				negative regulation of cell proliferation	cytoplasm|focal adhesion|nucleus|protein complex	zinc ion binding				0	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			ATCCAGTTGCTGCCAAGAAGA	0.383													44	203	---	---	---	---	capture	Silent	SNP	115889257	115889257	TES	7	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	15650	159
GRM8	2918	broad.mit.edu	37	7	126542691	126542691	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126542691C>T	uc003vlr.2	-	5	1372	c.1061G>A	c.(1060-1062)CGA>CAA	p.R354Q	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.R354Q|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_Missense_Mutation_p.R75Q	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	354	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	CACATTTCTTCGATTATTGGC	0.348										HNSCC(24;0.065)			46	102	---	---	---	---	capture	Missense_Mutation	SNP	126542691	126542691	GRM8	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6736	159
AGAP3	116988	broad.mit.edu	37	7	150840450	150840450	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150840450C>T	uc003wjg.1	+	17	2299	c.2296C>T	c.(2296-2298)CGG>TGG	p.R766W	AGAP3_uc003wje.1_Missense_Mutation_p.R435W|AGAP3_uc003wjj.1_Missense_Mutation_p.R265W|AGAP3_uc003wjk.1_Missense_Mutation_p.R184W	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	730	Arf-GAP.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						ACGCTGGATACGGGCCAAGTA	0.622													25	70	---	---	---	---	capture	Missense_Mutation	SNP	150840450	150840450	AGAP3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	369	159
CLVS1	157807	broad.mit.edu	37	8	62212806	62212806	+	Silent	SNP	T	C	C			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:62212806T>C	uc003xuh.2	+	2	744	c.420T>C	c.(418-420)ATT>ATC	p.I140I	CLVS1_uc003xug.2_Silent_p.I140I|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Silent_p.I140I	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	140	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						GCAGGAAGATTCTTTTGCTGT	0.448													31	37	---	---	---	---	capture	Silent	SNP	62212806	62212806	CLVS1	8	T	C	C	C	1	0	0	0	0	0	0	0	1	796	62	3	3	3536	159
C8orf84	157869	broad.mit.edu	37	8	73982070	73982070	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73982070C>T	uc003xzf.2	-	4	852	c.647G>A	c.(646-648)CGT>CAT	p.R216H		NM_153225	NP_694957	Q8IVN8	RPESP_HUMAN	RPE-spondin precursor	216					immune response	extracellular region	polysaccharide binding|scavenger receptor activity				0						TCCAGAACAACGAAGGCTCAC	0.478													27	48	---	---	---	---	capture	Missense_Mutation	SNP	73982070	73982070	C8orf84	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2417	159
LAMC3	10319	broad.mit.edu	37	9	133948659	133948659	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133948659C>T	uc004caa.1	+	20	3543	c.3445C>T	c.(3445-3447)CCG>TCG	p.P1149S		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	1149	Domain II and I.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TCCCAGTCAGCCGACCAAATG	0.582													4	122	---	---	---	---	capture	Missense_Mutation	SNP	133948659	133948659	LAMC3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8536	159
KCNT1	57582	broad.mit.edu	37	9	138657034	138657034	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138657034G>A	uc011mdq.1	+	12	1267	c.1193G>A	c.(1192-1194)CGG>CAG	p.R398Q	KCNT1_uc011mdr.1_Missense_Mutation_p.R225Q|KCNT1_uc010nbf.2_Missense_Mutation_p.R353Q|KCNT1_uc004cgo.1_Missense_Mutation_p.R147Q	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	398						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GCCCACCCCCGGCTCCAGGTG	0.642													67	82	---	---	---	---	capture	Missense_Mutation	SNP	138657034	138657034	KCNT1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8013	159
ACE2	59272	broad.mit.edu	37	X	15582159	15582159	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15582159C>T	uc004cxa.1	-	17	2465	c.2297G>A	c.(2296-2298)AGA>AAA	p.R766K	ACE2_uc004cxb.2_Missense_Mutation_p.R766K	NM_021804	NP_068576	Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2 precursor	766	Cytoplasmic (Potential).				angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding			ovary(3)	3	Hepatocellular(33;0.183)				Moexipril(DB00691)	CTTCCGATCTCTGATCCCAGT	0.413													87	254	---	---	---	---	capture	Missense_Mutation	SNP	15582159	15582159	ACE2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	137	159
RS1	6247	broad.mit.edu	37	X	18690198	18690198	+	Translation_Start_Site	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18690198G>A	uc004cyo.2	-	1	26	c.-9C>T	c.(-11--7)GACGA>GATGA			NM_000330	NP_000321	O15537	XLRS1_HUMAN	X-linked juvenile retinoschisis protein						cell adhesion|multicellular organismal development|response to stimulus|visual perception	extracellular space				ovary(2)	2	Hepatocellular(33;0.183)					TCTTCCCCTCGTCCTCGGCCA	0.443													4	125	---	---	---	---	capture	Translation_Start_Site	SNP	18690198	18690198	RS1	23	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	13585	159
KLHL34	257240	broad.mit.edu	37	X	21674007	21674007	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21674007C>T	uc004czz.1	-	1	2442	c.1900G>A	c.(1900-1902)GAG>AAG	p.E634K		NM_153270	NP_695002	Q8N239	KLH34_HUMAN	kelch-like 34	634										ovary(1)	1						TCTCCAACCTCTCCCTCCCTC	0.637													13	25	---	---	---	---	capture	Missense_Mutation	SNP	21674007	21674007	KLHL34	23	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	8307	159
BCOR	54880	broad.mit.edu	37	X	39932304	39932304	+	Silent	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39932304G>A	uc004den.3	-	4	2587	c.2295C>T	c.(2293-2295)TCC>TCT	p.S765S	BCOR_uc004dep.3_Silent_p.S765S|BCOR_uc004deo.3_Silent_p.S765S|BCOR_uc004dem.3_Silent_p.S765S|BCOR_uc004deq.3_Silent_p.S765S	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	765					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						CCAAAATCTCGGAAAACCGAT	0.512													80	187	---	---	---	---	capture	Silent	SNP	39932304	39932304	BCOR	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	1375	159
BMP15	9210	broad.mit.edu	37	X	50653945	50653945	+	Silent	SNP	C	T	T	rs149633402		TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50653945C>T	uc011mnw.1	+	1	162	c.162C>T	c.(160-162)GGC>GGT	p.G54G		NM_005448	NP_005439	O95972	BMP15_HUMAN	bone morphogenetic protein 15 precursor	54					female gamete generation|granulosa cell development|ovarian follicle development	extracellular space	cytokine activity|growth factor activity			ovary(2)	2	Ovarian(276;0.236)					AATCCCCTGGCGAACAGCCAA	0.592													7	8	---	---	---	---	capture	Silent	SNP	50653945	50653945	BMP15	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1446	159
KDM5C	8242	broad.mit.edu	37	X	53230914	53230914	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53230914G>A	uc004drz.2	-	14	2412	c.1879C>T	c.(1879-1881)CGC>TGC	p.R627C	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.R560C|KDM5C_uc004dsa.2_Missense_Mutation_p.R626C	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	627	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						ATGCACTGGCGCCCAGCAGGC	0.587			N|F|S		clear cell renal carcinoma								12	27	---	---	---	---	capture	Missense_Mutation	SNP	53230914	53230914	KDM5C	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8057	159
YIPF6	286451	broad.mit.edu	37	X	67731798	67731798	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:67731798T>A	uc004dwy.2	+	2	188	c.165T>A	c.(163-165)AAT>AAA	p.N55K	YIPF6_uc011mph.1_Intron	NM_173834	NP_776195	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	55						endoplasmic reticulum|integral to membrane					0						CCACATTAAATGAATCTGTTC	0.393													40	116	---	---	---	---	capture	Missense_Mutation	SNP	67731798	67731798	YIPF6	23	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	17363	159
PCDH11X	27328	broad.mit.edu	37	X	91133162	91133162	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91133162C>A	uc004efk.1	+	2	2768	c.1923C>A	c.(1921-1923)TTC>TTA	p.F641L	PCDH11X_uc004efl.1_Missense_Mutation_p.F641L|PCDH11X_uc004efo.1_Missense_Mutation_p.F641L|PCDH11X_uc010nmv.1_Missense_Mutation_p.F641L|PCDH11X_uc004efm.1_Missense_Mutation_p.F641L|PCDH11X_uc004efn.1_Missense_Mutation_p.F641L|PCDH11X_uc004efh.1_Missense_Mutation_p.F641L|PCDH11X_uc004efj.1_Missense_Mutation_p.F641L	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	641	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CTTACACTTTCTATGTAAAGG	0.363													26	66	---	---	---	---	capture	Missense_Mutation	SNP	91133162	91133162	PCDH11X	23	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	11411	159
OCRL	4952	broad.mit.edu	37	X	128721074	128721074	+	Silent	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:128721074A>G	uc004euq.2	+	20	2400	c.2235A>G	c.(2233-2235)CTA>CTG	p.L745L	OCRL_uc004eur.2_Silent_p.L737L|OCRL_uc010nrb.2_5'Flank	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	745	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						TAGATCACCTATTCAAATACG	0.403													72	142	---	---	---	---	capture	Silent	SNP	128721074	128721074	OCRL	23	A	G	G	G	1	0	0	0	0	0	0	0	1	197	16	3	3	10728	159
HTATSF1	27336	broad.mit.edu	37	X	135593609	135593609	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135593609G>T	uc004ezw.2	+	10	2127	c.1705G>T	c.(1705-1707)GGT>TGT	p.G569C	HTATSF1_uc004ezx.2_Missense_Mutation_p.G569C	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	569	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					TGAAGAAAATGGTCTCGAGAA	0.393													27	48	---	---	---	---	capture	Missense_Mutation	SNP	135593609	135593609	HTATSF1	23	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	7358	159
SOX3	6658	broad.mit.edu	37	X	139586804	139586804	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:139586804C>T	uc004fbd.1	-	1	422	c.422G>A	c.(421-423)CGG>CAG	p.R141Q		NM_005634	NP_005625	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	141	HMG box.				face development|hypothalamus development|negative regulation of neuron differentiation|pituitary gland development|regulation of transcription, DNA-dependent|sensory organ development|sex determination|transcription, DNA-dependent	nucleus	DNA binding			pancreas(1)	1	Acute lymphoblastic leukemia(192;7.65e-05)					GTTCATGGGCCGTTTCACACG	0.652													17	38	---	---	---	---	capture	Missense_Mutation	SNP	139586804	139586804	SOX3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14843	159
MTM1	4534	broad.mit.edu	37	X	149839946	149839946	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149839946C>T	uc004fef.3	+	15	1766	c.1690C>T	c.(1690-1692)CGC>TGC	p.R564C	MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Missense_Mutation_p.R527C|MTM1_uc011mxz.1_Missense_Mutation_p.R449C|MTM1_uc010nte.2_Missense_Mutation_p.R432C	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin	564					endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CTTAGCCTTACGCGACGAATA	0.517													16	55	---	---	---	---	capture	Missense_Mutation	SNP	149839946	149839946	MTM1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9847	159
GABRE	2564	broad.mit.edu	37	X	151128446	151128446	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151128446A>G	uc004ffi.2	-	6	703	c.649T>C	c.(649-651)TCC>CCC	p.S217P	GABRE_uc011myd.1_RNA|GABRE_uc011mye.1_RNA|MIR224_hsa-mir-224|MI0000301_5'Flank|MIR452_hsa-mir-452|MI0001733_5'Flank	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	217	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TCAGGATAGGAAACTGGAAAG	0.438													41	107	---	---	---	---	capture	Missense_Mutation	SNP	151128446	151128446	GABRE	23	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	6112	159
PLXNB3	5365	broad.mit.edu	37	X	153033712	153033712	+	Silent	SNP	C	T	T			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153033712C>T	uc004fii.2	+	4	1269	c.1095C>T	c.(1093-1095)CCC>CCT	p.P365P	PLXNB3_uc011mzb.1_Intron|PLXNB3_uc011mzc.1_Silent_p.P47P|PLXNB3_uc010nuk.2_Silent_p.P388P|PLXNB3_uc011mzd.1_Silent_p.P4P	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	365	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGATTCCCCCGAGTCGTACC	0.687													23	81	---	---	---	---	capture	Silent	SNP	153033712	153033712	PLXNB3	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12028	159
MPP1	4354	broad.mit.edu	37	X	154009984	154009984	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154009984T>A	uc004fmp.1	-	10	1155	c.1040A>T	c.(1039-1041)GAG>GTG	p.E347V	MPP1_uc010nvg.1_Missense_Mutation_p.E327V|MPP1_uc011mzv.1_Missense_Mutation_p.E317V|MPP1_uc004fmq.1_Missense_Mutation_p.E301V|MPP1_uc011mzw.1_Missense_Mutation_p.E330V	NM_002436	NP_002427	Q00013	EM55_HUMAN	palmitoylated membrane protein 1	347	Guanylate kinase-like.|Interaction with MPP5.				regulation of neutrophil chemotaxis|signal transduction	integral to plasma membrane|membrane fraction|stereocilium	guanylate kinase activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTCCAAGAACTCATTGGCAGA	0.468													6	281	---	---	---	---	capture	Missense_Mutation	SNP	154009984	154009984	MPP1	23	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	9645	159
FAM123B	139285	broad.mit.edu	37	X	63412206	63412206	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-1390-01	TCGA-19-1390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:63412206delT	uc004dvo.2	-	2	1234	c.961delA	c.(961-963)AGCfs	p.S321fs		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	321					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						GAATCAAAGCTTTTCAGGGAT	0.522													53	122	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	63412206	63412206	FAM123B	23	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	5377	159
