Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MTOR	2475	broad.mit.edu	37	1	11190804	11190804	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11190804C>T	uc001asd.2	-	39	5516	c.5395G>A	c.(5395-5397)GAA>AAA	p.E1799K	MTOR_uc001asc.2_Missense_Mutation_p.E4K	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1799	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						AGCACAGCTTCGAAGTTCATC	0.493													3	8	---	---	---	---	capture	Missense_Mutation	SNP	11190804	11190804	MTOR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9864	160
PRAMEF12	390999	broad.mit.edu	37	1	12837525	12837525	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12837525C>T	uc001aui.2	+	3	1262	c.1235C>T	c.(1234-1236)CCT>CTT	p.P412L		NM_001080830	NP_001074299	O95522	PRA12_HUMAN	PRAME family member 12	412										ovary(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCTGTATCCTGCCCCTCTG	0.577													9	155	---	---	---	---	capture	Missense_Mutation	SNP	12837525	12837525	PRAMEF12	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	12329	160
DDI2	84301	broad.mit.edu	37	1	15978327	15978327	+	Silent	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:15978327C>A	uc001awx.1	+	8	1216	c.1120C>A	c.(1120-1122)CGG>AGG	p.R374R	DDI2_uc009voj.1_Silent_p.R115R	NM_032341	NP_115717	Q5TDH0	DDI2_HUMAN	DNA-damage inducible protein 2	374					proteolysis		aspartic-type endopeptidase activity				0		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AGAGGATGTACGGCCAGAGGA	0.512													3	53	---	---	---	---	capture	Silent	SNP	15978327	15978327	DDI2	1	C	A	A	A	1	0	0	0	0	0	0	0	1	243	19	4	4	4288	160
C1orf64	149563	broad.mit.edu	37	1	16330879	16330879	+	Silent	SNP	C	A	A	rs143498880	byFrequency	TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16330879C>A	uc001axn.2	+	1	149	c.81C>A	c.(79-81)TCC>TCA	p.S27S		NM_178840	NP_849162	Q8NEQ6	CA064_HUMAN	hypothetical protein LOC149563	27										breast(2)	2		Colorectal(325;0.000435)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;2.08e-05)|BRCA - Breast invasive adenocarcinoma(304;9.19e-05)|Kidney(64;0.000165)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0114)|READ - Rectum adenocarcinoma(331;0.0649)		AGACCAGCTCCGGTAAGAGGC	0.483													2	11	---	---	---	---	capture	Silent	SNP	16330879	16330879	C1orf64	1	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	2036	160
CDA	978	broad.mit.edu	37	1	20945033	20945033	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:20945033G>A	uc001bdk.2	+	4	592	c.413G>A	c.(412-414)GGG>GAG	p.G138E	CDA_uc001bdl.2_RNA|CDA_uc009vpv.2_RNA	NM_001785	NP_001776	P32320	CDD_HUMAN	cytidine deaminase	138					cell surface receptor linked signaling pathway|cytosine metabolic process|negative regulation of cell growth|negative regulation of nucleotide metabolic process|protein homotetramerization|pyrimidine nucleoside salvage	cytosol|extracellular region	cytidine deaminase activity|nucleoside binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	TCCTCCTTTGGGCCTGAGGAC	0.542													18	45	---	---	---	---	capture	Missense_Mutation	SNP	20945033	20945033	CDA	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	3023	160
HSPG2	3339	broad.mit.edu	37	1	22163397	22163397	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22163397T>A	uc001bfj.2	-	75	10293	c.10253A>T	c.(10252-10254)GAG>GTG	p.E3418V	HSPG2_uc009vqd.2_Missense_Mutation_p.E3419V	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	3418	Ig-like C2-type 20.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	ACAGTGGAACTCAACGCTGGC	0.662													2	6	---	---	---	---	capture	Missense_Mutation	SNP	22163397	22163397	HSPG2	1	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	7355	160
ARID1A	8289	broad.mit.edu	37	1	27099916	27099916	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27099916C>T	uc001bmv.1	+	15	4168	c.3795C>T	c.(3793-3795)GGC>GGT	p.G1265G	ARID1A_uc001bmt.1_Silent_p.G1264G|ARID1A_uc001bmu.1_Silent_p.G1265G|ARID1A_uc001bmw.1_Silent_p.G882G|ARID1A_uc001bmx.1_Silent_p.G111G|ARID1A_uc009vsm.1_5'UTR|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1265					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GTGCTGCCGGCCCTGGGCTAG	0.607			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								20	69	---	---	---	---	capture	Silent	SNP	27099916	27099916	ARID1A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	906	160
CYP4X1	260293	broad.mit.edu	37	1	47498946	47498946	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47498946G>A	uc001cqt.2	+	4	648	c.398G>A	c.(397-399)TGG>TAG	p.W133*	CYP4X1_uc001cqr.2_Nonsense_Mutation_p.W132*|CYP4X1_uc001cqs.2_Nonsense_Mutation_p.W68*	NM_178033	NP_828847	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X,	133						endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2						GGACCCAAGTGGTTCCAGCAT	0.423													4	115	---	---	---	---	capture	Nonsense_Mutation	SNP	47498946	47498946	CYP4X1	1	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	4153	160
SYDE2	84144	broad.mit.edu	37	1	85624724	85624724	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85624724G>C	uc009wcm.2	-	7	3343	c.3294C>G	c.(3292-3294)AAC>AAG	p.N1098K		NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	1098					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		TTAAAAAGTAGTTTTCCCCAC	0.388													36	119	---	---	---	---	capture	Missense_Mutation	SNP	85624724	85624724	SYDE2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	15324	160
COL24A1	255631	broad.mit.edu	37	1	86377068	86377068	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86377068C>T	uc001dlj.2	-	25	2653	c.2611G>A	c.(2611-2613)GAA>AAA	p.E871K	COL24A1_uc001dli.2_Missense_Mutation_p.E7K|COL24A1_uc010osd.1_Missense_Mutation_p.E171K|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	871	Collagen-like 6.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		ATTACCTTTTCGCCAATGCTT	0.308													19	49	---	---	---	---	capture	Missense_Mutation	SNP	86377068	86377068	COL24A1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3648	160
NOTCH2	4853	broad.mit.edu	37	1	120510201	120510201	+	Silent	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120510201C>A	uc001eik.2	-	8	1564	c.1308G>T	c.(1306-1308)ACG>ACT	p.T436T	NOTCH2_uc001eil.2_Silent_p.T436T|NOTCH2_uc001eim.3_Silent_p.T353T	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	436	Extracellular (Potential).|EGF-like 11; calcium-binding (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGCGCCATCCGTGTTCACAC	0.473			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	104	---	---	---	---	capture	Silent	SNP	120510201	120510201	NOTCH2	1	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	10455	160
TCHH	7062	broad.mit.edu	37	1	152080460	152080460	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152080460G>A	uc001ezp.2	-	2	5233	c.5233C>T	c.(5233-5235)CGC>TGC	p.R1745C	TCHH_uc009wne.1_Missense_Mutation_p.R1745C	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1745	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTCTGTAGCGTTCTTGGCGG	0.587													20	38	---	---	---	---	capture	Missense_Mutation	SNP	152080460	152080460	TCHH	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15585	160
C1orf14	81626	broad.mit.edu	37	1	182922239	182922239	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:182922239G>A	uc001gpu.2	-	1	315	c.30C>T	c.(28-30)CCC>CCT	p.P10P	C1orf14_uc001gpv.2_5'UTR|C1orf14_uc010pnz.1_5'UTR|C1orf14_uc001gpw.2_5'UTR	NM_030933	NP_112195	Q9BZQ2	SHP1L_HUMAN	chromosome 1 open reading frame 14	82											0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)		ATGAGTCCGCGGGCACCGAGG	0.716													3	10	---	---	---	---	capture	Silent	SNP	182922239	182922239	C1orf14	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	1982	160
PPP1R12B	4660	broad.mit.edu	37	1	202418229	202418229	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:202418229G>A	uc001gya.1	+	13	1924	c.1780G>A	c.(1780-1782)GGG>AGG	p.G594R	PPP1R12B_uc001gxz.1_Missense_Mutation_p.G594R	NM_002481	NP_002472	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory (inhibitor)	594					regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)			CACTGCCAATGGGGTTACAGC	0.507													11	52	---	---	---	---	capture	Missense_Mutation	SNP	202418229	202418229	PPP1R12B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	12256	160
OR2B11	127623	broad.mit.edu	37	1	247614696	247614696	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247614696C>T	uc010pyx.1	-	1	589	c.589G>A	c.(589-591)GCT>ACT	p.A197T		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	197	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCATTCACAGCGGTGTCAGCA	0.577													3	47	---	---	---	---	capture	Missense_Mutation	SNP	247614696	247614696	OR2B11	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10892	160
ITGB1	3688	broad.mit.edu	37	10	33211272	33211272	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:33211272C>A	uc001iws.3	-	9	1177	c.1041G>T	c.(1039-1041)GAG>GAT	p.E347D	ITGB1_uc001iwp.3_Missense_Mutation_p.E347D|ITGB1_uc001iwq.3_Missense_Mutation_p.E347D|ITGB1_uc001iwr.3_Missense_Mutation_p.E347D|ITGB1_uc001iwt.3_Missense_Mutation_p.E347D|ITGB1_uc001iwu.1_Missense_Mutation_p.E347D	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	347	Extracellular (Potential).|VWFA.				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				AGTTTTTCAGCTCCTGCAATT	0.348													3	56	---	---	---	---	capture	Missense_Mutation	SNP	33211272	33211272	ITGB1	10	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	7813	160
ALOX5	240	broad.mit.edu	37	10	45936078	45936078	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:45936078C>A	uc001jce.2	+	8	1281	c.1182C>A	c.(1180-1182)TTC>TTA	p.F394L	ALOX5_uc009xmt.2_Missense_Mutation_p.F394L|ALOX5_uc010qfg.1_Missense_Mutation_p.F394L	NM_000698	NP_000689	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	394	Lipoxygenase.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding			ovary(1)|pancreas(1)	2		Lung SC(717;0.0257)			Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)	ACCCCATTTTCAAGGTACAGC	0.582													3	29	---	---	---	---	capture	Missense_Mutation	SNP	45936078	45936078	ALOX5	10	C	A	A	A	1	0	0	0	0	1	0	0	0	376	29	4	4	540	160
CDH23	64072	broad.mit.edu	37	10	73405621	73405621	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:73405621G>C	uc001jrx.3	+	12	1551	c.1174G>C	c.(1174-1176)GGG>CGG	p.G392R	CDH23_uc001jrw.3_Missense_Mutation_p.G392R|CDH23_uc001jry.2_Missense_Mutation_p.G8R|CDH23_uc001jrz.2_Missense_Mutation_p.G8R	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	392	Cadherin 4.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						GTACTTGGTGGGGAACAACTC	0.572													3	14	---	---	---	---	capture	Missense_Mutation	SNP	73405621	73405621	CDH23	10	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	3079	160
SYNPO2L	79933	broad.mit.edu	37	10	75407262	75407262	+	Silent	SNP	A	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75407262A>G	uc001jut.3	-	4	2300	c.2148T>C	c.(2146-2148)CCT>CCC	p.P716P	SYNPO2L_uc001jus.3_Silent_p.P492P	NM_001114133	NP_001107605	Q9H987	SYP2L_HUMAN	synaptopodin 2-like isoform a	716	Pro-rich.					cytoplasm|cytoskeleton	actin binding			ovary(1)	1	Prostate(51;0.0112)					TAGGAGTCATAGGGGGCGGGG	0.617													3	122	---	---	---	---	capture	Silent	SNP	75407262	75407262	SYNPO2L	10	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	15346	160
ZMIZ1	57178	broad.mit.edu	37	10	81061939	81061939	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:81061939C>T	uc001kaf.2	+	18	2667	c.2095C>T	c.(2095-2097)CTC>TTC	p.L699F	ZMIZ1_uc001kag.2_Missense_Mutation_p.L575F	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	699					transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CAAGAAGCGCCTCCTGCCCGC	0.627													3	121	---	---	---	---	capture	Missense_Mutation	SNP	81061939	81061939	ZMIZ1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	17576	160
RPP30	10556	broad.mit.edu	37	10	92660375	92660375	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:92660375G>A	uc009xtx.2	+	11	781	c.746G>A	c.(745-747)CGG>CAG	p.R249Q	RPP30_uc001khd.2_Missense_Mutation_p.R249Q	NM_006413	NP_006404	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit isoform b	249					tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity				0						AAGAAACCTCGGCCATCAGAA	0.423													24	227	---	---	---	---	capture	Missense_Mutation	SNP	92660375	92660375	RPP30	10	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13504	160
PDLIM1	9124	broad.mit.edu	37	10	96998437	96998437	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96998437G>C	uc001kkh.2	-	6	800	c.691C>G	c.(691-693)CCC>GCC	p.P231A	PDLIM1_uc001kki.2_Missense_Mutation_p.P231A|PDLIM1_uc009xuv.2_Intron|PDLIM1_uc001kkj.1_Missense_Mutation_p.P231A	NM_020992	NP_066272	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	231					response to oxidative stress	cytoplasm|cytoskeleton	zinc ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GGCTTGTTGGGATCCCCTGAA	0.443													2	23	---	---	---	---	capture	Missense_Mutation	SNP	96998437	96998437	PDLIM1	10	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	11582	160
DMBT1	1755	broad.mit.edu	37	10	124358594	124358594	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124358594C>T	uc001lgk.1	+	26	3367	c.3261C>T	c.(3259-3261)GAC>GAT	p.D1087D	DMBT1_uc001lgl.1_Silent_p.D1077D|DMBT1_uc001lgm.1_Silent_p.D588D|DMBT1_uc009xzz.1_Silent_p.D1087D|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_Silent_p.D48D	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1087	SRCR 8.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATAGTGAAGACGCTGGTGTCA	0.532													12	54	---	---	---	---	capture	Silent	SNP	124358594	124358594	DMBT1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4535	160
DMBT1	1755	broad.mit.edu	37	10	124390740	124390740	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124390740C>T	uc001lgk.1	+	46	6008	c.5902C>T	c.(5902-5904)CGA>TGA	p.R1968*	DMBT1_uc001lgl.1_Nonsense_Mutation_p.R1958*|DMBT1_uc001lgm.1_Nonsense_Mutation_p.R1340*|DMBT1_uc009xzz.1_Nonsense_Mutation_p.R1968*|DMBT1_uc010qtx.1_Nonsense_Mutation_p.R688*|DMBT1_uc009yab.1_Nonsense_Mutation_p.R671*|DMBT1_uc009yac.1_Nonsense_Mutation_p.R262*	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1968	SRCR 14.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GTGCCGGAACCGAGGCTGGTT	0.542													30	63	---	---	---	---	capture	Nonsense_Mutation	SNP	124390740	124390740	DMBT1	10	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	4535	160
DOCK1	1793	broad.mit.edu	37	10	128830507	128830507	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:128830507G>A	uc001ljt.2	+	18	1836	c.1772G>A	c.(1771-1773)AGC>AAC	p.S591N	DOCK1_uc010qun.1_Missense_Mutation_p.S612N	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	591	DHR-1.				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AGCATGCAGAGCCTTGGGAGC	0.562													2	8	---	---	---	---	capture	Missense_Mutation	SNP	128830507	128830507	DOCK1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	4640	160
ART5	116969	broad.mit.edu	37	11	3660908	3660908	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3660908G>C	uc001lyb.1	-	2	1144	c.751C>G	c.(751-753)CAG>GAG	p.Q251E	ART5_uc001lyc.1_Missense_Mutation_p.Q251E|ART5_uc001lyd.2_Intron|ART5_uc009yea.2_Intron	NM_053017	NP_443750	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5 precursor	251						extracellular region	NAD(P)+-protein-arginine ADP-ribosyltransferase activity			ovary(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTACAGGTCTGATTATAGCTC	0.522													5	185	---	---	---	---	capture	Missense_Mutation	SNP	3660908	3660908	ART5	11	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	993	160
HBE1	3046	broad.mit.edu	37	11	5290821	5290821	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5290821T>C	uc001mal.1	-	2	431	c.178A>G	c.(178-180)AAG>GAG	p.K60E	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Missense_Mutation_p.K60E	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin	60					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCTTGACCTTGGGGTTGCCC	0.507													33	63	---	---	---	---	capture	Missense_Mutation	SNP	5290821	5290821	HBE1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	6907	160
OR52L1	338751	broad.mit.edu	37	11	6008078	6008078	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6008078G>A	uc001mcd.2	-	1	138	c.83C>T	c.(82-84)CCT>CTT	p.P28L		NM_001005173	NP_001005173	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L,	28	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGAAAAGAAGGCTGGGATAG	0.468													15	49	---	---	---	---	capture	Missense_Mutation	SNP	6008078	6008078	OR52L1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11029	160
SLC1A2	6506	broad.mit.edu	37	11	35313908	35313908	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:35313908C>T	uc001mwd.2	-	7	1609	c.1017G>A	c.(1015-1017)GTG>GTA	p.V339V	SLC1A2_uc001mwe.2_Silent_p.V330V|SLC1A2_uc010rev.1_Silent_p.V339V	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2	339	Helical; (Potential).				D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	TTTTCCTGGTCACTACAAAGT	0.478													58	189	---	---	---	---	capture	Silent	SNP	35313908	35313908	SLC1A2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	14325	160
CREB3L1	90993	broad.mit.edu	37	11	46321656	46321656	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46321656C>T	uc001ncf.2	+	2	708	c.273C>T	c.(271-273)AGC>AGT	p.S91S		NM_052854	NP_443086	Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like	91	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L1(6)	soft_tissue(6)|ovary(2)	8				GBM - Glioblastoma multiforme(35;0.0285)		ACTCCCTGAGCGGCGACTCAG	0.607			T	FUS	myxofibrosarcoma								12	26	---	---	---	---	capture	Silent	SNP	46321656	46321656	CREB3L1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	3821	160
LRP4	4038	broad.mit.edu	37	11	46916320	46916320	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46916320G>A	uc001ndn.3	-	12	1506	c.1360C>T	c.(1360-1362)CTG>TTG	p.L454L		NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	454	Extracellular (Potential).				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		CGGTGTGGCAGCACCTGCCGG	0.567													3	72	---	---	---	---	capture	Silent	SNP	46916320	46916320	LRP4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	8875	160
OR5D14	219436	broad.mit.edu	37	11	55563704	55563704	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55563704G>C	uc010rim.1	+	1	673	c.673G>C	c.(673-675)GTG>CTG	p.V225L		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				TTTCATTTTTGTGACTGTACT	0.478													58	171	---	---	---	---	capture	Missense_Mutation	SNP	55563704	55563704	OR5D14	11	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	11059	160
OR6Q1	219952	broad.mit.edu	37	11	57798590	57798590	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57798590C>T	uc010rjz.1	+	1	166	c.166C>T	c.(166-168)CGA>TGA	p.R56*	OR9Q1_uc001nmj.2_Intron	NM_001005186	NP_001005186	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q,	56	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(1)	1		Breast(21;0.0707)|all_epithelial(135;0.142)				TTTGGACCACCGACTACGGAG	0.478													79	201	---	---	---	---	capture	Nonsense_Mutation	SNP	57798590	57798590	OR6Q1	11	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	11112	160
PLAC1L	219990	broad.mit.edu	37	11	59812205	59812205	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59812205A>T	uc001nol.2	+	3	490	c.305A>T	c.(304-306)GAT>GTT	p.D102V		NM_173801	NP_776162	Q86WS3	PLACL_HUMAN	placenta-specific 1-like precursor	102						extracellular region				ovary(2)|skin(1)	3						AGGAATATAGATCATGACCCT	0.408													21	80	---	---	---	---	capture	Missense_Mutation	SNP	59812205	59812205	PLAC1L	11	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	11916	160
AHNAK	79026	broad.mit.edu	37	11	62299512	62299512	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62299512T>A	uc001ntl.2	-	5	2677	c.2377A>T	c.(2377-2379)AGC>TGC	p.S793C	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	793					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TCCTCAATGCTCACATCAGGA	0.502													62	233	---	---	---	---	capture	Missense_Mutation	SNP	62299512	62299512	AHNAK	11	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	414	160
DPP3	10072	broad.mit.edu	37	11	66252660	66252660	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66252660C>T	uc001oig.1	+	3	349	c.287C>T	c.(286-288)GCC>GTC	p.A96V	DPP3_uc001oif.1_Missense_Mutation_p.A96V|DPP3_uc010rpe.1_Intron	NM_005700	NP_005691	Q9NY33	DPP3_HUMAN	dipeptidyl peptidase III	96					proteolysis	cytoplasm	aminopeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity			ovary(1)|skin(1)	2						CTGGTCTATGCCGCGGGTGTT	0.592													3	44	---	---	---	---	capture	Missense_Mutation	SNP	66252660	66252660	DPP3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4683	160
MMP7	4316	broad.mit.edu	37	11	102395756	102395756	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102395756G>A	uc001phb.2	-	4	571	c.524C>T	c.(523-525)ACG>ATG	p.T175M	MMP7_uc009yxd.2_Missense_Mutation_p.T175M	NM_002423	NP_002414	P09237	MMP7_HUMAN	matrix metalloproteinase 7 preproprotein	175		Calcium 2; via carbonyl oxygen.			collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(1)	1	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)		ATGAGCCAGCGTGTTTCCTGG	0.478													4	72	---	---	---	---	capture	Missense_Mutation	SNP	102395756	102395756	MMP7	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9579	160
PPP2R1B	5519	broad.mit.edu	37	11	111631562	111631562	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111631562C>G	uc001plx.1	-	4	604	c.520G>C	c.(520-522)GTT>CTT	p.V174L	PPP2R1B_uc001plw.1_Missense_Mutation_p.V174L|PPP2R1B_uc010rwi.1_Missense_Mutation_p.V110L|PPP2R1B_uc010rwj.1_Intron|PPP2R1B_uc010rwk.1_Missense_Mutation_p.V174L|PPP2R1B_uc010rwl.1_Intron	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein	174	HEAT 5.						protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		TCTGCTTTAACAGCATTTGAT	0.438													2	32	---	---	---	---	capture	Missense_Mutation	SNP	111631562	111631562	PPP2R1B	11	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	12284	160
OR8D1	283159	broad.mit.edu	37	11	124180313	124180313	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124180313G>C	uc010sag.1	-	1	350	c.350C>G	c.(349-351)GCC>GGC	p.A117G		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	117	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		ATATGCCATGGCAGTCAGGAG	0.478													2	26	---	---	---	---	capture	Missense_Mutation	SNP	124180313	124180313	OR8D1	11	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	11135	160
CCDC15	80071	broad.mit.edu	37	11	124910501	124910501	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124910501T>C	uc001qbm.3	+	16	3009	c.2750T>C	c.(2749-2751)CTA>CCA	p.L917P		NM_025004	NP_079280	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	917						centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		ACTCGGGCACTACATTCATTC	0.393													2	24	---	---	---	---	capture	Missense_Mutation	SNP	124910501	124910501	CCDC15	11	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	2758	160
VWF	7450	broad.mit.edu	37	12	6153612	6153612	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6153612T>C	uc001qnn.1	-	18	2537	c.2287A>G	c.(2287-2289)AGG>GGG	p.R763G	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	763					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	GATAGGCTCCTTTTGCCTCGA	0.522													3	48	---	---	---	---	capture	Missense_Mutation	SNP	6153612	6153612	VWF	12	T	C	C	C	1	0	0	0	0	1	0	0	0	726	56	3	3	17128	160
A2M	2	broad.mit.edu	37	12	9251275	9251275	+	Silent	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9251275G>C	uc001qvk.1	-	15	1892	c.1779C>G	c.(1777-1779)TCC>TCG	p.S593S	A2M_uc009zgk.1_Silent_p.S443S	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	593					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	GGGCGCAGACGGACTGAGGAG	0.582													2	13	---	---	---	---	capture	Silent	SNP	9251275	9251275	A2M	12	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	4	160
MLL2	8085	broad.mit.edu	37	12	49416568	49416568	+	Silent	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49416568C>A	uc001rta.3	-	51	16143	c.16143G>T	c.(16141-16143)GTG>GTT	p.V5381V		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	5381					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						ACTTGGAGTGCACAAACTGCT	0.587			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			3	56	---	---	---	---	capture	Silent	SNP	49416568	49416568	MLL2	12	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	9533	160
KRT84	3890	broad.mit.edu	37	12	52771859	52771859	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52771859G>A	uc001sah.1	-	9	1810	c.1762C>T	c.(1762-1764)CGC>TGC	p.R588C		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	588	Tail.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GACACAAAGCGGACGCTGGAG	0.677													2	4	---	---	---	---	capture	Missense_Mutation	SNP	52771859	52771859	KRT84	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8418	160
KRT74	121391	broad.mit.edu	37	12	52960950	52960950	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52960950C>T	uc001sap.1	-	9	1441	c.1393G>A	c.(1393-1395)GTC>ATC	p.V465I		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	465	Tail.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)		CTGCTGATGACAGCTGAGGAG	0.607													5	11	---	---	---	---	capture	Missense_Mutation	SNP	52960950	52960950	KRT74	12	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	8407	160
ZBTB39	9880	broad.mit.edu	37	12	57397937	57397937	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57397937G>T	uc001sml.1	-	2	851	c.765C>A	c.(763-765)TTC>TTA	p.F255L	RDH16_uc010sqx.1_5'Flank	NM_014830	NP_055645	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	255					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						TGTTTTTACTGAAGTCTCCAT	0.517													3	102	---	---	---	---	capture	Missense_Mutation	SNP	57397937	57397937	ZBTB39	12	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	17420	160
OS9	10956	broad.mit.edu	37	12	58112083	58112083	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58112083G>A	uc001spj.2	+	11	1348	c.1289G>A	c.(1288-1290)CGG>CAG	p.R430Q	OS9_uc010srx.1_Missense_Mutation_p.R224Q|OS9_uc001spk.2_Missense_Mutation_p.R430Q|OS9_uc001spl.2_Missense_Mutation_p.R430Q|OS9_uc001spm.2_Missense_Mutation_p.R430Q|OS9_uc001spn.2_Missense_Mutation_p.R431Q|OS9_uc010sry.1_Missense_Mutation_p.R398Q|OS9_uc010srz.1_Missense_Mutation_p.R371Q	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum	430					ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			gaggatgaACGGCAGTTACTG	0.413													3	104	---	---	---	---	capture	Missense_Mutation	SNP	58112083	58112083	OS9	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11176	160
PAH	5053	broad.mit.edu	37	12	103246597	103246597	+	Missense_Mutation	SNP	C	T	T	rs62508698		TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:103246597C>T	uc001tjq.1	-	8	1310	c.838G>A	c.(838-840)GAA>AAA	p.E280K		NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase	280			E -> K (in PKU; haplotypes 1,2,4,16,38; partial residual activity).		catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	ACTCACGGTTCGGGGGTATAC	0.547													31	105	---	---	---	---	capture	Missense_Mutation	SNP	103246597	103246597	PAH	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11298	160
TCTN2	79867	broad.mit.edu	37	12	124156084	124156084	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124156084G>A	uc001ufp.2	+	2	241	c.113G>A	c.(112-114)GGC>GAC	p.G38D	TCTN2_uc009zya.2_Missense_Mutation_p.G38D	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	38	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CGAATGTCCGGCCCTGCGGTC	0.617													4	120	---	---	---	---	capture	Missense_Mutation	SNP	124156084	124156084	TCTN2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15608	160
RNF17	56163	broad.mit.edu	37	13	25363875	25363875	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25363875C>A	uc001upr.2	+	9	941	c.900C>A	c.(898-900)AAC>AAA	p.N300K	RNF17_uc010tdd.1_Missense_Mutation_p.N159K|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.N300K|RNF17_uc001ups.2_Missense_Mutation_p.N239K|RNF17_uc001upq.1_Missense_Mutation_p.N300K	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	300					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GTATGTTCAACAATATGGGAA	0.308													15	120	---	---	---	---	capture	Missense_Mutation	SNP	25363875	25363875	RNF17	13	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	13353	160
BRCA2	675	broad.mit.edu	37	13	32903619	32903619	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:32903619A>T	uc001uub.1	+	8	898	c.671A>T	c.(670-672)GAT>GTT	p.D224V	BRCA2_uc001uua.1_Missense_Mutation_p.D101V	NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	224					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTTCCTCATGATACTACTGCT	0.259			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			2	10	---	---	---	---	capture	Missense_Mutation	SNP	32903619	32903619	BRCA2	13	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	1487	160
TUBGCP3	10426	broad.mit.edu	37	13	113181294	113181294	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113181294A>T	uc001vse.1	-	13	1704	c.1517T>A	c.(1516-1518)ATG>AAG	p.M506K	TUBGCP3_uc010tjq.1_Missense_Mutation_p.M496K|TUBGCP3_uc001vsf.2_Missense_Mutation_p.M506K	NM_006322	NP_006313	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	506					G2/M transition of mitotic cell cycle|microtubule nucleation|single fertilization	centriole|cytosol|polar microtubule	gamma-tubulin binding|structural constituent of cytoskeleton			central_nervous_system(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CACAGCTATCATCTTTGTAGT	0.318													44	123	---	---	---	---	capture	Missense_Mutation	SNP	113181294	113181294	TUBGCP3	13	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	16649	160
TGM1	7051	broad.mit.edu	37	14	24729739	24729739	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24729739C>T	uc001wod.2	-	4	798	c.674G>A	c.(673-675)CGC>CAC	p.R225H	TGM1_uc010tog.1_Intron	NM_000359	NP_000350	P22735	TGM1_HUMAN	transglutaminase 1	225			R -> P (in ARCI-TGM1).|R -> H (in ARCI-TGM1).		cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	TGATTGTGTGCGGACTGTGAA	0.587													4	116	---	---	---	---	capture	Missense_Mutation	SNP	24729739	24729739	TGM1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15714	160
NYNRIN	57523	broad.mit.edu	37	14	24886187	24886187	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24886187G>A	uc001wpf.3	+	9	5550	c.5232G>A	c.(5230-5232)CTG>CTA	p.L1744L		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	1744	Integrase catalytic.				DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						TGCCTTTGCTGCACCTGGCCT	0.622													3	25	---	---	---	---	capture	Silent	SNP	24886187	24886187	NYNRIN	14	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	10701	160
FOXA1	3169	broad.mit.edu	37	14	38061688	38061688	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38061688C>T	uc001wuf.2	-	2	613	c.301G>A	c.(301-303)GTG>ATG	p.V101M	FOXA1_uc010tpz.1_Missense_Mutation_p.V68M	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	101					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		ATGGCCGTCACGCCGGCCGCA	0.741													5	10	---	---	---	---	capture	Missense_Mutation	SNP	38061688	38061688	FOXA1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5933	160
PPM1A	5494	broad.mit.edu	37	14	60749967	60749967	+	Silent	SNP	A	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:60749967A>G	uc010apn.2	+	3	948	c.546A>G	c.(544-546)GTA>GTG	p.V182V	PPM1A_uc001xew.3_Silent_p.V255V|PPM1A_uc001xex.3_Silent_p.V182V|PPM1A_uc001xey.3_Silent_p.V182V	NM_021003	NP_066283	P35813	PPM1A_HUMAN	protein phosphatase 1A isoform 1	182					cell cycle arrest|insulin receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein dephosphorylation|Wnt receptor signaling pathway	cytosol|nucleus|protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein serine/threonine phosphatase activity|signal transducer activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.046)		GTGGCTCTGTAATGATTCAGC	0.443													3	133	---	---	---	---	capture	Silent	SNP	60749967	60749967	PPM1A	14	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	12236	160
AHNAK2	113146	broad.mit.edu	37	14	105409035	105409035	+	Silent	SNP	A	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105409035A>G	uc010axc.1	-	7	12873	c.12753T>C	c.(12751-12753)GAT>GAC	p.D4251D	AHNAK2_uc001ypx.2_Silent_p.D4151D	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4251						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGTCATCACATCCGCCTTGG	0.642													14	238	---	---	---	---	capture	Silent	SNP	105409035	105409035	AHNAK2	14	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	415	160
GABRB3	2562	broad.mit.edu	37	15	26866466	26866466	+	Silent	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26866466C>G	uc001zaz.2	-	4	598	c.456G>C	c.(454-456)GGG>GGC	p.G152G	GABRB3_uc010uae.1_Silent_p.G67G|GABRB3_uc001zba.2_Silent_p.G152G|GABRB3_uc001zbb.2_Silent_p.G208G|GABRB3_uc001zbc.2_RNA	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	152	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	CAGACCTGAGCCCATACAGCA	0.448													8	79	---	---	---	---	capture	Silent	SNP	26866466	26866466	GABRB3	15	C	G	G	G	1	0	0	0	0	0	0	0	1	327	26	4	4	6110	160
TCF12	6938	broad.mit.edu	37	15	57543615	57543615	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:57543615C>G	uc002aec.2	+	14	1466	c.1182C>G	c.(1180-1182)CAC>CAG	p.H394Q	TCF12_uc010ugm.1_Missense_Mutation_p.H446Q|TCF12_uc010ugn.1_Missense_Mutation_p.H390Q|TCF12_uc002aea.2_Missense_Mutation_p.H394Q|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Missense_Mutation_p.H394Q|TCF12_uc002aed.2_Missense_Mutation_p.H394Q|TCF12_uc002aee.2_Missense_Mutation_p.H224Q|TCF12_uc010bft.2_Missense_Mutation_p.H224Q|TCF12_uc010ugo.1_Missense_Mutation_p.H158Q|TCF12_uc010ugp.1_Missense_Mutation_p.H28Q|TCF12_uc010ugq.1_Missense_Mutation_p.H28Q|TCF12_uc010ugr.1_5'Flank	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b	394					immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		ACTCACTCCACTCCCTGGTAA	0.448			T	TEC	extraskeletal myxoid chondrosarcoma								14	28	---	---	---	---	capture	Missense_Mutation	SNP	57543615	57543615	TCF12	15	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	15573	160
AQP9	366	broad.mit.edu	37	15	58476317	58476317	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:58476317C>T	uc002aez.2	+	6	1228	c.871C>T	c.(871-873)CTC>TTC	p.L291F	ALDH1A2_uc010ugw.1_Intron|AQP9_uc010ugx.1_Missense_Mutation_p.L226F	NM_020980	NP_066190	O43315	AQP9_HUMAN	aquaporin 9	291	Cytoplasmic (Potential).				cellular response to cAMP|excretion|immune response|metabolic process|response to mercury ion|response to osmotic stress|water homeostasis	integral to plasma membrane|intracellular membrane-bounded organelle	amine transmembrane transporter activity|carboxylic acid transmembrane transporter activity|glycerol channel activity|porin activity|purine base transmembrane transporter activity|pyrimidine base transmembrane transporter activity|water channel activity			ovary(1)	1				GBM - Glioblastoma multiforme(80;0.16)		GAAATATGAACTCAGTGTCAT	0.438													3	120	---	---	---	---	capture	Missense_Mutation	SNP	58476317	58476317	AQP9	15	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	826	160
BNC1	646	broad.mit.edu	37	15	83933192	83933192	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:83933192C>G	uc002bjt.1	-	4	899	c.811G>C	c.(811-813)GAC>CAC	p.D271H	BNC1_uc010uos.1_Missense_Mutation_p.D259H	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	271					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TGACTTTGGTCATGACCCTGC	0.488													3	97	---	---	---	---	capture	Missense_Mutation	SNP	83933192	83933192	BNC1	15	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	1462	160
CHSY1	22856	broad.mit.edu	37	15	101775678	101775678	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101775678G>T	uc002bwt.1	-	3	908	c.425C>A	c.(424-426)TCC>TAC	p.S142Y		NM_014918	NP_055733	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	142	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity				0	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGGCGGGTAGGAGTCGTCCAC	0.483													35	136	---	---	---	---	capture	Missense_Mutation	SNP	101775678	101775678	CHSY1	15	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	3377	160
PTX4	390667	broad.mit.edu	37	16	1537375	1537375	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1537375A>T	uc010uvf.1	-	2	723	c.723T>A	c.(721-723)AGT>AGA	p.S241R		NM_001013658	NP_001013680	Q96A99	PTX4_HUMAN	neuronal pentraxin II-like	246						extracellular region	metal ion binding				0						GGGCAGTCCCACTGAGTACCC	0.677													4	69	---	---	---	---	capture	Missense_Mutation	SNP	1537375	1537375	PTX4	16	A	T	T	T	1	0	0	0	0	1	0	0	0	76	6	4	4	12718	160
PKD1	5310	broad.mit.edu	37	16	2160687	2160687	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2160687C>T	uc002cos.1	-	15	4690	c.4481G>A	c.(4480-4482)CGC>CAC	p.R1494H	PKD1_uc002cot.1_Missense_Mutation_p.R1494H	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	1494	Extracellular (Potential).|PKD 10.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GCTGGCGGGGCGCCCACGGCC	0.652													9	26	---	---	---	---	capture	Missense_Mutation	SNP	2160687	2160687	PKD1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11866	160
ADCY7	113	broad.mit.edu	37	16	50349362	50349362	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50349362G>T	uc002egd.1	+	25	3457	c.3189G>T	c.(3187-3189)AGG>AGT	p.R1063S		NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	1063	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	GCGAGCTGAGGACTTACTTTG	0.572													38	102	---	---	---	---	capture	Missense_Mutation	SNP	50349362	50349362	ADCY7	16	G	T	T	T	1	0	0	0	0	1	0	0	0	529	41	4	4	299	160
CES7	221223	broad.mit.edu	37	16	55907825	55907825	+	Silent	SNP	C	T	T	rs113880150	byFrequency	TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:55907825C>T	uc002eip.2	-	2	347	c.198G>A	c.(196-198)CCG>CCA	p.P66P	CES7_uc002eio.2_Silent_p.P66P|CES7_uc002eiq.2_5'UTR|CES7_uc002eir.2_5'UTR	NM_001143685	NP_001137157	Q6NT32	EST5A_HUMAN	carboxylesterase 7 isoform 1	66						extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.229)|Epithelial(162;0.231)		GGGATCCCAGCGGGGGAGCAG	0.597													7	37	---	---	---	---	capture	Silent	SNP	55907825	55907825	CES7	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3240	160
E2F4	1874	broad.mit.edu	37	16	67226947	67226947	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67226947C>G	uc002erz.2	+	3	344	c.281C>G	c.(280-282)GCT>GGT	p.A94G	EXOC3L_uc002erv.1_5'Flank|EXOC3L_uc002erw.1_5'Flank|EXOC3L_uc002ery.1_5'Flank|EXOC3L_uc010vje.1_5'Flank|EXOC3L_uc002erx.1_5'Flank	NM_001950	NP_001941	Q16254	E2F4_HUMAN	E2F transcription factor 4	94	Dimerization (Potential).				G1 phase of mitotic cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		CGGGAGATTGCTGACAAACTG	0.612													2	6	---	---	---	---	capture	Missense_Mutation	SNP	67226947	67226947	E2F4	16	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	4824	160
C17orf100	388327	broad.mit.edu	37	17	6555309	6555309	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6555309C>A	uc010clp.1	+	1	251	c.76C>A	c.(76-78)CGC>AGC	p.R26S	MED31_uc002gdg.3_5'Flank|MED31_uc002gdh.3_5'Flank	NM_001105520	NP_001098990	D3DTM5	D3DTM5_HUMAN	hypothetical protein LOC388327	26											0						GTCCACGGTCCGCGTGGAGAC	0.736													2	4	---	---	---	---	capture	Missense_Mutation	SNP	6555309	6555309	C17orf100	17	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	1832	160
SLFN13	146857	broad.mit.edu	37	17	33771684	33771684	+	Missense_Mutation	SNP	C	T	T	rs148604980		TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33771684C>T	uc002hjk.1	-	1	1346	c.1016G>A	c.(1015-1017)CGC>CAC	p.R339H	SLFN13_uc010wch.1_Missense_Mutation_p.R339H|SLFN13_uc002hjl.2_Missense_Mutation_p.R339H|SLFN13_uc010ctt.2_Missense_Mutation_p.R21H|SLFN13_uc002hjm.2_Missense_Mutation_p.R8H	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13	339						intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TGTCAAGGGGCGGATGTACTT	0.488													26	107	---	---	---	---	capture	Missense_Mutation	SNP	33771684	33771684	SLFN13	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14628	160
IKZF3	22806	broad.mit.edu	37	17	37985642	37985642	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37985642C>G	uc002hsu.2	-	3	223	c.161G>C	c.(160-162)GGA>GCA	p.G54A	IKZF3_uc002htd.2_Intron|IKZF3_uc010cwd.2_Missense_Mutation_p.G54A|IKZF3_uc002hsv.2_Intron|IKZF3_uc010cwe.2_Missense_Mutation_p.G54A|IKZF3_uc010cwf.2_Missense_Mutation_p.G54A|IKZF3_uc010cwg.2_Missense_Mutation_p.G54A|IKZF3_uc002hsw.2_Missense_Mutation_p.G54A|IKZF3_uc002hsx.2_Missense_Mutation_p.G54A|IKZF3_uc002hsy.2_Missense_Mutation_p.G54A|IKZF3_uc002hsz.2_Missense_Mutation_p.G54A|IKZF3_uc002hta.2_Missense_Mutation_p.G54A|IKZF3_uc002htb.2_RNA|IKZF3_uc010cwh.2_Missense_Mutation_p.G54A|IKZF3_uc002htc.2_5'UTR	NM_012481	NP_036613	Q9UKT9	IKZF3_HUMAN	aiolos isoform 1	54					B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CGGCTCACCTCCTATGTCTTC	0.428													38	77	---	---	---	---	capture	Missense_Mutation	SNP	37985642	37985642	IKZF3	17	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	7539	160
NAGS	162417	broad.mit.edu	37	17	42085912	42085912	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42085912C>A	uc002ies.2	+	7	1548	c.1548C>A	c.(1546-1548)AAC>AAA	p.N516K	NAGS_uc010czn.2_Missense_Mutation_p.N524K|NAGS_uc002iet.2_Missense_Mutation_p.N140K	NM_153006	NP_694551	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	516	N-acetyltransferase.				arginine biosynthetic process|urea cycle	mitochondrial matrix	acetyl-CoA:L-glutamate N-acetyltransferase activity				0		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)	L-Glutamic Acid(DB00142)	AGTTGGTCAACCACGCCAAGG	0.557													59	125	---	---	---	---	capture	Missense_Mutation	SNP	42085912	42085912	NAGS	17	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	10055	160
SEPT4	5414	broad.mit.edu	37	17	56603127	56603127	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56603127C>T	uc002iwm.1	-	4	595	c.467G>A	c.(466-468)GGC>GAC	p.G156D	SEPT4_uc002iwk.1_Missense_Mutation_p.G9D|SEPT4_uc010wnw.1_Missense_Mutation_p.G9D|SEPT4_uc002iwl.1_Missense_Mutation_p.G9D|SEPT4_uc002iwn.1_Missense_Mutation_p.G57D|SEPT4_uc002iwo.1_Missense_Mutation_p.G137D|SEPT4_uc002iwp.1_Missense_Mutation_p.G137D|SEPT4_uc010wnx.1_Missense_Mutation_p.G171D|SEPT4_uc010wny.1_Missense_Mutation_p.G148D|SEPT4_uc010dcy.1_Missense_Mutation_p.G38D	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1	156	GTP (By similarity).			G -> D (in Ref. 7; BAG37789).|GKS->ENP: Loss of TGF-beta-induced apoptosis. No translocation to the nucleus following TGF-beta treatment. Loss of XIAP-binding.	apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGTGGATTTGCCCAGGCCAGA	0.502													3	58	---	---	---	---	capture	Missense_Mutation	SNP	56603127	56603127	SEPT4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13959	160
CD7	924	broad.mit.edu	37	17	80274632	80274632	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80274632C>T	uc002kel.1	-	2	417	c.308G>A	c.(307-309)CGC>CAC	p.R103H	CD7_uc010din.2_Missense_Mutation_p.R103H|CD7_uc002kem.2_Silent_p.P84P|CD7_uc010wvk.1_Missense_Mutation_p.R103H	NM_006137	NP_006128	P09564	CD7_HUMAN	CD7 antigen precursor	103	Ig-like.|Extracellular (Probable).				immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|membrane fraction|plasma membrane	receptor activity				0	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			CAGCTGCAGGCGGTGCATGGT	0.612													41	153	---	---	---	---	capture	Missense_Mutation	SNP	80274632	80274632	CD7	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3003	160
B3GNTL1	146712	broad.mit.edu	37	17	80915279	80915279	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80915279C>G	uc002kgg.1	-	9	831	c.817G>C	c.(817-819)GGG>CGG	p.G273R	B3GNTL1_uc002kgf.1_Missense_Mutation_p.G162R|B3GNTL1_uc002kge.1_RNA	NM_001009905	NP_001009905	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal	273							transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			AGCCGGCGCCCCTGCTTGCCA	0.692													2	31	---	---	---	---	capture	Missense_Mutation	SNP	80915279	80915279	B3GNTL1	17	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	1254	160
SMCHD1	23347	broad.mit.edu	37	18	2700592	2700592	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2700592A>T	uc002klm.3	+	11	1587	c.1398A>T	c.(1396-1398)AGA>AGT	p.R466S	SMCHD1_uc002klk.3_5'Flank	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	466					chromosome organization		ATP binding				0						AAGCAGCTAGAGGGAAAAGGC	0.303													2	12	---	---	---	---	capture	Missense_Mutation	SNP	2700592	2700592	SMCHD1	18	A	T	T	T	1	0	0	0	0	1	0	0	0	141	11	4	4	14680	160
C18orf8	29919	broad.mit.edu	37	18	21089223	21089223	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21089223C>G	uc010xax.1	+	5	509	c.388C>G	c.(388-390)CAA>GAA	p.Q130E	C18orf8_uc010xau.1_Translation_Start_Site|C18orf8_uc010xav.1_Intron|C18orf8_uc010xaw.1_Intron|C18orf8_uc002kul.2_RNA	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1	130										ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CATAACAGATCAAGGAATCGA	0.294													8	19	---	---	---	---	capture	Missense_Mutation	SNP	21089223	21089223	C18orf8	18	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	1891	160
DSG4	147409	broad.mit.edu	37	18	28968938	28968938	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28968938G>A	uc002kwq.2	+	5	609	c.474G>A	c.(472-474)TCG>TCA	p.S158S	DSG4_uc002kwr.2_Silent_p.S158S	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	158	Cadherin 2.|Extracellular (Potential).		Missing (in LAH1).		homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CAGTCTTTTCGCAAAGTGTAT	0.413													27	90	---	---	---	---	capture	Silent	SNP	28968938	28968938	DSG4	18	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4734	160
NOL4	8715	broad.mit.edu	37	18	31432915	31432915	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:31432915G>A	uc010dmi.2	-	11	2037	c.1808C>T	c.(1807-1809)CCA>CTA	p.P603L	NOL4_uc010xbs.1_Missense_Mutation_p.P318L|NOL4_uc002kxr.3_Missense_Mutation_p.P375L|NOL4_uc010xbt.1_Missense_Mutation_p.P529L|NOL4_uc010dmh.2_Missense_Mutation_p.P465L|NOL4_uc010xbu.1_Missense_Mutation_p.P539L|NOL4_uc002kxt.3_Missense_Mutation_p.P501L	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4	603						nucleolus	RNA binding			ovary(3)	3						GATTTCAGTTGGACTCAGCTG	0.448													4	99	---	---	---	---	capture	Missense_Mutation	SNP	31432915	31432915	NOL4	18	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	10431	160
MYO5B	4645	broad.mit.edu	37	18	47405384	47405384	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:47405384G>T	uc002leb.2	-	24	3495	c.3207C>A	c.(3205-3207)AAC>AAA	p.N1069K	MYO5B_uc002lea.2_Missense_Mutation_p.N210K	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	1069	Potential.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		CCTTCACAAGGTTCTGGTACC	0.488													27	89	---	---	---	---	capture	Missense_Mutation	SNP	47405384	47405384	MYO5B	18	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	9989	160
CCBE1	147372	broad.mit.edu	37	18	57105364	57105364	+	Silent	SNP	C	T	T	rs144169027		TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:57105364C>T	uc002lib.2	-	10	1036	c.966G>A	c.(964-966)GCG>GCA	p.A322A	CCBE1_uc010dpq.2_Silent_p.A51A|CCBE1_uc002lia.2_Silent_p.A175A	NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	322	Collagen-like 2.				lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				TGGGCCCAGGCGCTCCTCTCT	0.507													8	35	---	---	---	---	capture	Silent	SNP	57105364	57105364	CCBE1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	2705	160
TNFRSF11A	8792	broad.mit.edu	37	18	60033975	60033975	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:60033975C>T	uc002lin.2	+	8	803	c.765C>T	c.(763-765)GGC>GGT	p.G255G	TNFRSF11A_uc010dpv.2_Intron	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,	255	Cytoplasmic (Potential).				adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity			breast(2)|lung(1)	3		Colorectal(73;0.188)				AGGCTTGTGGCCGCCTAAGTG	0.403									Paget_Disease_of_Bone				5	164	---	---	---	---	capture	Silent	SNP	60033975	60033975	TNFRSF11A	18	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	16167	160
RTTN	25914	broad.mit.edu	37	18	67718720	67718720	+	Silent	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:67718720G>T	uc002lkp.2	-	39	5318	c.5250C>A	c.(5248-5250)CTC>CTA	p.L1750L	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Silent_p.L838L|RTTN_uc010dqp.2_Silent_p.L2L	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	1750							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				CTTTCCTCAGGAGCATGGCCA	0.408													29	71	---	---	---	---	capture	Silent	SNP	67718720	67718720	RTTN	18	G	T	T	T	1	0	0	0	0	0	0	0	1	522	41	4	4	13629	160
TCF3	6929	broad.mit.edu	37	19	1619469	1619469	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1619469C>G	uc002ltr.2	-	15	1239	c.1172G>C	c.(1171-1173)AGT>ACT	p.S391T	TCF3_uc002lto.2_Missense_Mutation_p.S152T|TCF3_uc002ltt.3_Missense_Mutation_p.S391T|TCF3_uc002ltq.2_Missense_Mutation_p.S340T|TCF3_uc002lts.1_Missense_Mutation_p.S307T|TCF3_uc010dso.1_Intron	NM_003200	NP_003191	P15923	TFE2_HUMAN	transcription factor 3 isoform E12	391	Leucine-zipper.				B cell lineage commitment|B cell lineage commitment|G1 phase of mitotic cell cycle|immunoglobulin V(D)J recombination|muscle cell differentiation|positive regulation of B cell proliferation|positive regulation of cell cycle|positive regulation of muscle cell differentiation|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus|protein complex|transcription factor complex	bHLH transcription factor binding|DNA binding|E-box binding|identical protein binding|mitogen-activated protein kinase kinase kinase binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|vitamin D response element binding			lung(2)|breast(2)|ovary(1)|large_intestine(1)|skin(1)	7		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCTATCTTACTCTGCTGCAG	0.682			T	PBX1|HLF|TFPT	pre B-ALL								7	26	---	---	---	---	capture	Missense_Mutation	SNP	1619469	1619469	TCF3	19	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	15579	160
RFX2	5990	broad.mit.edu	37	19	6007158	6007158	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6007158C>T	uc002meb.2	-	12	1536	c.1267G>A	c.(1267-1269)GCC>ACC	p.A423T	RFX2_uc002mec.2_Missense_Mutation_p.A398T|RFX2_uc002med.1_3'UTR	NM_000635	NP_000626	P48378	RFX2_HUMAN	regulatory factor X2 isoform a	423					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			breast(4)|ovary(1)|skin(1)	6						GGCAGGACGGCGCCCTCGGGG	0.662													3	104	---	---	---	---	capture	Missense_Mutation	SNP	6007158	6007158	RFX2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13158	160
MAN2B1	4125	broad.mit.edu	37	19	12757445	12757445	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12757445C>A	uc002mub.2	-	24	3101	c.3025G>T	c.(3025-3027)GTG>TTG	p.V1009L	MAN2B1_uc010dyv.1_Missense_Mutation_p.V1008L	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	1009					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						TAACCATCCACCTCCTTCCAT	0.602													3	93	---	---	---	---	capture	Missense_Mutation	SNP	12757445	12757445	MAN2B1	19	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	9130	160
DCAF15	90379	broad.mit.edu	37	19	14065391	14065391	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14065391G>A	uc002mxt.2	+	3	290	c.284G>A	c.(283-285)AGC>AAC	p.S95N	PODNL1_uc010xnj.1_5'Flank|PODNL1_uc002mxs.2_5'Flank	NM_138353	NP_612362	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	95										central_nervous_system(1)	1						TCCTACACCAGCAGCAGTGGG	0.582													3	91	---	---	---	---	capture	Missense_Mutation	SNP	14065391	14065391	DCAF15	19	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	4226	160
MAP1S	55201	broad.mit.edu	37	19	17844118	17844118	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17844118C>T	uc002nhe.1	+	6	2914	c.2905C>T	c.(2905-2907)CAG>TAG	p.Q969*	MAP1S_uc010eba.1_Intron|MAP1S_uc002nhf.1_Nonsense_Mutation_p.Q217*|MAP1S_uc010xpv.1_Nonsense_Mutation_p.Q943*	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	969	Necessary for association with actin (By similarity).|Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for the mitochondrial aggregation and genome destruction.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						GGAGTTCTTCCAGCGCGTGCG	0.687													2	16	---	---	---	---	capture	Nonsense_Mutation	SNP	17844118	17844118	MAP1S	19	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	9148	160
ATP13A1	57130	broad.mit.edu	37	19	19756301	19756301	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19756301C>G	uc002nnh.3	-	26	3573	c.3545G>C	c.(3544-3546)TGC>TCC	p.C1182S	GMIP_uc002nnd.2_5'Flank|GMIP_uc010xrb.1_5'Flank|GMIP_uc010xrc.1_5'Flank|ATP13A1_uc002nne.2_Missense_Mutation_p.C322S|ATP13A1_uc002nnf.3_Missense_Mutation_p.C550S|ATP13A1_uc002nng.2_Missense_Mutation_p.C1064S	NM_020410	NP_065143	Q9HD20	AT131_HUMAN	ATPase type 13A1	1182	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(3)|large_intestine(2)|central_nervous_system(1)	6						GAGCGCCAGGCAGAAGTCCAG	0.647													2	22	---	---	---	---	capture	Missense_Mutation	SNP	19756301	19756301	ATP13A1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	1114	160
GRAMD1A	57655	broad.mit.edu	37	19	35512755	35512755	+	Silent	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35512755C>A	uc010xse.1	+	15	1877	c.1740C>A	c.(1738-1740)GGC>GGA	p.G580G	GRAMD1A_uc002nxk.2_Silent_p.G573G|GRAMD1A_uc002nxl.2_Silent_p.G346G|GRAMD1A_uc010xsf.1_Silent_p.G585G|GRAMD1A_uc002nxm.1_RNA|GRAMD1A_uc002nxn.1_Silent_p.G195G	NM_020895	NP_065946	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A isoform 1	580						integral to membrane					0	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CCCGGGCCGGCATTCACACCT	0.711													4	57	---	---	---	---	capture	Silent	SNP	35512755	35512755	GRAMD1A	19	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	6680	160
ZNF565	147929	broad.mit.edu	37	19	36673611	36673611	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36673611G>A	uc002odn.2	-	5	1365	c.1257C>T	c.(1255-1257)TAC>TAT	p.Y419Y	ZNF565_uc010ees.2_Silent_p.Y354Y|ZNF565_uc002odo.2_Silent_p.Y419Y	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565	419	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			CCTTACATTCGTAGGGTTTGT	0.448													31	116	---	---	---	---	capture	Silent	SNP	36673611	36673611	ZNF565	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	17875	160
SIRT2	22933	broad.mit.edu	37	19	39371782	39371782	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39371782A>C	uc002ojt.1	-	11	905	c.705T>G	c.(703-705)TTT>TTG	p.F235L	RINL_uc002ojq.2_5'Flank|RINL_uc010xuo.1_5'Flank|SIRT2_uc010egh.1_Missense_Mutation_p.F198L|SIRT2_uc010egi.1_Missense_Mutation_p.F198L|SIRT2_uc002ojs.1_Missense_Mutation_p.F215L|SIRT2_uc002oju.1_Missense_Mutation_p.F198L|SIRT2_uc010egj.1_Missense_Mutation_p.F198L|SIRT2_uc002ojv.1_Missense_Mutation_p.F233L	NM_012237	NP_036369	Q8IXJ6	SIRT2_HUMAN	sirtuin 2 isoform 1	235	Deacetylase sirtuin-type.				cell division|chromatin silencing at rDNA|chromatin silencing at telomere|mitosis|negative regulation of striated muscle tissue development|protein ADP-ribosylation|regulation of exit from mitosis|regulation of phosphorylation|response to redox state	chromatin silencing complex|cytoplasm|microtubule	histone acetyltransferase binding|histone deacetylase binding|NAD+ binding|NAD-dependent histone deacetylase activity|transcription factor binding|tubulin deacetylase activity|ubiquitin binding|zinc ion binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			GGCTCTCACCAAAAAAGACGA	0.617													2	31	---	---	---	---	capture	Missense_Mutation	SNP	39371782	39371782	SIRT2	19	A	C	C	C	1	0	0	0	0	1	0	0	0	63	5	4	4	14231	160
PSG5	5673	broad.mit.edu	37	19	43689016	43689016	+	Silent	SNP	G	A	A	rs143404539	byFrequency	TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43689016G>A	uc002ovu.2	-	2	479	c.348C>T	c.(346-348)GAC>GAT	p.D116D	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Silent_p.D44D|PSG5_uc002ovx.2_Silent_p.D116D|PSG5_uc002ovv.2_Silent_p.D116D|PSG5_uc002ovw.2_Silent_p.D116D	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	116	Ig-like V-type.				female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				AGGATCCTGCGTCTTCCCGGG	0.438													129	528	---	---	---	---	capture	Silent	SNP	43689016	43689016	PSG5	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12553	160
PRKD2	25865	broad.mit.edu	37	19	47197301	47197301	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47197301G>A	uc002pfh.2	-	11	1749	c.1407C>T	c.(1405-1407)ATC>ATT	p.I469I	PRKD2_uc010ekt.2_5'Flank|PRKD2_uc002pfe.2_5'UTR|PRKD2_uc002pff.2_5'UTR|PRKD2_uc002pfg.2_Silent_p.I312I|PRKD2_uc002pfi.2_Silent_p.I469I|PRKD2_uc002pfj.2_Silent_p.I469I|PRKD2_uc010xye.1_Silent_p.I469I|PRKD2_uc002pfk.2_Silent_p.I312I	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	469	PH.				cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TGGCAGTGACGATCTCAAAGC	0.647													3	96	---	---	---	---	capture	Silent	SNP	47197301	47197301	PRKD2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	12415	160
DHX34	9704	broad.mit.edu	37	19	47879753	47879753	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47879753C>T	uc010xyn.1	+	12	2876	c.2535C>T	c.(2533-2535)TTC>TTT	p.F845F	DHX34_uc010xyo.1_5'Flank	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	845						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CCTGCGTCTTCGCTGGCAGCC	0.652													6	14	---	---	---	---	capture	Silent	SNP	47879753	47879753	DHX34	19	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	4465	160
ZNF649	65251	broad.mit.edu	37	19	52394397	52394397	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52394397C>T	uc002pxy.2	-	5	1260	c.992G>A	c.(991-993)GGC>GAC	p.G331D	ZNF577_uc010ydf.1_5'Flank	NM_023074	NP_075562	Q9BS31	ZN649_HUMAN	zinc finger protein 649	331	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GTTGAGATTGCCCTTCTGAAT	0.453													3	135	---	---	---	---	capture	Missense_Mutation	SNP	52394397	52394397	ZNF649	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17942	160
ZNF347	84671	broad.mit.edu	37	19	53645153	53645153	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53645153T>A	uc002qbb.1	-	5	997	c.928A>T	c.(928-930)ATC>TTC	p.I310F	ZNF347_uc010eql.1_Missense_Mutation_p.I311F|ZNF347_uc002qbc.1_Missense_Mutation_p.I311F	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN	zinc finger protein 347	310	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0179)		CCAGTATGGATCACCTGATGG	0.388													65	222	---	---	---	---	capture	Missense_Mutation	SNP	53645153	53645153	ZNF347	19	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	17741	160
NLRP7	199713	broad.mit.edu	37	19	55447703	55447703	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55447703G>A	uc002qih.3	-	6	2302	c.2226C>T	c.(2224-2226)ATC>ATT	p.I742I	NLRP7_uc002qig.3_Silent_p.I714I|NLRP7_uc002qii.3_Silent_p.I742I|NLRP7_uc010esk.2_Silent_p.I742I|NLRP7_uc010esl.2_Silent_p.I770I	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	742							ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		GTTCCCACTCGATGTGCCCTG	0.552													12	43	---	---	---	---	capture	Silent	SNP	55447703	55447703	NLRP7	19	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	10389	160
ZNF329	79673	broad.mit.edu	37	19	58640193	58640193	+	Silent	SNP	G	A	A	rs116840582	byFrequency;by1000genomes	TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58640193G>A	uc002qrn.2	-	4	915	c.678C>T	c.(676-678)ACC>ACT	p.T226T	ZNF329_uc010euk.1_RNA|ZNF329_uc002qro.1_RNA|ZNF329_uc002qrp.1_RNA	NM_024620	NP_078896	Q86UD4	ZN329_HUMAN	zinc finger protein 329	226					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		GCTTCTCTCCGGTGTGAGTTC	0.433													26	425	---	---	---	---	capture	Silent	SNP	58640193	58640193	ZNF329	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17727	160
CIB4	130106	broad.mit.edu	37	2	26805768	26805768	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26805768G>A	uc002rhm.2	-	6	481	c.452C>T	c.(451-453)TCG>TTG	p.S151L		NM_001029881	NP_001025052	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	151	EF-hand 3.						calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCCAGATCCGACTCACTCAG	0.542													22	36	---	---	---	---	capture	Missense_Mutation	SNP	26805768	26805768	CIB4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3388	160
CAD	790	broad.mit.edu	37	2	27465508	27465508	+	Silent	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27465508G>T	uc002rji.2	+	41	6405	c.6243G>T	c.(6241-6243)CTG>CTT	p.L2081L	CAD_uc010eyw.2_Silent_p.L2018L	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	2081	ATCase (Aspartate transcarbamylase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	TGGGTGACCTGAAGCACGGAC	0.587													3	61	---	---	---	---	capture	Silent	SNP	27465508	27465508	CAD	2	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	2541	160
BIRC6	57448	broad.mit.edu	37	2	32710744	32710744	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:32710744G>A	uc010ezu.2	+	40	7865	c.7731G>A	c.(7729-7731)CAG>CAA	p.Q2577Q		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	2577					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GACTTGAACAGCAAGCAGAAC	0.373													3	63	---	---	---	---	capture	Silent	SNP	32710744	32710744	BIRC6	2	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	1426	160
PRKCE	5581	broad.mit.edu	37	2	46228662	46228662	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:46228662A>G	uc002rut.2	+	7	1140	c.943A>G	c.(943-945)AAC>GAC	p.N315D		NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon	315					activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			CAAAATCACCAACAGCGGCCA	0.552													2	22	---	---	---	---	capture	Missense_Mutation	SNP	46228662	46228662	PRKCE	2	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	12407	160
RAB11FIP5	26056	broad.mit.edu	37	2	73316179	73316179	+	Silent	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73316179T>C	uc002siu.3	-	2	937	c.696A>G	c.(694-696)AAA>AAG	p.K232K	RAB11FIP5_uc002sit.3_Silent_p.K154K	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	232					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						GGAAGAAGCCTTTGGCTTTGC	0.602													34	96	---	---	---	---	capture	Silent	SNP	73316179	73316179	RAB11FIP5	2	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	12792	160
PAX8	7849	broad.mit.edu	37	2	113999249	113999249	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113999249G>T	uc010yxt.1	-	7	822	c.656C>A	c.(655-657)CCC>CAC	p.P219H	PAX8_uc010yxu.1_Missense_Mutation_p.P219H|PAX8_uc010yxv.1_Missense_Mutation_p.P219H|PAX8_uc002tjm.2_Missense_Mutation_p.P219H|PAX8_uc002tjn.2_Missense_Mutation_p.P219H|PAX8_uc010fku.1_Missense_Mutation_p.P219H|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A	219					branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						GTGCTTTCGGGGTCCGCTGCT	0.597			T	PPARG	follicular thyroid		Thyroid dysgenesis 						22	52	---	---	---	---	capture	Missense_Mutation	SNP	113999249	113999249	PAX8	2	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	11388	160
TTN	7273	broad.mit.edu	37	2	179407009	179407009	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179407009C>G	uc010zfg.1	-	298	89994	c.89770G>C	c.(89770-89772)GAG>CAG	p.E29924Q	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E23619Q|TTN_uc010zfi.1_Missense_Mutation_p.E23552Q|TTN_uc010zfj.1_Missense_Mutation_p.E23427Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30851							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCGACACTCTATGACCTCA	0.463													2	7	---	---	---	---	capture	Missense_Mutation	SNP	179407009	179407009	TTN	2	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	16617	160
MYO1B	4430	broad.mit.edu	37	2	192255148	192255148	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192255148T>C	uc010fsg.2	+	18	2167	c.1912T>C	c.(1912-1914)TAT>CAT	p.Y638H	MYO1B_uc002usq.2_Missense_Mutation_p.Y638H|MYO1B_uc002usr.2_Missense_Mutation_p.Y638H|MYO1B_uc002usu.2_5'Flank	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	638	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			CAGGCAGGCCTATGAACCTTG	0.468													3	111	---	---	---	---	capture	Missense_Mutation	SNP	192255148	192255148	MYO1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	9979	160
TMEFF2	23671	broad.mit.edu	37	2	193049126	193049126	+	Silent	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:193049126T>C	uc002utc.2	-	3	760	c.366A>G	c.(364-366)AAA>AAG	p.K122K	TMEFF2_uc002utd.1_Silent_p.K122K	NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two	122	Kazal-like 1.|Extracellular (Potential).					extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			CACTCTGCTGTTTGCATGCAG	0.473													15	69	---	---	---	---	capture	Silent	SNP	193049126	193049126	TMEFF2	2	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	15899	160
PAX3	5077	broad.mit.edu	37	2	223096854	223096854	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:223096854G>C	uc010fwo.2	-	5	1101	c.735C>G	c.(733-735)GAC>GAG	p.D245E	PAX3_uc002vmt.1_Missense_Mutation_p.D245E|PAX3_uc002vmy.1_Missense_Mutation_p.D244E|PAX3_uc002vmv.1_Missense_Mutation_p.D245E|PAX3_uc002vmw.1_Missense_Mutation_p.D245E|PAX3_uc002vmx.1_Missense_Mutation_p.D245E	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	245	Homeobox.				apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TAGTATAAATGTCAGGGTAAT	0.527			T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						56	130	---	---	---	---	capture	Missense_Mutation	SNP	223096854	223096854	PAX3	2	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	11383	160
ESPNL	339768	broad.mit.edu	37	2	239036280	239036280	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:239036280G>C	uc002vxq.3	+	7	1230	c.1120G>C	c.(1120-1122)GCC>CCC	p.A374P	ESPNL_uc010fyw.2_Missense_Mutation_p.A70P	NM_194312	NP_919288	Q6ZVH7	ESPNL_HUMAN	espin-like	374	Pro-rich.									pancreas(1)	1		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CCTCAGCCCGGCCTGGCCTGG	0.672													2	22	---	---	---	---	capture	Missense_Mutation	SNP	239036280	239036280	ESPNL	2	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	5210	160
OR6B3	150681	broad.mit.edu	37	2	240985270	240985270	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:240985270C>T	uc010zoe.1	-	1	220	c.220G>A	c.(220-222)GTG>ATG	p.V74M	PRR21_uc010zod.1_5'Flank	NM_173351	NP_775486	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		ATGTCAGACACGTACCAGATC	0.557													34	104	---	---	---	---	capture	Missense_Mutation	SNP	240985270	240985270	OR6B3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11093	160
MYEOV2	150678	broad.mit.edu	37	2	241069334	241069334	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241069334C>T	uc002vyu.1	-	4	375	c.375G>A	c.(373-375)TCG>TCA	p.S125S		NM_138336	NP_612209	Q8WXC6	MYOV2_HUMAN	hypothetical protein LOC150678 isoform 1	Error:Variant_position_missing_in_Q8WXC6_after_alignment											0		all_epithelial(40;1.56e-11)|Breast(86;0.0002)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.81e-30)|all cancers(36;1.1e-27)|OV - Ovarian serous cystadenocarcinoma(60;2.74e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.54e-06)|Lung(119;0.00361)|LUSC - Lung squamous cell carcinoma(224;0.0153)|Colorectal(34;0.0202)|COAD - Colon adenocarcinoma(134;0.143)		TTACCTCTTCCGACACCACAG	0.617													7	62	---	---	---	---	capture	Silent	SNP	241069334	241069334	MYEOV2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9936	160
D2HGDH	728294	broad.mit.edu	37	2	242683078	242683078	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242683078A>G	uc002wce.1	+	5	705	c.532A>G	c.(532-534)AGC>GGC	p.S178G	D2HGDH_uc010zpc.1_RNA|D2HGDH_uc010fzq.1_Missense_Mutation_p.S44G|D2HGDH_uc002wcg.1_RNA	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor	178	FAD-binding PCMH-type.				2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		GGAGGAGCTGAGCCGGTATGT	0.642													2	31	---	---	---	---	capture	Missense_Mutation	SNP	242683078	242683078	D2HGDH	2	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	4173	160
RBCK1	10616	broad.mit.edu	37	20	409649	409649	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:409649C>T	uc002wdp.3	+	11	2056	c.1363C>T	c.(1363-1365)CAG>TAG	p.Q455*	RBCK1_uc002wdq.3_Nonsense_Mutation_p.Q413*|RBCK1_uc010fzy.2_RNA|RBCK1_uc002wdr.3_Nonsense_Mutation_p.Q285*	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing	455	IBR-type 2.				interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				GATCGTGGTACAGAAGAAGGA	0.682													3	77	---	---	---	---	capture	Nonsense_Mutation	SNP	409649	409649	RBCK1	20	C	T	T	T	1	0	0	0	0	0	1	0	0	221	17	5	2	13002	160
RBPJL	11317	broad.mit.edu	37	20	43936878	43936878	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43936878G>T	uc002xns.2	+	2	190	c.118G>T	c.(118-120)GGC>TGC	p.G40C	MATN4_uc002xnn.2_5'UTR|MATN4_uc002xno.2_5'UTR|MATN4_uc002xnp.2_5'UTR|MATN4_uc010zwr.1_5'Flank|MATN4_uc002xnr.1_5'UTR|RBPJL_uc002xnt.2_Missense_Mutation_p.G40C	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L	40					signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				GAGCCTCCCGGGCACTTGGAC	0.642													6	64	---	---	---	---	capture	Missense_Mutation	SNP	43936878	43936878	RBPJL	20	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	13057	160
GGTLC2	91227	broad.mit.edu	37	22	22989259	22989259	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22989259T>A	uc010gtt.2	+	2	246	c.212T>A	c.(211-213)ATC>AAC	p.I71N	LOC96610_uc011aim.1_Intron|POM121L1P_uc011ait.1_5'Flank|GGTLC2_uc010gts.2_Missense_Mutation_p.I71N	NM_199127	NP_954578	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase-like 4 isoform 1	71					glutathione biosynthetic process		gamma-glutamyltransferase activity			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		GTCAGCGAGATCCTGTTCAAT	0.592													5	143	---	---	---	---	capture	Missense_Mutation	SNP	22989259	22989259	GGTLC2	22	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	6305	160
PLA2G6	8398	broad.mit.edu	37	22	38541510	38541510	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38541510C>G	uc003auy.1	-	3	496	c.360G>C	c.(358-360)TGG>TGC	p.W120C	PLA2G6_uc003auz.1_Missense_Mutation_p.W120C|PLA2G6_uc003ava.1_Missense_Mutation_p.W120C|PLA2G6_uc003avb.2_Missense_Mutation_p.W120C|PLA2G6_uc010gxk.1_Intron|PLA2G6_uc011ano.1_Missense_Mutation_p.W120C	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a	120					cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	GGGCCACTGACCAGCTGGGGT	0.577													2	21	---	---	---	---	capture	Missense_Mutation	SNP	38541510	38541510	PLA2G6	22	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	11911	160
RANGAP1	5905	broad.mit.edu	37	22	41652054	41652054	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41652054G>T	uc003azs.2	-	9	2514	c.1044C>A	c.(1042-1044)TTC>TTA	p.F348L	RANGAP1_uc003azt.2_Missense_Mutation_p.F348L|RANGAP1_uc003azu.2_Missense_Mutation_p.F348L|RANGAP1_uc011aoz.1_Missense_Mutation_p.F293L	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	348					mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						TGGCCATGTTGAAGCCCTCCA	0.552													3	61	---	---	---	---	capture	Missense_Mutation	SNP	41652054	41652054	RANGAP1	22	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	12928	160
SBF1	6305	broad.mit.edu	37	22	50904674	50904674	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50904674G>A	uc003blh.2	-	8	997	c.802C>T	c.(802-804)CCC>TCC	p.P268S	SBF1_uc011arx.1_5'UTR|SBF1_uc003bli.2_Missense_Mutation_p.P269S	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	268	DENN.				protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GGCAGGATGGGCACATAGGTG	0.672													4	59	---	---	---	---	capture	Missense_Mutation	SNP	50904674	50904674	SBF1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13750	160
DNAH1	25981	broad.mit.edu	37	3	52393305	52393305	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52393305C>G	uc011bef.1	+	26	4571	c.4310C>G	c.(4309-4311)ACC>AGC	p.T1437S		NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1437	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGCCAGGTGACCATCGCTGGG	0.627													2	7	---	---	---	---	capture	Missense_Mutation	SNP	52393305	52393305	DNAH1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	4555	160
OR5K2	402135	broad.mit.edu	37	3	98216751	98216751	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98216751C>G	uc011bgx.1	+	1	227	c.227C>G	c.(226-228)GCT>GGT	p.A76G		NM_001004737	NP_001004737	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K,	76	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						TGTGCCTGTGCTATTACCCCC	0.413													67	270	---	---	---	---	capture	Missense_Mutation	SNP	98216751	98216751	OR5K2	3	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	11071	160
PPP2R3A	5523	broad.mit.edu	37	3	135721607	135721607	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:135721607G>T	uc003eqv.1	+	2	1832	c.1267G>T	c.(1267-1269)GGA>TGA	p.G423*	PPP2R3A_uc011blz.1_Intron	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	423					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						AGAGTCAGATGGAAAGAAAGC	0.358													32	68	---	---	---	---	capture	Nonsense_Mutation	SNP	135721607	135721607	PPP2R3A	3	G	T	T	T	1	0	0	0	0	0	1	0	0	611	47	5	4	12289	160
ACPL2	92370	broad.mit.edu	37	3	141006223	141006223	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:141006223G>T	uc003etu.2	+	7	732	c.433G>T	c.(433-435)GAA>TAA	p.E145*	ACPL2_uc003etv.2_Nonsense_Mutation_p.E145*|ACPL2_uc011bna.1_Nonsense_Mutation_p.E107*|ACPL2_uc011bnb.1_Nonsense_Mutation_p.E128*	NM_152282	NP_689495	Q8TE99	ACPL2_HUMAN	acid phosphatase-like 2 precursor	145						extracellular region	acid phosphatase activity			skin(1)	1						AGCCTCTTTCGAAAGCCCCTT	0.493													77	164	---	---	---	---	capture	Nonsense_Mutation	SNP	141006223	141006223	ACPL2	3	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	166	160
PLCH1	23007	broad.mit.edu	37	3	155198910	155198910	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:155198910T>A	uc011bok.1	-	23	5206	c.4929A>T	c.(4927-4929)AAA>AAT	p.K1643N	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.K1605N	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1643					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GGCCACCCCCTTTCGTGTTCT	0.562													19	52	---	---	---	---	capture	Missense_Mutation	SNP	155198910	155198910	PLCH1	3	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	11940	160
MECOM	2122	broad.mit.edu	37	3	168834168	168834168	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:168834168C>T	uc003ffi.3	-	7	1197	c.928G>A	c.(928-930)GGC>AGC	p.G310S	MECOM_uc010hwk.1_Missense_Mutation_p.G333S|MECOM_uc003ffj.3_Missense_Mutation_p.G375S|MECOM_uc011bpi.1_Missense_Mutation_p.G311S|MECOM_uc003ffn.3_Missense_Mutation_p.G310S|MECOM_uc003ffk.2_Missense_Mutation_p.G310S|MECOM_uc003ffl.2_Missense_Mutation_p.G470S|MECOM_uc011bpj.1_Missense_Mutation_p.G498S|MECOM_uc011bpk.1_Missense_Mutation_p.G300S|MECOM_uc010hwn.2_Missense_Mutation_p.G498S	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	310					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						TGGTACAAGCCGGAAGGAAAC	0.473													38	68	---	---	---	---	capture	Missense_Mutation	SNP	168834168	168834168	MECOM	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9335	160
HRG	3273	broad.mit.edu	37	3	186394875	186394875	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186394875C>A	uc003fqq.2	+	7	804	c.781C>A	c.(781-783)CAT>AAT	p.H261N		NM_000412	NP_000403	P04196	HRG_HUMAN	histidine-rich glycoprotein precursor	261					fibrinolysis|platelet activation|platelet degranulation	extracellular region|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding			ovary(1)|central_nervous_system(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		TCATTTGGGACATCCCTTCCA	0.468													30	96	---	---	---	---	capture	Missense_Mutation	SNP	186394875	186394875	HRG	3	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	7279	160
TNK2	10188	broad.mit.edu	37	3	195611779	195611779	+	Silent	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195611779G>C	uc003fvu.1	-	4	903	c.360C>G	c.(358-360)CTC>CTG	p.L120L	TNK2_uc003fvs.1_Silent_p.L152L|TNK2_uc003fvt.1_Silent_p.L183L|TNK2_uc010hzw.1_RNA|TNK2_uc003fvv.1_5'UTR|TNK2_uc010hzx.1_Silent_p.L134L	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1	120					positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	TCTCCCCAATGAGGCAGGTGA	0.672													2	40	---	---	---	---	capture	Silent	SNP	195611779	195611779	TNK2	3	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	16201	160
FGFR3	2261	broad.mit.edu	37	4	1807639	1807639	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1807639G>A	uc003gdr.3	+	13	2064	c.1808G>A	c.(1807-1809)CGG>CAG	p.R603Q	FGFR3_uc003gdu.2_Missense_Mutation_p.R605Q|FGFR3_uc003gds.3_Missense_Mutation_p.R491Q|FGFR3_uc003gdq.3_Missense_Mutation_p.R604Q	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	603	Protein kinase.|Cytoplasmic (Potential).				bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding			urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	CAGGTGGCCCGGGGCATGGAG	0.612		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				26	95	---	---	---	---	capture	Missense_Mutation	SNP	1807639	1807639	FGFR3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5813	160
WHSC2	7469	broad.mit.edu	37	4	1986590	1986590	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1986590G>A	uc003gem.2	-	8	1254	c.1014C>T	c.(1012-1014)TCC>TCT	p.S338S	WHSC2_uc003gek.2_Silent_p.S64S|WHSC2_uc003gel.2_Silent_p.S252S|WHSC2_uc003gen.2_Silent_p.S192S	NM_005663	NP_005654	Q9H3P2	NELFA_HUMAN	Wolf-Hirschhorn syndrome candidate 2 protein	327					multicellular organismal development|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm				skin(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0155)			CGCTGGGCGTGGAGGGAAGGT	0.617													2	16	---	---	---	---	capture	Silent	SNP	1986590	1986590	WHSC2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	17245	160
CC2D2A	57545	broad.mit.edu	37	4	15589458	15589458	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15589458C>T	uc010idv.2	+	33	4330	c.4085C>T	c.(4084-4086)GCA>GTA	p.A1362V	CC2D2A_uc003gnx.2_Missense_Mutation_p.A1254V|CC2D2A_uc003gnz.1_RNA|CC2D2A_uc003goa.1_RNA	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform	1362					cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						GATCTCCTGGCAGGGGATGAA	0.383													3	59	---	---	---	---	capture	Missense_Mutation	SNP	15589458	15589458	CC2D2A	4	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	2702	160
SLIT2	9353	broad.mit.edu	37	4	20598280	20598280	+	Splice_Site	SNP	T	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:20598280T>A	uc003gpr.1	+	32	3765	c.3561_splice	c.e32+2	p.Q1187_splice	SLIT2_uc003gps.1_Splice_Site_p.Q1179_splice	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						ACACTTCAGGTAAGAGATCTC	0.358													5	67	---	---	---	---	capture	Splice_Site	SNP	20598280	20598280	SLIT2	4	T	A	A	A	1	0	0	0	0	0	0	1	0	741	57	5	4	14632	160
EPHA5	2044	broad.mit.edu	37	4	66361196	66361196	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:66361196T>A	uc003hcy.2	-	4	1169	c.976A>T	c.(976-978)AGT>TGT	p.S326C	EPHA5_uc003hcx.2_Missense_Mutation_p.S257C|EPHA5_uc003hcz.2_Missense_Mutation_p.S326C|EPHA5_uc011cah.1_Missense_Mutation_p.S326C|EPHA5_uc011cai.1_Missense_Mutation_p.S326C|EPHA5_uc003hda.2_Missense_Mutation_p.S326C	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	326	Extracellular (Potential).|Cys-rich.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						TGGGTATAACTGTGAGGTGGA	0.463										TSP Lung(17;0.13)			61	167	---	---	---	---	capture	Missense_Mutation	SNP	66361196	66361196	EPHA5	4	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	5125	160
FGB	2244	broad.mit.edu	37	4	155490852	155490852	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155490852C>T	uc003ioa.3	+	7	1184	c.1145C>T	c.(1144-1146)GCC>GTC	p.A382V	FGB_uc003iob.3_Intron|FGB_uc010ipv.2_Missense_Mutation_p.A320V|FGB_uc010ipw.2_Intron|FGB_uc003ioc.3_Missense_Mutation_p.A163V	NM_005141	NP_005132	P02675	FIBB_HUMAN	fibrinogen, beta chain preproprotein	382	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GCCGGTAATGCCCTCATGGAT	0.473													16	49	---	---	---	---	capture	Missense_Mutation	SNP	155490852	155490852	FGB	4	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5777	160
PALLD	23022	broad.mit.edu	37	4	169824985	169824985	+	Silent	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:169824985C>A	uc011cjx.1	+	15	2761	c.2550C>A	c.(2548-2550)ACC>ACA	p.T850T	CBR4_uc011cjy.1_Intron|PALLD_uc003iru.2_Silent_p.T833T|PALLD_uc003irv.2_Silent_p.T451T|PALLD_uc003irw.2_Silent_p.T335T|PALLD_uc003irx.2_Silent_p.T59T	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2	1057	Ig-like C2-type 3.				cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		TCGATGGGACCTGCTCCCTCC	0.438									Pancreatic_Cancer_Familial_Clustering_of				3	82	---	---	---	---	capture	Silent	SNP	169824985	169824985	PALLD	4	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	11311	160
ADAMTS16	170690	broad.mit.edu	37	5	5200249	5200249	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5200249G>T	uc003jdl.2	+	9	1456	c.1318G>T	c.(1318-1320)GGC>TGC	p.G440C	ADAMTS16_uc003jdk.1_Missense_Mutation_p.G440C|ADAMTS16_uc003jdj.1_Missense_Mutation_p.G440C	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	440	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						tcATAGCTTTGGCATGATTCA	0.388													8	11	---	---	---	---	capture	Missense_Mutation	SNP	5200249	5200249	ADAMTS16	5	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	261	160
CDH18	1016	broad.mit.edu	37	5	19503108	19503108	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19503108G>C	uc003jgc.2	-	10	2000	c.1623C>G	c.(1621-1623)GAC>GAG	p.D541E	CDH18_uc003jgd.2_Missense_Mutation_p.D541E|CDH18_uc011cnm.1_Missense_Mutation_p.D541E	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	541	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CACCTTCATTGTCCTTCAGAG	0.353													33	74	---	---	---	---	capture	Missense_Mutation	SNP	19503108	19503108	CDH18	5	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	3074	160
PRDM9	56979	broad.mit.edu	37	5	23522791	23522791	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23522791G>T	uc003jgo.2	+	8	861	c.679G>T	c.(679-681)GAC>TAC	p.D227Y		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	227					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						ATTTGTAAAGGACAGTGCAGT	0.552										HNSCC(3;0.000094)			4	73	---	---	---	---	capture	Missense_Mutation	SNP	23522791	23522791	PRDM9	5	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	12359	160
NIPBL	25836	broad.mit.edu	37	5	37064646	37064646	+	Silent	SNP	A	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:37064646A>G	uc003jkl.3	+	47	8566	c.8067A>G	c.(8065-8067)AAA>AAG	p.K2689K	NIPBL_uc003jkk.3_3'UTR|NIPBL_uc003jkn.2_3'UTR	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	2689					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GAAGGTCAAAACGAAATTCAG	0.378													19	117	---	---	---	---	capture	Silent	SNP	37064646	37064646	NIPBL	5	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	10335	160
C9	735	broad.mit.edu	37	5	39288825	39288825	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:39288825C>A	uc003jlv.3	-	10	1734	c.1645G>T	c.(1645-1647)GGA>TGA	p.G549*		NM_001737	NP_001728	P02748	CO9_HUMAN	complement component 9 precursor	549					complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TTGTCCTCACCTTCAGAAATT	0.333													3	119	---	---	---	---	capture	Nonsense_Mutation	SNP	39288825	39288825	C9	5	C	A	A	A	1	0	0	0	0	0	1	0	0	312	24	5	4	2420	160
C5orf35	133383	broad.mit.edu	37	5	56207282	56207282	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56207282A>G	uc003jqx.2	+	2	758	c.385A>G	c.(385-387)AGC>GGC	p.S129G	C5orf35_uc003jqy.2_Intron	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383	129										ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)		CCAAGCAACTAGCTCATTGAT	0.403													46	152	---	---	---	---	capture	Missense_Mutation	SNP	56207282	56207282	C5orf35	5	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	2272	160
MTX3	345778	broad.mit.edu	37	5	79279592	79279592	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79279592G>A	uc010jag.2	-	9	881	c.854C>T	c.(853-855)CCT>CTT	p.P285L	MTX3_uc010jah.2_3'UTR|MTX3_uc003kge.3_Missense_Mutation_p.P224L	NM_001010891	NP_001010891	Q5HYI7	MTX3_HUMAN	metaxin 3	285					protein targeting to mitochondrion	mitochondrial outer membrane					0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		AGGAAGCTGAGGGCTTTGGCG	0.463													4	154	---	---	---	---	capture	Missense_Mutation	SNP	79279592	79279592	MTX3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9879	160
SLC23A1	9963	broad.mit.edu	37	5	138716553	138716553	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:138716553C>A	uc003leh.2	-	4	428	c.331G>T	c.(331-333)GCC>TCC	p.A111S	SLC23A1_uc003leg.2_Missense_Mutation_p.A111S	NM_005847	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (nucleobase	111	Helical; (Potential).				brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	AATGCAAAGGCACTGGCCTGG	0.602													2	10	---	---	---	---	capture	Missense_Mutation	SNP	138716553	138716553	SLC23A1	5	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	14354	160
KIF4B	285643	broad.mit.edu	37	5	154396908	154396908	+	Silent	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154396908C>A	uc010jih.1	+	1	3649	c.3489C>A	c.(3487-3489)ACC>ACA	p.T1163T		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1163	Interaction with PRC1 (By similarity).|Globular (By similarity).				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCTGTGCCACCCCCAATAGCA	0.532													4	92	---	---	---	---	capture	Silent	SNP	154396908	154396908	KIF4B	5	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	8226	160
CFB	629	broad.mit.edu	37	6	31915244	31915244	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31915244C>T	uc003nyj.3	+	4	882	c.604C>T	c.(604-606)CGG>TGG	p.R202W	CFB_uc011dor.1_Missense_Mutation_p.R704W|CFB_uc003nyi.2_Missense_Mutation_p.R202W	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein	202	Sushi 3.				complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						TGGCTCCCAGCGGCGAACGTG	0.632													20	90	---	---	---	---	capture	Missense_Mutation	SNP	31915244	31915244	CFB	6	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3246	160
TAP2	6891	broad.mit.edu	37	6	32806007	32806007	+	Missense_Mutation	SNP	G	A	A	rs61736918		TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32806007G>A	uc003occ.2	-	1	35	c.4C>T	c.(4-6)CGG>TGG	p.R2W	TAP2_uc011dqf.1_Missense_Mutation_p.R2W|TAP2_uc003ocb.1_Missense_Mutation_p.R2W|TAP2_uc003ocd.2_Missense_Mutation_p.R2W	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	2	Lumenal (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						TCAGGGAGCCGCATGGCTCTG	0.622													3	84	---	---	---	---	capture	Missense_Mutation	SNP	32806007	32806007	TAP2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	15439	160
LEMD2	221496	broad.mit.edu	37	6	33740529	33740529	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33740529C>A	uc011drm.1	-	9	1401	c.1388G>T	c.(1387-1389)CGA>CTA	p.R463L	LEMD2_uc010jvg.2_Missense_Mutation_p.R172L|LEMD2_uc011drl.1_Missense_Mutation_p.R161L|LEMD2_uc003ofe.2_Missense_Mutation_p.R161L	NM_181336	NP_851853	Q8NC56	LEMD2_HUMAN	LEM domain containing 2 isoform 1	463						integral to nuclear inner membrane				central_nervous_system(1)	1						CTCCACAGCTCGGTCCCAGAC	0.627													3	16	---	---	---	---	capture	Missense_Mutation	SNP	33740529	33740529	LEMD2	6	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	8640	160
PGK2	5232	broad.mit.edu	37	6	49754282	49754282	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49754282G>T	uc003ozu.2	-	1	726	c.619C>A	c.(619-621)CCC>ACC	p.P207T		NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	207					glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					GCCAGAAAGGGTCTCACTGGG	0.428													59	204	---	---	---	---	capture	Missense_Mutation	SNP	49754282	49754282	PGK2	6	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	11694	160
GOPC	57120	broad.mit.edu	37	6	117892118	117892118	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117892118C>A	uc003pxu.2	-	6	1047	c.817G>T	c.(817-819)GAT>TAT	p.D273Y	GOPC_uc003pxq.1_Missense_Mutation_p.D46Y|GOPC_uc003pxv.2_Missense_Mutation_p.D265Y	NM_020399	NP_065132	Q9HD26	GOPC_HUMAN	golgi associated PDZ and coiled-coil motif	273					apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		GAATCTTGATCCTTATTGGGA	0.328			O	ROS1	glioblastoma								4	104	---	---	---	---	capture	Missense_Mutation	SNP	117892118	117892118	GOPC	6	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	6507	160
UTRN	7402	broad.mit.edu	37	6	145103130	145103130	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:145103130T>C	uc003qkt.2	+	60	8797	c.8705T>C	c.(8704-8706)CTC>CCC	p.L2902P		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	2902	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GACCAGCTCCTCAGTGTTCCA	0.403													3	81	---	---	---	---	capture	Missense_Mutation	SNP	145103130	145103130	UTRN	6	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	16985	160
ESR1	2099	broad.mit.edu	37	6	152163775	152163775	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152163775G>T	uc003qom.3	+	4	866	c.496G>T	c.(496-498)GCC>TCC	p.A166S	ESR1_uc010kin.2_Missense_Mutation_p.A166S|ESR1_uc010kio.2_Missense_Mutation_p.A166S|ESR1_uc010kip.2_Missense_Mutation_p.A166S|ESR1_uc003qon.3_Missense_Mutation_p.A166S|ESR1_uc003qoo.3_Missense_Mutation_p.A166S|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_RNA|ESR1_uc011eeu.1_RNA|ESR1_uc011eev.1_5'UTR|ESR1_uc011eew.1_5'UTR	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	166	Modulating; mediates interaction with MACROD1.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	AGAAAGATTGGCCAGTACCAA	0.453													10	32	---	---	---	---	capture	Missense_Mutation	SNP	152163775	152163775	ESR1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	5211	160
TIAM2	26230	broad.mit.edu	37	6	155451173	155451173	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155451173G>T	uc003qqb.2	+	6	2089	c.816G>T	c.(814-816)ATG>ATT	p.M272I	TIAM2_uc003qqe.2_Missense_Mutation_p.M272I	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	272					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CCCCCGGCATGCCTGACCCCA	0.597													4	88	---	---	---	---	capture	Missense_Mutation	SNP	155451173	155451173	TIAM2	6	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	15776	160
IGF2R	3482	broad.mit.edu	37	6	160445736	160445736	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160445736G>T	uc003qta.2	+	5	794	c.646G>T	c.(646-648)GAC>TAC	p.D216Y		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	216	2.|Lumenal (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		TAGAGACATAGGTATGAATCT	0.438													4	126	---	---	---	---	capture	Missense_Mutation	SNP	160445736	160445736	IGF2R	6	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	7501	160
KIAA0415	9907	broad.mit.edu	37	7	4830771	4830771	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4830771A>G	uc003sne.2	+	17	2262	c.2179A>G	c.(2179-2181)AGG>GGG	p.R727G	KIAA0415_uc010ksp.2_RNA|KIAA0415_uc003snf.2_Missense_Mutation_p.R204G	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	727					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		GTCAAAGATGAGGACCCTGGC	0.637													2	24	---	---	---	---	capture	Missense_Mutation	SNP	4830771	4830771	KIAA0415	7	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	8097	160
AMPH	273	broad.mit.edu	37	7	38516553	38516553	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38516553C>T	uc003tgu.2	-	6	482	c.413G>A	c.(412-414)CGC>CAC	p.R138H	AMPH_uc003tgv.2_Missense_Mutation_p.R138H	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	138	BAR.				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						CTTCCTGCTGCGCTTGGCGAT	0.502													26	105	---	---	---	---	capture	Missense_Mutation	SNP	38516553	38516553	AMPH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	588	160
C7orf25	79020	broad.mit.edu	37	7	42949845	42949845	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:42949845G>C	uc003thw.2	-	2	1119	c.655C>G	c.(655-657)CTT>GTT	p.L219V	C7orf25_uc010kxq.2_Missense_Mutation_p.L219V|C7orf25_uc003thx.3_Missense_Mutation_p.L277V|C7orf25_uc010kxr.2_Missense_Mutation_p.L277V	NM_024054	NP_076959	Q9BPX7	CG025_HUMAN	hypothetical protein LOC79020 b	219										skin(1)	1						ACCTGCAAAAGTTCAGGGCCC	0.438													9	95	---	---	---	---	capture	Missense_Mutation	SNP	42949845	42949845	C7orf25	7	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	2357	160
ADCY1	107	broad.mit.edu	37	7	45632382	45632382	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45632382G>A	uc003tne.3	+	2	682	c.664G>A	c.(664-666)GTC>ATC	p.V222I	ADCY1_uc003tnd.2_5'UTR	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	222	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CTTGCTCTTCGTCGGTGTGAA	0.592													54	199	---	---	---	---	capture	Missense_Mutation	SNP	45632382	45632382	ADCY1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	292	160
TNS3	64759	broad.mit.edu	37	7	47408183	47408183	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47408183G>A	uc003tnv.2	-	17	2427	c.2060C>T	c.(2059-2061)TCC>TTC	p.S687F	TNS3_uc003tnw.2_Missense_Mutation_p.S687F	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	687						focal adhesion	protein binding			ovary(4)	4						CGAGCCTGGGGAGGGGCCTGT	0.622													124	451	---	---	---	---	capture	Missense_Mutation	SNP	47408183	47408183	TNS3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	16227	160
POM121L12	285877	broad.mit.edu	37	7	53103674	53103674	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103674G>C	uc003tpz.2	+	1	326	c.310G>C	c.(310-312)GGG>CGG	p.G104R		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	104											0						TGCCCTTCCCGGGGAGACCGC	0.721													8	27	---	---	---	---	capture	Missense_Mutation	SNP	53103674	53103674	POM121L12	7	G	C	C	C	1	0	0	0	0	1	0	0	0	507	39	4	4	12143	160
EGFR	1956	broad.mit.edu	37	7	55249121	55249121	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55249121G>C	uc003tqk.2	+	20	2665	c.2419G>C	c.(2419-2421)GAC>CAC	p.D807H	EGFR_uc010kzg.1_Missense_Mutation_p.D762H|EGFR_uc011kco.1_Missense_Mutation_p.D754H|uc003tqo.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	807	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.D807N(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GGAACACAAAGACAATATTGG	0.582		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			13	598	---	---	---	---	capture	Missense_Mutation	SNP	55249121	55249121	EGFR	7	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	4922	160
LAT2	7462	broad.mit.edu	37	7	73630358	73630358	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73630358T>G	uc003uag.2	+	3	603	c.53T>G	c.(52-54)TTG>TGG	p.L18W	RFC2_uc011kfa.1_Intron|LAT2_uc003uah.2_Missense_Mutation_p.L18W|LAT2_uc003uai.2_Missense_Mutation_p.L18W|LAT2_uc010lbo.2_RNA	NM_032464	NP_115853	Q9GZY6	NTAL_HUMAN	linker for activation of T cells family member	18	Helical; Signal-anchor for type III membrane protein; (Potential).				B cell activation|B cell receptor signaling pathway|calcium-mediated signaling|mast cell degranulation	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding				0						CTGGTGCTGTTGGGGGTGGCA	0.637													7	93	---	---	---	---	capture	Missense_Mutation	SNP	73630358	73630358	LAT2	7	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	8565	160
RSBN1L	222194	broad.mit.edu	37	7	77402516	77402516	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77402516C>T	uc010ldt.1	+	6	1722	c.1678C>T	c.(1678-1680)CGT>TGT	p.R560C	RSBN1L_uc003ugm.2_Missense_Mutation_p.R342C	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	560						nucleus				ovary(1)	1						AAGTGAGCCCCGTGAGATGCT	0.383													33	147	---	---	---	---	capture	Missense_Mutation	SNP	77402516	77402516	RSBN1L	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13589	160
MUC17	140453	broad.mit.edu	37	7	100674925	100674925	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100674925C>T	uc003uxp.1	+	3	281	c.228C>T	c.(226-228)GTC>GTT	p.V76V	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	76	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CTACAAATGTCGTGGAGCCAA	0.453													16	77	---	---	---	---	capture	Silent	SNP	100674925	100674925	MUC17	7	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	9884	160
PPP1R3A	5506	broad.mit.edu	37	7	113558410	113558410	+	Silent	SNP	A	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113558410A>C	uc010ljy.1	-	1	673	c.642T>G	c.(640-642)TCT>TCG	p.S214S		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	214	CBM21.				glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						ATGTACCAACAGAAGTTTCAT	0.353													37	153	---	---	---	---	capture	Silent	SNP	113558410	113558410	PPP1R3A	7	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	12272	160
CALD1	800	broad.mit.edu	37	7	134552504	134552504	+	Missense_Mutation	SNP	G	A	A	rs142583902		TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134552504G>A	uc003vrz.2	+	3	479	c.20G>A	c.(19-21)CGC>CAC	p.R7H	CALD1_uc003vry.2_Missense_Mutation_p.R7H|CALD1_uc003vsa.2_Missense_Mutation_p.R7H|CALD1_uc003vsb.2_Missense_Mutation_p.R7H|CALD1_uc010lmm.2_Missense_Mutation_p.R7H|CALD1_uc011kpt.1_5'UTR	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1	7					cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						TTTGAGCGTCGCAGAGAACTT	0.433													4	19	---	---	---	---	capture	Missense_Mutation	SNP	134552504	134552504	CALD1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2557	160
NUP205	23165	broad.mit.edu	37	7	135311087	135311087	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:135311087C>T	uc003vsw.2	+	33	4802	c.4771C>T	c.(4771-4773)CGC>TGC	p.R1591C	NUP205_uc003vsx.2_RNA	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1591					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						CTATGACATGCGCCCAGAAAC	0.423													5	146	---	---	---	---	capture	Missense_Mutation	SNP	135311087	135311087	NUP205	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10666	160
FAM115A	9747	broad.mit.edu	37	7	143573699	143573699	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143573699C>A	uc003wdo.1	-	2	136	c.3G>T	c.(1-3)ATG>ATT	p.M1I	FAM115A_uc011ktu.1_Intron|FAM115A_uc003wdp.1_Missense_Mutation_p.M1I	NM_014719	NP_055534	Q9Y4C2	F115A_HUMAN	hypothetical protein LOC9747	1											0	Melanoma(164;0.0903)					AGGGAGTCGCCATGGCTCTAT	0.473													4	111	---	---	---	---	capture	Missense_Mutation	SNP	143573699	143573699	FAM115A	7	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	5359	160
ANK1	286	broad.mit.edu	37	8	41530099	41530099	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41530099G>A	uc003xok.2	-	38	4953	c.4869C>T	c.(4867-4869)GAC>GAT	p.D1623D	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Intron|ANK1_uc003xoi.2_Silent_p.D1623D|ANK1_uc003xoj.2_Silent_p.D1623D|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Silent_p.D1664D	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1623	55 kDa regulatory domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCACTGTGTCGTCCTCCACAA	0.562													36	256	---	---	---	---	capture	Silent	SNP	41530099	41530099	ANK1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	617	160
TRHR	7201	broad.mit.edu	37	8	110131345	110131345	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110131345G>A	uc003ymz.3	+	2	874	c.858G>A	c.(856-858)GTG>GTA	p.V286V		NM_003301	NP_003292	P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	286	Helical; Name=6; (Potential).					integral to plasma membrane	thyrotropin-releasing hormone receptor activity			skin(2)|lung(1)	3			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			GGACTCTAGTGGTTGTCAACT	0.418													26	583	---	---	---	---	capture	Silent	SNP	110131345	110131345	TRHR	8	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	16363	160
TRPS1	7227	broad.mit.edu	37	8	116632180	116632180	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:116632180C>T	uc003ynz.2	-	2	565	c.106G>A	c.(106-108)GAA>AAA	p.E36K	TRPS1_uc011lhy.1_Missense_Mutation_p.E40K|TRPS1_uc003yny.2_Missense_Mutation_p.E49K|TRPS1_uc010mcy.2_Missense_Mutation_p.E36K	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	36					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GCAGAAAATTCTTTGTTCTTT	0.448									Langer-Giedion_syndrome				5	74	---	---	---	---	capture	Missense_Mutation	SNP	116632180	116632180	TRPS1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	16476	160
COMMD5	28991	broad.mit.edu	37	8	146076337	146076337	+	Silent	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:146076337C>T	uc003zem.2	-	2	518	c.387G>A	c.(385-387)GTG>GTA	p.V129V	COMMD5_uc003zel.1_RNA|COMMD5_uc003zen.2_Silent_p.V129V|COMMD5_uc003zeo.3_Silent_p.V129V|COMMD5_uc010mgf.2_Silent_p.V129V	NM_001081004	NP_001074473	Q9GZQ3	COMD5_HUMAN	COMM domain containing 5	129						nucleus	protein binding			ovary(1)	1	all_cancers(97;1.14e-11)|all_epithelial(106;7.74e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			TCCCAAATACCACGCTGGCCA	0.652													2	12	---	---	---	---	capture	Silent	SNP	146076337	146076337	COMMD5	8	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3684	160
PIGO	84720	broad.mit.edu	37	9	35095288	35095288	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35095288C>A	uc003zwd.2	-	2	671	c.275G>T	c.(274-276)AGA>ATA	p.R92I	PIGO_uc003zwc.1_Missense_Mutation_p.R92I|PIGO_uc003zwe.2_Missense_Mutation_p.R92I|PIGO_uc003zwf.2_Missense_Mutation_p.R92I|PIGO_uc003zwg.1_5'UTR	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	92					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity			large_intestine(1)|ovary(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGGAGGCTCTCTAGGCACGTG	0.582													5	251	---	---	---	---	capture	Missense_Mutation	SNP	35095288	35095288	PIGO	9	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	11797	160
OR2K2	26248	broad.mit.edu	37	9	114090010	114090010	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114090010T>C	uc011lwp.1	-	1	704	c.704A>G	c.(703-705)AAG>AGG	p.K235R		NM_205859	NP_995581	Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K,	264	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AGAAAAAGCCTTGTTTCTTCC	0.423													25	96	---	---	---	---	capture	Missense_Mutation	SNP	114090010	114090010	OR2K2	9	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	10909	160
STXBP1	6812	broad.mit.edu	37	9	130422360	130422360	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130422360C>T	uc004brl.2	+	5	495	c.298C>T	c.(298-300)CGG>TGG	p.R100W	STXBP1_uc004brk.2_Missense_Mutation_p.R100W	NM_001032221	NP_001027392	P61764	STXB1_HUMAN	syntaxin binding protein 1 isoform b	100					axon target recognition|energy reserve metabolic process|glutamate secretion|negative regulation of synaptic transmission, GABAergic|neurotransmitter secretion|platelet aggregation|platelet degranulation|protein transport|regulation of insulin secretion|regulation of synaptic vesicle priming|synaptic vesicle maturation|vesicle docking involved in exocytosis	cytosol|mitochondrion|plasma membrane|platelet alpha granule|protein complex	identical protein binding|syntaxin-1 binding|syntaxin-2 binding			skin(1)	1						TGCTAAATACCGGGCTGCACA	0.527													3	86	---	---	---	---	capture	Missense_Mutation	SNP	130422360	130422360	STXBP1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	15242	160
NLGN4X	57502	broad.mit.edu	37	X	5811228	5811228	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:5811228G>A	uc010ndh.2	-	6	2582	c.2081C>T	c.(2080-2082)GCG>GTG	p.A694V	NLGN4X_uc004crp.2_Missense_Mutation_p.A714V|NLGN4X_uc004crq.2_Missense_Mutation_p.A694V|NLGN4X_uc010ndi.2_Missense_Mutation_p.A731V|NLGN4X_uc004crr.2_Missense_Mutation_p.A694V|NLGN4X_uc010ndj.2_Missense_Mutation_p.A694V	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	694	Helical; (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						GTACAGCGCCGCAAAAGCTAA	0.502													3	84	---	---	---	---	capture	Missense_Mutation	SNP	5811228	5811228	NLGN4X	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10371	160
VCX3B	425054	broad.mit.edu	37	X	8433516	8433516	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:8433516G>T	uc010ndo.2	+	2	332	c.25G>T	c.(25-27)GGA>TGA	p.G9*	VCX3B_uc011mht.1_Nonsense_Mutation_p.G9*|VCX3B_uc004csd.1_Nonsense_Mutation_p.G9*	NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	9						nucleolus					0						GAGAGCCTCGGGACCTCCGGC	0.607													34	62	---	---	---	---	capture	Nonsense_Mutation	SNP	8433516	8433516	VCX3B	23	G	T	T	T	1	0	0	0	0	0	1	0	0	559	43	5	4	17027	160
DMD	1756	broad.mit.edu	37	X	32503062	32503062	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32503062T>C	uc004dda.1	-	21	3021	c.2777A>G	c.(2776-2778)CAG>CGG	p.Q926R	DMD_uc004dcz.2_Missense_Mutation_p.Q803R|DMD_uc004dcy.1_Missense_Mutation_p.Q922R|DMD_uc004ddb.1_Missense_Mutation_p.Q918R|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	926	Spectrin 5.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTCTCTGGCCTGCACATCAGA	0.408													2	28	---	---	---	---	capture	Missense_Mutation	SNP	32503062	32503062	DMD	23	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	4538	160
CXorf22	170063	broad.mit.edu	37	X	36007487	36007487	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:36007487G>A	uc004ddj.2	+	16	2824	c.2765G>A	c.(2764-2766)GGC>GAC	p.G922D	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	922										large_intestine(1)|lung(1)|ovary(1)	3						TGGCAGCAGGGCTTCAGTTCT	0.368													20	12	---	---	---	---	capture	Missense_Mutation	SNP	36007487	36007487	CXorf22	23	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4062	160
ZC4H2	55906	broad.mit.edu	37	X	64140054	64140054	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64140054T>C	uc004dvu.2	-	3	393	c.305A>G	c.(304-306)AAG>AGG	p.K102R	ZC4H2_uc004dvv.2_Missense_Mutation_p.K79R|ZC4H2_uc011mov.1_Missense_Mutation_p.K79R|ZC4H2_uc011mow.1_Missense_Mutation_p.K102R|ZC4H2_uc004dvw.1_Missense_Mutation_p.K102R	NM_018684	NP_061154	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	102	Potential.						metal ion binding|protein binding			ovary(1)	1						TTTCAGTGGCTTATACTCATC	0.473													3	106	---	---	---	---	capture	Missense_Mutation	SNP	64140054	64140054	ZC4H2	23	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	17458	160
EDA	1896	broad.mit.edu	37	X	69250324	69250324	+	Silent	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69250324T>C	uc004dxs.2	+	6	989	c.747T>C	c.(745-747)GCT>GCC	p.A249A	EDA_uc004dxr.2_Silent_p.A249A|EDA_uc011mpj.1_Silent_p.A249A	NM_001399	NP_001390	Q92838	EDA_HUMAN	ectodysplasin A isoform EDA-A1	249	Extracellular (Potential).				cell differentiation|ectoderm development|immune response|positive regulation of NF-kappaB transcription factor activity|signal transduction	collagen|cytoskeleton|membrane fraction	tumor necrosis factor receptor binding			ovary(2)|large_intestine(1)	3						GCCAGCCAGCTGTGGTGCATC	0.502											OREG0019846	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	15	---	---	---	---	capture	Silent	SNP	69250324	69250324	EDA	23	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	4858	160
CDX4	1046	broad.mit.edu	37	X	72674301	72674301	+	Silent	SNP	G	A	A			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:72674301G>A	uc011mqk.1	+	3	735	c.735G>A	c.(733-735)TCG>TCA	p.S245S		NM_005193	NP_005184	O14627	CDX4_HUMAN	caudal type homeobox 4	245						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(35;0.156)					GTGGAGGCTCGGTGCAAAGTG	0.448													12	16	---	---	---	---	capture	Silent	SNP	72674301	72674301	CDX4	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3153	160
RLIM	51132	broad.mit.edu	37	X	73811531	73811531	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:73811531T>C	uc004ebu.2	-	5	1909	c.1619A>G	c.(1618-1620)GAT>GGT	p.D540G	RLIM_uc004ebw.2_Missense_Mutation_p.D540G	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	540					random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GTCATCATCATCCTCATTTAA	0.458													2	33	---	---	---	---	capture	Missense_Mutation	SNP	73811531	73811531	RLIM	23	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	13282	160
CYLC1	1538	broad.mit.edu	37	X	83128534	83128534	+	Nonsense_Mutation	SNP	C	G	G			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:83128534C>G	uc004eei.1	+	4	839	c.818C>G	c.(817-819)TCA>TGA	p.S273*	CYLC1_uc004eeh.1_Nonsense_Mutation_p.S272*	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	273					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						CAGAATAATTCAAAGAATTAT	0.318													3	31	---	---	---	---	capture	Nonsense_Mutation	SNP	83128534	83128534	CYLC1	23	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	4101	160
RPS6KA6	27330	broad.mit.edu	37	X	83361995	83361995	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:83361995T>C	uc004eej.1	-	14	1242	c.1165A>G	c.(1165-1167)AGC>GGC	p.S389G	RPS6KA6_uc011mqt.1_Missense_Mutation_p.S389G|RPS6KA6_uc011mqu.1_Missense_Mutation_p.S286G	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	389	AGC-kinase C-terminal.				axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						GCAACAAAGCTGAATCCTTTG	0.343													2	44	---	---	---	---	capture	Missense_Mutation	SNP	83361995	83361995	RPS6KA6	23	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	13547	160
SALL3	27164	broad.mit.edu	37	18	76757007	76757007	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:76757007delC	uc002lmt.2	+	3	3588	c.3588delC	c.(3586-3588)TTCfs	p.F1196fs	SALL3_uc010dra.2_Frame_Shift_Del_p.F731fs	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	1196					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CTGAAATGTTCCAGAAGGACC	0.577													19	75	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	76757007	76757007	SALL3	18	C	-	-	-	1	0	1	0	1	0	0	0	0	389	30	5	5	13704	160
TTN	7273	broad.mit.edu	37	2	179634616	179634616	+	Frame_Shift_Del	DEL	T	-	-	rs78680811		TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179634616delT	uc010zfg.1	-	37	8916	c.8692delA	c.(8692-8694)ACTfs	p.T2898fs	TTN_uc010zfh.1_Frame_Shift_Del_p.T2852fs|TTN_uc010zfi.1_Frame_Shift_Del_p.T2852fs|TTN_uc010zfj.1_Frame_Shift_Del_p.T2852fs|TTN_uc002unb.2_Frame_Shift_Del_p.T2898fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2898							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAGAGGCAGTTTTGGTCTCA	0.368													64	144	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	179634616	179634616	TTN	2	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	16617	160
MYEOV2	150678	broad.mit.edu	37	2	241066064	241066064	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241066064delT	uc002vyu.1	-	5	675	c.675delA	c.(673-675)AAAfs	p.K225fs		NM_138336	NP_612209	Q8WXC6	MYOV2_HUMAN	hypothetical protein LOC150678 isoform 1	Error:Variant_position_missing_in_Q8WXC6_after_alignment											0		all_epithelial(40;1.56e-11)|Breast(86;0.0002)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.81e-30)|all cancers(36;1.1e-27)|OV - Ovarian serous cystadenocarcinoma(60;2.74e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.54e-06)|Lung(119;0.00361)|LUSC - Lung squamous cell carcinoma(224;0.0153)|Colorectal(34;0.0202)|COAD - Colon adenocarcinoma(134;0.143)		TCTTAAAACATTTACCCCTCC	0.488													12	145	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	241066064	241066064	MYEOV2	2	T	-	-	-	1	0	1	0	1	0	0	0	0	673	52	5	5	9936	160
PIK3CA	5290	broad.mit.edu	37	3	178928108	178928127	+	Splice_Site	DEL	TGGATCAAATCCAAATAAAG	-	-			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178928108_178928127delTGGATCAAATCCAAATAAAG	uc003fjk.2	+	8	1561	c.1404_splice	c.e8+1	p.K468_splice		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TTGGTGTTACTGGATCAAATCCAAATAAAGTAAGGTTTTT	0.332		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			13	172	---	---	---	---	capture_indel	Splice_Site	DEL	178928108	178928127	PIK3CA	3	TGGATCAAATCCAAATAAAG	-	-	-	1	0	1	0	1	0	0	1	0	704	55	5	5	11816	160
C6orf146	222826	broad.mit.edu	37	6	4068936	4068938	+	In_Frame_Del	DEL	TTG	-	-			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:4068936_4068938delTTG	uc003mvx.2	-	7	1859_1861	c.1519_1521delCAA	c.(1519-1521)CAAdel	p.Q507del	C6orf146_uc010jnq.1_Intron|C6orf146_uc003mvy.2_In_Frame_Del_p.Q444del	NM_173563	NP_775834	Q8IXS0	CF146_HUMAN	hypothetical protein LOC222826	507										ovary(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				AGAGTTATTTTTGTTCAATGGGT	0.360													46	107	---	---	---	---	capture_indel	In_Frame_Del	DEL	4068936	4068938	C6orf146	6	TTG	-	-	-	1	0	1	0	1	0	0	0	0	829	64	5	5	2312	160
STARD3NL	83930	broad.mit.edu	37	7	38254036	38254039	+	Splice_Site	DEL	GTAA	-	-			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38254036_38254039delGTAA	uc003tfr.2	+	3	451	c.303_splice	c.e3+1	p.F101_splice	STARD3NL_uc003tfs.2_Splice_Site_p.F101_splice|STARD3NL_uc003tft.2_Splice_Site_p.F101_splice	NM_032016	NP_114405	O95772	MENTO_HUMAN	MLN64 N-terminal homolog							integral to membrane|late endosome membrane				ovary(1)	1						TGATATATTTGTAAGTATTTTTTA	0.338													16	80	---	---	---	---	capture_indel	Splice_Site	DEL	38254036	38254039	STARD3NL	7	GTAA	-	-	-	1	0	1	0	1	0	0	1	0	624	48	5	5	15148	160
AKAP9	10142	broad.mit.edu	37	7	91668077	91668078	+	Frame_Shift_Ins	INS	-	GA	GA			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:91668077_91668078insGA	uc003ulg.2	+	17	4908_4909	c.4683_4684insGA	c.(4681-4686)GTTAGAfs	p.V1561fs	AKAP9_uc003ule.2_Frame_Shift_Ins_p.V1573fs|AKAP9_uc003ulf.2_Frame_Shift_Ins_p.V1561fs|AKAP9_uc003uli.2_Frame_Shift_Ins_p.V1186fs	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	1573_1574					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CATTTATAGTTAGACAGTCTGT	0.287			T	BRAF	papillary thyroid								23	81	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	91668077	91668078	AKAP9	7	-	GA	GA	GA	1	0	1	1	0	0	0	0	0	782	61	5	5	459	160
ZAN	7455	broad.mit.edu	37	7	100350019	100350019	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100350019delA	uc003uwj.2	+	14	2456	c.2291delA	c.(2290-2292)GAAfs	p.E764fs	ZAN_uc003uwk.2_Frame_Shift_Del_p.E764fs|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	764	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCCCCACAGAAAAACCCACC	0.527													23	93	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	100350019	100350019	ZAN	7	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	17394	160
TRPS1	7227	broad.mit.edu	37	8	116599737	116599737	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1790-01	TCGA-19-1790-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:116599737delC	uc003ynz.2	-	4	2611	c.2152delG	c.(2152-2154)GAAfs	p.E718fs	TRPS1_uc011lhy.1_Frame_Shift_Del_p.E722fs|TRPS1_uc003yny.2_Frame_Shift_Del_p.E731fs|TRPS1_uc010mcy.2_Frame_Shift_Del_p.E718fs	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	718	Mediates interaction with GLI3.				negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATGTCCTGTTCCTGGCAGTGA	0.507									Langer-Giedion_syndrome				77	228	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	116599737	116599737	TRPS1	8	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	16476	160
