Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PTCHD2	57540	broad.mit.edu	37	1	11562051	11562051	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11562051G>A	uc001ash.3	+	2	1140	c.1002G>A	c.(1000-1002)TCG>TCA	p.S334S	PTCHD2_uc001asi.1_Silent_p.S334S	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	334	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CCTACTGCTCGCCCCCCAGCT	0.627													29	21	---	---	---	---	capture	Silent	SNP	11562051	11562051	PTCHD2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12628	162
LRRC8B	23507	broad.mit.edu	37	1	90048973	90048973	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:90048973A>G	uc001dni.2	+	7	1271	c.764A>G	c.(763-765)TAT>TGT	p.Y255C	LRRC8B_uc001dnh.2_Missense_Mutation_p.Y255C|LRRC8B_uc001dnj.2_Missense_Mutation_p.Y255C	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	255						integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		GACATCATTTATAGAGTATAT	0.383													47	77	---	---	---	---	capture	Missense_Mutation	SNP	90048973	90048973	LRRC8B	1	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	8937	162
GPR61	83873	broad.mit.edu	37	1	110086040	110086040	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110086040G>A	uc001dxy.2	+	2	1079	c.396G>A	c.(394-396)TCG>TCA	p.S132S		NM_031936	NP_114142	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	132	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(2)	2		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		CCATCCTCTCGGTGTCAGCCA	0.607													51	103	---	---	---	---	capture	Silent	SNP	110086040	110086040	GPR61	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6635	162
TTF2	8458	broad.mit.edu	37	1	117618058	117618058	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117618058G>A	uc001egy.2	+	5	872	c.852G>A	c.(850-852)GAG>GAA	p.E284E	TTF2_uc001egx.1_Silent_p.E284E	NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	284					mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TCAACAAGGAGTACACGAACT	0.522													42	115	---	---	---	---	capture	Silent	SNP	117618058	117618058	TTF2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	16601	162
FLG	2312	broad.mit.edu	37	1	152283519	152283519	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152283519G>A	uc001ezu.1	-	3	3879	c.3843C>T	c.(3841-3843)GAC>GAT	p.D1281D	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1281	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTCGGAGTCGTCTGAGTGTC	0.383									Ichthyosis				126	232	---	---	---	---	capture	Silent	SNP	152283519	152283519	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5867	162
HMCN1	83872	broad.mit.edu	37	1	186050515	186050515	+	Nonsense_Mutation	SNP	C	T	T	rs142475663		TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186050515C>T	uc001grq.1	+	56	9005	c.8776C>T	c.(8776-8778)CGA>TGA	p.R2926*		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2926	Ig-like C2-type 27.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ATCTAATGGACGAATTCTGCA	0.338													42	82	---	---	---	---	capture	Nonsense_Mutation	SNP	186050515	186050515	HMCN1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	7145	162
HMCN1	83872	broad.mit.edu	37	1	186083185	186083185	+	Missense_Mutation	SNP	G	A	A	rs138190200	byFrequency	TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186083185G>A	uc001grq.1	+	73	11435	c.11206G>A	c.(11206-11208)GCT>ACT	p.A3736T		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3736	Ig-like C2-type 36.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GGAATGCATCGCTGAAGGTGT	0.408													46	131	---	---	---	---	capture	Missense_Mutation	SNP	186083185	186083185	HMCN1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7145	162
NUAK2	81788	broad.mit.edu	37	1	205280831	205280831	+	Splice_Site	SNP	A	G	G			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205280831A>G	uc001hce.2	-	2	479	c.352_splice	c.e2+1	p.V118_splice	NUAK2_uc009xbj.1_5'Flank	NM_030952	NP_112214	Q9H093	NUAK2_HUMAN	NUAK family, SNF1-like kinase, 2						actin cytoskeleton organization|apoptosis|cellular response to glucose starvation|negative regulation of apoptosis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|stomach(1)|breast(1)	5	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TGCCCACTGTACCTTCATGGA	0.413													4	79	---	---	---	---	capture	Splice_Site	SNP	205280831	205280831	NUAK2	1	A	G	G	G	1	0	0	0	0	0	0	1	0	182	14	5	3	10620	162
TRAF3IP3	80342	broad.mit.edu	37	1	209954760	209954760	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209954760A>T	uc001hho.2	+	16	1810	c.1520A>T	c.(1519-1521)CAC>CTC	p.H507L	TRAF3IP3_uc001hhn.2_Missense_Mutation_p.H487L|TRAF3IP3_uc009xcr.2_Missense_Mutation_p.H507L	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator	507	Cytoplasmic (Potential).					integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		AAGCTGCAGCACTGTCGAGAA	0.512													16	86	---	---	---	---	capture	Missense_Mutation	SNP	209954760	209954760	TRAF3IP3	1	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	16325	162
AS3MT	57412	broad.mit.edu	37	10	104638210	104638210	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104638210C>T	uc001kwk.2	+	8	825	c.685C>T	c.(685-687)CGT>TGT	p.R229C	AS3MT_uc001kwj.2_Missense_Mutation_p.R231C|AS3MT_uc009xxh.2_Missense_Mutation_p.R229C	NM_020682	NP_065733	Q9HBK9	AS3MT_HUMAN	arsenic (+3 oxidation state) methyltransferase	229					arsonoacetate metabolic process|toxin metabolic process	cytosol	arsenite methyltransferase activity|methylarsonite methyltransferase activity				0		Colorectal(252;0.122)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;5.87e-09)|all cancers(201;1.58e-07)|BRCA - Breast invasive adenocarcinoma(275;0.223)		CTGCCCTCCACGTTTGGTCAC	0.408													86	82	---	---	---	---	capture	Missense_Mutation	SNP	104638210	104638210	AS3MT	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	997	162
OR5D18	219438	broad.mit.edu	37	11	55587445	55587445	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55587445T>A	uc010rin.1	+	1	340	c.340T>A	c.(340-342)TTT>ATT	p.F114I		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	114	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				CACTGAATCCTTTTTATTAGC	0.433													102	231	---	---	---	---	capture	Missense_Mutation	SNP	55587445	55587445	OR5D18	11	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	11061	162
ACRV1	56	broad.mit.edu	37	11	125542539	125542539	+	Silent	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125542539C>T	uc001qcs.2	-	4	1014	c.747G>A	c.(745-747)ACG>ACA	p.T249T	CHEK1_uc001qcf.3_Intron|ACRV1_uc001qck.2_Silent_p.T160T|ACRV1_uc001qcl.2_Silent_p.T179T|ACRV1_uc001qcm.2_Silent_p.T105T|ACRV1_uc001qcn.2_Silent_p.T194T|ACRV1_uc001qco.2_Silent_p.T154T|ACRV1_uc001qcp.2_Silent_p.T65T|ACRV1_uc001qcq.2_Silent_p.T139T|ACRV1_uc001qcr.2_Silent_p.T230T	NM_001612	NP_001603	P26436	ASPX_HUMAN	acrosomal vesicle protein 1 isoform a precursor	249					multicellular organismal development	acrosomal vesicle					0	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)		TTTGCATCCTCGTTCCATGGG	0.448													53	109	---	---	---	---	capture	Silent	SNP	125542539	125542539	ACRV1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	172	162
ADAMTS20	80070	broad.mit.edu	37	12	43833726	43833726	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:43833726G>A	uc010skx.1	-	17	2437	c.2437C>T	c.(2437-2439)CGA>TGA	p.R813*	ADAMTS20_uc001rno.1_5'Flank|ADAMTS20_uc001rnp.1_5'Flank	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	813	Spacer.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TTCTCTTGTCGATTAGTACTA	0.299													7	18	---	---	---	---	capture	Nonsense_Mutation	SNP	43833726	43833726	ADAMTS20	12	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	266	162
H1FNT	341567	broad.mit.edu	37	12	48723149	48723149	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48723149G>A	uc001rrm.2	+	1	387	c.75G>A	c.(73-75)GCG>GCA	p.A25A		NM_181788	NP_861453	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	25					chromosome condensation|multicellular organismal development|sperm chromatin condensation|spermatid nucleus elongation	nuclear chromatin	ATP binding|DNA binding			pancreas(1)	1						TGGCTGAGGCGCCTGGGCCCA	0.657													4	7	---	---	---	---	capture	Silent	SNP	48723149	48723149	H1FNT	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6850	162
B4GALNT1	2583	broad.mit.edu	37	12	58022670	58022670	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58022670G>A	uc001spg.1	-	8	1260	c.828C>T	c.(826-828)AGC>AGT	p.S276S	B4GALNT1_uc010sru.1_Silent_p.S221S|B4GALNT1_uc010srv.1_Silent_p.S243S	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	276	Lumenal (Potential).				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TGACTAGAGCGCTGATGTTGT	0.577													27	56	---	---	---	---	capture	Silent	SNP	58022670	58022670	B4GALNT1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	1255	162
PTPN11	5781	broad.mit.edu	37	12	112926910	112926910	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112926910G>C	uc001ttx.2	+	13	1910	c.1530G>C	c.(1528-1530)CAG>CAC	p.Q510H		NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	514	Tyrosine-protein phosphatase.		Q -> P (in LEOPARD1).		axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding	p.Q510K(2)|p.Q510H(1)		haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						CAGAAGCACAGTACCGATTTA	0.493			Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				55	119	---	---	---	---	capture	Missense_Mutation	SNP	112926910	112926910	PTPN11	12	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	12675	162
C12orf52	84934	broad.mit.edu	37	12	113629392	113629392	+	Silent	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113629392C>T	uc001tur.1	+	4	1048	c.580C>T	c.(580-582)CTG>TTG	p.L194L	C12orf52_uc009zwg.1_Silent_p.L191L|C12orf52_uc001tus.1_Silent_p.L194L|C12orf52_uc001tut.1_Silent_p.L218L	NM_032848	NP_116237	Q96K30	RITA_HUMAN	hypothetical protein LOC84934	194	Interaction with tubulin.				negative regulation of Notch signaling pathway|negative regulation of transcription from RNA polymerase II promoter|neurogenesis|Notch signaling pathway|nuclear export	centrosome|nucleus	tubulin binding				0						TTCACGCCCCCTGAAGCGGGG	0.607													3	63	---	---	---	---	capture	Silent	SNP	113629392	113629392	C12orf52	12	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	1683	162
DNAH10	196385	broad.mit.edu	37	12	124393905	124393905	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124393905G>A	uc001uft.3	+	57	9584	c.9559G>A	c.(9559-9561)GTG>ATG	p.V3187M		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3187	Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGCCAAGGGCGTGATGTCCGA	0.502													10	14	---	---	---	---	capture	Missense_Mutation	SNP	124393905	124393905	DNAH10	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4556	162
GPR133	283383	broad.mit.edu	37	12	131475583	131475583	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:131475583C>T	uc001uit.3	+	7	1329	c.770C>T	c.(769-771)ACG>ATG	p.T257M	GPR133_uc010tbm.1_Missense_Mutation_p.T289M	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	257	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TTGTCTTCAACGCTGCCAAGC	0.478													11	19	---	---	---	---	capture	Missense_Mutation	SNP	131475583	131475583	GPR133	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6577	162
MDGA2	161357	broad.mit.edu	37	14	47389235	47389235	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:47389235A>G	uc001wwj.3	-	10	2207	c.2011T>C	c.(2011-2013)TAC>CAC	p.Y671H	MDGA2_uc001wwi.3_Missense_Mutation_p.Y442H|MDGA2_uc010ani.2_Missense_Mutation_p.Y231H	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	671					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						CCCAACCGGTATGCAACAATC	0.423													21	31	---	---	---	---	capture	Missense_Mutation	SNP	47389235	47389235	MDGA2	14	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	9320	162
SYNE2	23224	broad.mit.edu	37	14	64686074	64686074	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64686074G>A	uc001xgm.2	+	109	19967	c.19737G>A	c.(19735-19737)ATG>ATA	p.M6579I	SYNE2_uc001xgl.2_Missense_Mutation_p.M6602I|SYNE2_uc010apy.2_Missense_Mutation_p.M2964I|SYNE2_uc001xgn.2_Missense_Mutation_p.M1541I|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_Missense_Mutation_p.M549I|SYNE2_uc001xgq.2_Missense_Mutation_p.M944I|SYNE2_uc001xgr.2_Missense_Mutation_p.M362I|SYNE2_uc010tsi.1_Missense_Mutation_p.M236I|SYNE2_uc001xgs.2_Missense_Mutation_p.M236I|SYNE2_uc001xgt.2_Missense_Mutation_p.M110I	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6579	Cytoplasmic (Potential).|Spectrin 9.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGTTAAAGATGGCAAAGCCTC	0.433													19	34	---	---	---	---	capture	Missense_Mutation	SNP	64686074	64686074	SYNE2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	15334	162
LTBP2	4053	broad.mit.edu	37	14	75078500	75078500	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75078500C>T	uc001xqa.2	-	1	535	c.148G>A	c.(148-150)GCG>ACG	p.A50T		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	50					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		AGTCGATTCGCGTCTCCACCA	0.692													17	14	---	---	---	---	capture	Missense_Mutation	SNP	75078500	75078500	LTBP2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8989	162
AK7	122481	broad.mit.edu	37	14	96875256	96875256	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96875256C>T	uc001yfn.2	+	4	520	c.476C>T	c.(475-477)GCG>GTG	p.A159V		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	159	Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		ATGACTTGGGCGCGCTCCAAA	0.473													4	57	---	---	---	---	capture	Missense_Mutation	SNP	96875256	96875256	AK7	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	444	162
PACS2	23241	broad.mit.edu	37	14	105859121	105859121	+	Silent	SNP	C	G	G			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105859121C>G	uc001yqt.2	+	22	2551	c.2376C>G	c.(2374-2376)GGC>GGG	p.G792G	PACS2_uc001yqs.2_Silent_p.G717G|PACS2_uc001yqv.2_Silent_p.G796G|PACS2_uc001yqu.2_Silent_p.G807G	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	792					apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		CCAGCAGCGGCGAGGCTGCAG	0.612													18	48	---	---	---	---	capture	Silent	SNP	105859121	105859121	PACS2	14	C	G	G	G	1	0	0	0	0	0	0	0	1	340	27	4	4	11277	162
TRPM1	4308	broad.mit.edu	37	15	31295059	31295059	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:31295059G>A	uc001zfm.2	-	27	3906	c.3778C>T	c.(3778-3780)CGG>TGG	p.R1260W	TRPM1_uc010azy.2_Missense_Mutation_p.R1167W|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	1260	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTGCTTTGCCGGAGAAGATAC	0.473													7	118	---	---	---	---	capture	Missense_Mutation	SNP	31295059	31295059	TRPM1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16468	162
FBXL16	146330	broad.mit.edu	37	16	745854	745854	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:745854C>T	uc002cjc.2	-	4	906	c.703G>A	c.(703-705)GGG>AGG	p.G235R	FBXL16_uc002cja.2_5'Flank|FBXL16_uc002cjb.2_Missense_Mutation_p.G23R	NM_153350	NP_699181	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	235											0		Hepatocellular(780;0.0218)				GACCACAGCCCGGCCTCGGTG	0.672													4	46	---	---	---	---	capture	Missense_Mutation	SNP	745854	745854	FBXL16	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5658	162
CHTF18	63922	broad.mit.edu	37	16	839297	839297	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:839297C>G	uc002cke.3	+	3	437	c.374C>G	c.(373-375)TCC>TGC	p.S125C	RPUSD1_uc002cka.2_5'Flank|RPUSD1_uc002ckb.2_5'Flank|RPUSD1_uc002ckc.2_5'Flank|RPUSD1_uc002ckd.2_5'Flank|CHTF18_uc010uus.1_Missense_Mutation_p.S125C|CHTF18_uc010bre.1_RNA|CHTF18_uc002ckf.3_Missense_Mutation_p.S153C|CHTF18_uc010brf.2_5'UTR|CHTF18_uc002ckg.3_Intron	NM_022092	NP_071375	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor	125					cell cycle|DNA replication	nucleus	ATP binding|DNA binding|nucleoside-triphosphatase activity			kidney(1)	1		Hepatocellular(780;0.00335)				CCTCCCGACTCCTCGCCGACG	0.662													4	11	---	---	---	---	capture	Missense_Mutation	SNP	839297	839297	CHTF18	16	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	3379	162
GP2	2813	broad.mit.edu	37	16	20328646	20328646	+	Silent	SNP	G	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20328646G>T	uc002dgv.2	-	9	1397	c.1314C>A	c.(1312-1314)TCC>TCA	p.S438S	GP2_uc002dgw.2_Silent_p.S435S|GP2_uc002dgx.2_Silent_p.S291S|GP2_uc002dgy.2_Silent_p.S288S	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	438	ZP.					anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						GGCTTTCCGAGGACTGCCCAT	0.468													35	80	---	---	---	---	capture	Silent	SNP	20328646	20328646	GP2	16	G	T	T	T	1	0	0	0	0	0	0	0	1	444	35	4	4	6516	162
DNAH3	55567	broad.mit.edu	37	16	21053361	21053361	+	Silent	SNP	G	A	A	rs150869091	byFrequency	TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21053361G>A	uc010vbe.1	-	32	4626	c.4626C>T	c.(4624-4626)CCC>CCT	p.P1542P		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1542	AAA 1 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TGAGATTGTCGGGCAGTTCAG	0.403													37	70	---	---	---	---	capture	Silent	SNP	21053361	21053361	DNAH3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4560	162
ZNF423	23090	broad.mit.edu	37	16	49671646	49671646	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:49671646G>C	uc002efs.2	-	5	1715	c.1417C>G	c.(1417-1419)CAG>GAG	p.Q473E	ZNF423_uc010vgn.1_Missense_Mutation_p.Q356E	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	473					cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				TTGCCAAACTGCATCACAGGG	0.577													5	116	---	---	---	---	capture	Missense_Mutation	SNP	49671646	49671646	ZNF423	16	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	17778	162
OR1D2	4991	broad.mit.edu	37	17	2995386	2995386	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:2995386C>A	uc010vrb.1	-	1	905	c.905G>T	c.(904-906)AGA>ATA	p.R302I		NM_002548	NP_002539	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D,	302	Cytoplasmic (Potential).				cellular component movement|chemotaxis|protein import into nucleus, translocation|sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						ATCTAGGAGTCTTCCCAGAGC	0.463													7	165	---	---	---	---	capture	Missense_Mutation	SNP	2995386	2995386	OR1D2	17	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	10857	162
NF1	4763	broad.mit.edu	37	17	29508439	29508439	+	Splice_Site	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29508439G>A	uc002hgg.2	+	6	920	c.587_splice	c.e6-1	p.E196_splice	NF1_uc002hge.1_Splice_Site_p.E196_splice|NF1_uc002hgf.1_Splice_Site_p.E196_splice|NF1_uc002hgh.2_Splice_Site_p.E196_splice|NF1_uc010csn.1_Splice_Site_p.E56_splice	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTTTTTTCCAGAAACAGCATT	0.299			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			3	52	---	---	---	---	capture	Splice_Site	SNP	29508439	29508439	NF1	17	G	A	A	A	1	0	0	0	0	0	0	1	0	429	33	5	2	10263	162
WNT9B	7484	broad.mit.edu	37	17	44949992	44949992	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:44949992C>T	uc002ikw.1	+	2	224	c.187C>T	c.(187-189)CGG>TGG	p.R63W	WNT9B_uc002ikx.1_Missense_Mutation_p.R63W	NM_003396	NP_003387	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family,	63					anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|collecting duct development|cornea development in camera-type eye|endoderm development|establishment of planar polarity involved in nephron morphogenesis|kidney rudiment formation|male genitalia development|mesonephric duct formation|metanephric tubule development|neuron differentiation|palate development|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|uterus morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway|Wnt receptor signaling pathway, planar cell polarity pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding			lung(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GCTGTCCCGGCGGCAGAAGCA	0.682													30	66	---	---	---	---	capture	Missense_Mutation	SNP	44949992	44949992	WNT9B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	17280	162
IGF2BP1	10642	broad.mit.edu	37	17	47118832	47118832	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47118832A>C	uc002iom.2	+	8	1245	c.911A>C	c.(910-912)CAA>CCA	p.Q304P	IGF2BP1_uc010dbj.2_Missense_Mutation_p.Q165P	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding	304	Necessary for interaction with ELAVL4 and binding to TAU mRNA (By similarity).|KH 2.				CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						AAGGTAGAGCAAGATACCGAG	0.498													34	82	---	---	---	---	capture	Missense_Mutation	SNP	47118832	47118832	IGF2BP1	17	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	7498	162
SDK2	54549	broad.mit.edu	37	17	71418469	71418469	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:71418469C>T	uc010dfm.2	-	15	2002	c.2002G>A	c.(2002-2004)GTC>ATC	p.V668I	SDK2_uc010dfn.2_Missense_Mutation_p.V347I	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	668	Extracellular (Potential).|Fibronectin type-III 1.				cell adhesion	integral to membrane				ovary(2)	2						ACGTCGTTGACGGCACAAAGA	0.617													41	76	---	---	---	---	capture	Missense_Mutation	SNP	71418469	71418469	SDK2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13862	162
LAMA1	284217	broad.mit.edu	37	18	6999962	6999962	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6999962C>T	uc002knm.2	-	31	4511	c.4417G>A	c.(4417-4419)GAT>AAT	p.D1473N	LAMA1_uc010wzj.1_Missense_Mutation_p.D949N	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1473	Laminin EGF-like 16.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAACGGAAATCGTGGTCCCCT	0.423													12	32	---	---	---	---	capture	Missense_Mutation	SNP	6999962	6999962	LAMA1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8525	162
RIOK3	8780	broad.mit.edu	37	18	21043044	21043044	+	Splice_Site	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21043044G>A	uc002kui.3	+	2	796	c.179_splice	c.e2+1	p.A60_splice	RIOK3_uc010dls.2_Splice_Site_p.A60_splice|RIOK3_uc010xas.1_Splice_Site_p.A60_splice	NM_003831	NP_003822	O14730	RIOK3_HUMAN	sudD suppressor of bimD6 homolog						chromosome segregation		ATP binding|protein binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CTGAAGTTGCGTAAGTAAAAT	0.348													29	46	---	---	---	---	capture	Splice_Site	SNP	21043044	21043044	RIOK3	18	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	13271	162
DOCK6	57572	broad.mit.edu	37	19	11353971	11353971	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11353971C>T	uc002mqs.3	-	12	1390	c.1349G>A	c.(1348-1350)CGT>CAT	p.R450H		NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	450					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						CGTGGCTGGACGGAAGCCAGA	0.677											OREG0025252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	6	---	---	---	---	capture	Missense_Mutation	SNP	11353971	11353971	DOCK6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4647	162
OR7A10	390892	broad.mit.edu	37	19	14952342	14952342	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14952342G>A	uc002mzx.1	-	1	348	c.348C>T	c.(346-348)ACC>ACT	p.T116T		NM_001005190	NP_001005190	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A,	116	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					AGGCCATCACGGTCAGAAGGA	0.483													31	88	---	---	---	---	capture	Silent	SNP	14952342	14952342	OR7A10	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11118	162
FCGBP	8857	broad.mit.edu	37	19	40364217	40364217	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40364217G>A	uc002omp.3	-	31	14433	c.14425C>T	c.(14425-14427)CCG>TCG	p.P4809S		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	4809						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCAGGGCCCGGGTAGAAGACC	0.657													17	81	---	---	---	---	capture	Missense_Mutation	SNP	40364217	40364217	FCGBP	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	5724	162
EML2	24139	broad.mit.edu	37	19	46112931	46112931	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46112931C>T	uc002pcn.2	-	19	1975	c.1940G>A	c.(1939-1941)CGG>CAG	p.R647Q	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Missense_Mutation_p.R531Q|EML2_uc010xxl.1_Missense_Mutation_p.R794Q|EML2_uc010xxm.1_Missense_Mutation_p.R848Q	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	647	WD 11.				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		TCAGACCACCCGCCACTGTAG	0.537													22	57	---	---	---	---	capture	Missense_Mutation	SNP	46112931	46112931	EML2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5052	162
ELSPBP1	64100	broad.mit.edu	37	19	48525436	48525436	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48525436C>T	uc002pht.2	+	6	679	c.524C>T	c.(523-525)GCG>GTG	p.A175V		NM_022142	NP_071425	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1 precursor	175					single fertilization	extracellular region					0		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		GGAATTTCCGCGTTGGTCCCT	0.453													9	191	---	---	---	---	capture	Missense_Mutation	SNP	48525436	48525436	ELSPBP1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5038	162
LPIN1	23175	broad.mit.edu	37	2	11943091	11943091	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:11943091G>A	uc010yjn.1	+	15	2111	c.1837G>A	c.(1837-1839)GCA>ACA	p.A613T	LPIN1_uc010yjm.1_Missense_Mutation_p.A698T|LPIN1_uc002rbt.2_Missense_Mutation_p.A613T|LPIN1_uc010yjo.1_Missense_Mutation_p.A114T	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1	613					fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		GCCATCAAACGCAGGCCACCT	0.532													41	105	---	---	---	---	capture	Missense_Mutation	SNP	11943091	11943091	LPIN1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8834	162
IL1RL1	9173	broad.mit.edu	37	2	102959595	102959595	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102959595T>C	uc002tbu.1	+	7	1053	c.782T>C	c.(781-783)TTT>TCT	p.F261S	IL1RL1_uc010ywa.1_Missense_Mutation_p.F144S|IL18R1_uc002tbw.3_Intron|IL1RL1_uc002tbv.2_Missense_Mutation_p.F261S	NM_016232	NP_057316	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1 isoform 1	261	Extracellular (Potential).|Ig-like C2-type 3.				innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity			skin(2)|ovary(1)|central_nervous_system(1)	4						ATTACAGACTTTGGTGAACCA	0.423													59	107	---	---	---	---	capture	Missense_Mutation	SNP	102959595	102959595	IL1RL1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	7586	162
LRP2	4036	broad.mit.edu	37	2	170066149	170066149	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170066149G>A	uc002ues.2	-	38	6496	c.6283C>T	c.(6283-6285)CGA>TGA	p.R2095*		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2095	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AGTGCGTTTCGTCCTGGAAGT	0.418													22	36	---	---	---	---	capture	Nonsense_Mutation	SNP	170066149	170066149	LRP2	2	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	8872	162
DNAH7	56171	broad.mit.edu	37	2	196765215	196765215	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:196765215G>C	uc002utj.3	-	28	4440	c.4339C>G	c.(4339-4341)CTC>GTC	p.L1447V		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1447	AAA 1 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						GTCCGAAAGAGAGCCTATGGG	0.303													26	106	---	---	---	---	capture	Missense_Mutation	SNP	196765215	196765215	DNAH7	2	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	4562	162
AOX1	316	broad.mit.edu	37	2	201478598	201478598	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201478598C>T	uc002uvx.2	+	15	1621	c.1520C>T	c.(1519-1521)GCG>GTG	p.A507V	AOX1_uc010zhf.1_Missense_Mutation_p.A63V|AOX1_uc010fsu.2_5'UTR	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	507					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TTGGGCTCGGCGCCAGGTGGG	0.473													10	81	---	---	---	---	capture	Missense_Mutation	SNP	201478598	201478598	AOX1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	722	162
FAM126B	285172	broad.mit.edu	37	2	201881771	201881771	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201881771G>A	uc002uws.3	-	5	464	c.276C>T	c.(274-276)AGC>AGT	p.S92S	FAM126B_uc002uwu.2_Silent_p.S10S|FAM126B_uc002uwv.2_Silent_p.S92S|FAM126B_uc002uww.1_Silent_p.S92S	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172	92						intracellular				ovary(1)	1						GTCTGTCTCGGCTAACTGTAA	0.388													5	82	---	---	---	---	capture	Silent	SNP	201881771	201881771	FAM126B	2	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5384	162
TRPM8	79054	broad.mit.edu	37	2	234835206	234835206	+	Silent	SNP	C	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234835206C>A	uc002vvh.2	+	2	64	c.24C>A	c.(22-24)CTC>CTA	p.L8L	TRPM8_uc010fyj.2_5'UTR	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	8	Cytoplasmic (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	CAGCCAGGCTCAGCATGAGGA	0.522													4	56	---	---	---	---	capture	Silent	SNP	234835206	234835206	TRPM8	2	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	16475	162
PROKR2	128674	broad.mit.edu	37	20	5282952	5282952	+	Missense_Mutation	SNP	C	T	T	rs139399061	byFrequency	TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5282952C>T	uc010zqw.1	-	2	889	c.889G>A	c.(889-891)GTT>ATT	p.V297I	PROKR2_uc010zqx.1_Missense_Mutation_p.V297I|PROKR2_uc010zqy.1_Missense_Mutation_p.V297I	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	297	Extracellular (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						AAGTCACGAACGATGGTGAAA	0.562										HNSCC(71;0.22)			5	106	---	---	---	---	capture	Missense_Mutation	SNP	5282952	5282952	PROKR2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12449	162
SYCP2	10388	broad.mit.edu	37	20	58489299	58489299	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:58489299G>T	uc002yaz.2	-	10	781	c.642C>A	c.(640-642)GAC>GAA	p.D214E	SYCP2_uc010gju.1_Missense_Mutation_p.D115E	NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	214					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CTACCTGTAAGTCATAATCTA	0.289													8	16	---	---	---	---	capture	Missense_Mutation	SNP	58489299	58489299	SYCP2	20	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	15320	162
ARFGAP1	55738	broad.mit.edu	37	20	61907550	61907550	+	Silent	SNP	C	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61907550C>A	uc002yem.2	+	3	280	c.168C>A	c.(166-168)CTC>CTA	p.L56L	ARFGAP1_uc011aas.1_Intron|ARFGAP1_uc011aat.1_5'UTR|ARFGAP1_uc002yel.2_Silent_p.L56L|ARFGAP1_uc002yen.2_Silent_p.L56L	NM_018209	NP_060679	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating	56	Arf-GAP.				COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)					GGGTTCACCTCAGGTCAGTGT	0.642													22	31	---	---	---	---	capture	Silent	SNP	61907550	61907550	ARFGAP1	20	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	842	162
OR5H2	79310	broad.mit.edu	37	3	98001924	98001924	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98001924T>A	uc003dsj.1	+	1	193	c.193T>A	c.(193-195)TAC>AAC	p.Y65N		NM_001005482	NP_001005482	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						CATCCCCATGTACTTTTTTCT	0.408													118	255	---	---	---	---	capture	Missense_Mutation	SNP	98001924	98001924	OR5H2	3	T	A	A	A	1	0	0	0	0	1	0	0	0	741	57	4	4	11066	162
OR5H2	79310	broad.mit.edu	37	3	98002428	98002428	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98002428A>C	uc003dsj.1	+	1	697	c.697A>C	c.(697-699)AAG>CAG	p.K233Q		NM_001005482	NP_001005482	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						AATCCTAAAAAAGAAGTCTGT	0.363													21	48	---	---	---	---	capture	Missense_Mutation	SNP	98002428	98002428	OR5H2	3	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	11066	162
SLCO2A1	6578	broad.mit.edu	37	3	133692615	133692615	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:133692615G>A	uc003eqa.3	-	3	563	c.289C>T	c.(289-291)CGT>TGT	p.R97C	SLCO2A1_uc003eqb.3_Missense_Mutation_p.R97C|SLCO2A1_uc011blv.1_Missense_Mutation_p.R97C|SLCO2A1_uc010htw.1_5'UTR	NM_005630	NP_005621	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family,	97	Cytoplasmic (Potential).				sodium-independent organic anion transport	integral to plasma membrane|membrane fraction	prostaglandin transmembrane transporter activity|protein binding			central_nervous_system(1)	1						AGACGTGGACGGTGCACCCGG	0.572													10	21	---	---	---	---	capture	Missense_Mutation	SNP	133692615	133692615	SLCO2A1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14618	162
SR140	23350	broad.mit.edu	37	3	142735741	142735741	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142735741C>T	uc003evh.1	+	6	593	c.494C>T	c.(493-495)GCA>GTA	p.A165V	SR140_uc003evi.1_5'UTR|SR140_uc011bnj.1_Missense_Mutation_p.A165V|SR140_uc003evj.1_RNA|SR140_uc003evk.1_Missense_Mutation_p.A165V	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein	165					RNA processing	nucleus	nucleotide binding|RNA binding				0						TCAAGATTTGCAGATCAAAAA	0.303													3	23	---	---	---	---	capture	Missense_Mutation	SNP	142735741	142735741	SR140	3	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	15023	162
BCHE	590	broad.mit.edu	37	3	165548715	165548715	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:165548715G>T	uc003fem.3	-	2	267	c.107C>A	c.(106-108)ACA>AAA	p.T36K	BCHE_uc003fen.3_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	36					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	TCCATTCTTTGTTGCAATTAT	0.408													27	53	---	---	---	---	capture	Missense_Mutation	SNP	165548715	165548715	BCHE	3	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	1347	162
GHSR	2693	broad.mit.edu	37	3	172165593	172165593	+	Missense_Mutation	SNP	G	A	A	rs121917883		TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172165593G>A	uc003fib.1	-	1	611	c.611C>T	c.(610-612)GCG>GTG	p.A204V	GHSR_uc011bpv.1_Missense_Mutation_p.A204V	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	204	Extracellular (Potential).		A -> E (in ISSA; affects cell-surface expression; impairs constitutive activity but not the ability to respond to ghrelin).		actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			AGAGCGCACCGCAAACTCGGT	0.622													25	53	---	---	---	---	capture	Missense_Mutation	SNP	172165593	172165593	GHSR	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6314	162
CCDC158	339965	broad.mit.edu	37	4	77288530	77288530	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77288530G>A	uc003hkb.3	-	11	1900	c.1747C>T	c.(1747-1749)CGA>TGA	p.R583*		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	583	Potential.									skin(3)|ovary(2)|pancreas(1)	6						CCAGCAGTTCGTCCATGCTGG	0.453													45	109	---	---	---	---	capture	Nonsense_Mutation	SNP	77288530	77288530	CCDC158	4	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	2764	162
SEC31A	22872	broad.mit.edu	37	4	83799939	83799939	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:83799939C>T	uc003hnf.2	-	4	510	c.346G>A	c.(346-348)GCC>ACC	p.A116T	SEC31A_uc011ccl.1_Missense_Mutation_p.A116T|SEC31A_uc003hnl.2_Missense_Mutation_p.A116T|SEC31A_uc003hng.2_Missense_Mutation_p.A116T|SEC31A_uc003hnh.2_Missense_Mutation_p.A116T|SEC31A_uc003hni.2_Missense_Mutation_p.A116T|SEC31A_uc003hnj.2_Missense_Mutation_p.A116T|SEC31A_uc011ccm.1_Missense_Mutation_p.A111T|SEC31A_uc011ccn.1_Missense_Mutation_p.A116T|SEC31A_uc003hnk.2_Missense_Mutation_p.A116T|SEC31A_uc003hnm.2_Missense_Mutation_p.A116T|SEC31A_uc003hnn.1_Missense_Mutation_p.A116T|SEC31A_uc003hno.2_Missense_Mutation_p.A116T	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1	116					COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				TCATTCTGGGCAATCACAACT	0.398													19	134	---	---	---	---	capture	Missense_Mutation	SNP	83799939	83799939	SEC31A	4	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	13891	162
PCDH18	54510	broad.mit.edu	37	4	138451923	138451923	+	Silent	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:138451923C>T	uc003ihe.3	-	1	1707	c.1320G>A	c.(1318-1320)AGG>AGA	p.R440R	PCDH18_uc003ihf.3_Silent_p.R433R|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Silent_p.R220R|PCDH18_uc011cha.1_Intron	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	440	Cadherin 4.|Extracellular (Potential).				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					TGGGTGTCCCCCTGTCCTCAG	0.373													60	137	---	---	---	---	capture	Silent	SNP	138451923	138451923	PCDH18	4	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	11416	162
MYO10	4651	broad.mit.edu	37	5	16668507	16668507	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:16668507C>T	uc003jft.3	-	40	6422	c.5954G>A	c.(5953-5955)CGT>CAT	p.R1985H	MYO10_uc011cnb.1_Missense_Mutation_p.R614H|MYO10_uc011cnc.1_Missense_Mutation_p.R864H|MYO10_uc011cnd.1_Missense_Mutation_p.R1342H|MYO10_uc011cne.1_Missense_Mutation_p.R1342H|MYO10_uc010itx.2_Missense_Mutation_p.R1607H	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	1985	FERM.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						TCCCTCTCCACGCTTGTAGAC	0.547													46	79	---	---	---	---	capture	Missense_Mutation	SNP	16668507	16668507	MYO10	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9972	162
CDH9	1007	broad.mit.edu	37	5	26885965	26885965	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26885965G>A	uc003jgs.1	-	11	1809	c.1640C>T	c.(1639-1641)GCA>GTA	p.A547V	CDH9_uc011cnv.1_Missense_Mutation_p.A140V	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	547	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CATGATTCCTGCTGTATTATC	0.318													32	77	---	---	---	---	capture	Missense_Mutation	SNP	26885965	26885965	CDH9	5	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	3088	162
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139889605	139889605	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:139889605G>A	uc003lfs.1	+	22	4067	c.3943G>A	c.(3943-3945)GGA>AGA	p.G1315R	ANKHD1_uc003lfq.1_Missense_Mutation_p.G1334R|ANKHD1_uc003lfr.2_Missense_Mutation_p.G1315R|ANKHD1_uc003lft.1_Missense_Mutation_p.G526R|ANKHD1_uc003lfu.1_Missense_Mutation_p.G795R|ANKHD1_uc003lfv.1_Missense_Mutation_p.G392R|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.G54R|ANKHD1_uc003lfw.2_5'UTR	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1315						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTTTACAGGGGAGCCCACAT	0.393													29	80	---	---	---	---	capture	Missense_Mutation	SNP	139889605	139889605	ANKHD1-EIF4EBP3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	626	162
PCDHA4	56144	broad.mit.edu	37	5	140188686	140188686	+	Silent	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140188686C>T	uc003lhi.2	+	1	2015	c.1914C>T	c.(1912-1914)GAC>GAT	p.D638D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Silent_p.D638D|PCDHA4_uc011daa.1_Silent_p.D638D	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	638	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCCTGGACGAAACGGACG	0.677													30	96	---	---	---	---	capture	Silent	SNP	140188686	140188686	PCDHA4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11429	162
PCDHGB3	56102	broad.mit.edu	37	5	140751537	140751537	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140751537C>T	uc003ljw.1	+	1	1576	c.1576C>T	c.(1576-1578)CGT>TGT	p.R526C	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Missense_Mutation_p.R526C|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	526	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAGCAGCTGCGTGCCTTCGA	0.692													24	50	---	---	---	---	capture	Missense_Mutation	SNP	140751537	140751537	PCDHGB3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11467	162
CAMK2A	815	broad.mit.edu	37	5	149602771	149602771	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149602771C>T	uc003lru.2	-	17	1429	c.1214G>A	c.(1213-1215)CGG>CAG	p.R405Q	CAMK2A_uc003lrs.2_Missense_Mutation_p.R116Q|CAMK2A_uc003lrt.2_Missense_Mutation_p.R416Q	NM_171825	NP_741960	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II	405					interferon-gamma-mediated signaling pathway|positive regulation of NF-kappaB transcription factor activity|synaptic transmission	cell junction|cytosol|endocytic vesicle membrane|nucleoplasm|presynaptic membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTTGCTGTTCCGGGACCACAC	0.612													3	54	---	---	---	---	capture	Missense_Mutation	SNP	149602771	149602771	CAMK2A	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2575	162
LARP1	23367	broad.mit.edu	37	5	154188110	154188110	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154188110G>A	uc003lvp.2	+	16	3219	c.2790G>A	c.(2788-2790)AAG>AAA	p.K930K	LARP1_uc003lvo.2_Silent_p.K853K	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	930							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCAACAAAAAGATGTATGAGG	0.532													25	72	---	---	---	---	capture	Silent	SNP	154188110	154188110	LARP1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	8548	162
LARP1	23367	broad.mit.edu	37	5	154188112	154188112	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154188112T>A	uc003lvp.2	+	16	3221	c.2792T>A	c.(2791-2793)ATG>AAG	p.M931K	LARP1_uc003lvo.2_Missense_Mutation_p.M854K	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	931							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AACAAAAAGATGTATGAGGAG	0.532													24	70	---	---	---	---	capture	Missense_Mutation	SNP	154188112	154188112	LARP1	5	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	8548	162
GABRA6	2559	broad.mit.edu	37	5	161116737	161116737	+	Missense_Mutation	SNP	G	T	T	rs145469537		TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161116737G>T	uc003lyu.2	+	6	963	c.625G>T	c.(625-627)GAT>TAT	p.D209Y	GABRA6_uc003lyv.2_5'UTR	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	209	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	p.D209N(1)		ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TCTCCAGTATGATCTGATTGG	0.378										TCGA Ovarian(5;0.080)			18	50	---	---	---	---	capture	Missense_Mutation	SNP	161116737	161116737	GABRA6	5	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	6107	162
ENPP5	59084	broad.mit.edu	37	6	46135819	46135819	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46135819C>T	uc003oxz.1	-	2	389	c.181G>A	c.(181-183)GTG>ATG	p.V61M	ENPP5_uc003oya.1_Missense_Mutation_p.V61M|ENPP5_uc011dvz.1_Intron|ENPP5_uc010jzc.1_Missense_Mutation_p.V61M	NM_021572	NP_067547	Q9UJA9	ENPP5_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	61						extracellular region|integral to membrane	hydrolase activity				0						ACTTGCTTCACGTGAACACCA	0.348													18	48	---	---	---	---	capture	Missense_Mutation	SNP	46135819	46135819	ENPP5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5088	162
LGSN	51557	broad.mit.edu	37	6	63991054	63991054	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:63991054T>A	uc003peh.2	-	4	436	c.402A>T	c.(400-402)GAA>GAT	p.E134D	LGSN_uc003pei.2_Missense_Mutation_p.E134D	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	134					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	TGTTATTCATTTCATTGTCCT	0.393													42	89	---	---	---	---	capture	Missense_Mutation	SNP	63991054	63991054	LGSN	6	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	8679	162
EPHA7	2045	broad.mit.edu	37	6	93956625	93956625	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:93956625C>G	uc003poe.2	-	15	2852	c.2611G>C	c.(2611-2613)GAT>CAT	p.D871H	EPHA7_uc003pof.2_Missense_Mutation_p.D866H|EPHA7_uc011eac.1_Missense_Mutation_p.D867H	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor	871	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TGCCAACAATCCAACATTAGC	0.418													30	72	---	---	---	---	capture	Missense_Mutation	SNP	93956625	93956625	EPHA7	6	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	5127	162
MAN1A1	4121	broad.mit.edu	37	6	119669897	119669897	+	Missense_Mutation	SNP	C	G	G	rs139302645		TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:119669897C>G	uc003pym.1	-	2	776	c.334G>C	c.(334-336)GAC>CAC	p.D112H	MAN1A1_uc010kei.1_Missense_Mutation_p.D112H	NM_005907	NP_005898	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	112	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		GCCTCCGGGTCCCCGGGTGCC	0.502													14	34	---	---	---	---	capture	Missense_Mutation	SNP	119669897	119669897	MAN1A1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9124	162
ECT2L	345930	broad.mit.edu	37	6	139183819	139183819	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:139183819G>A	uc003qif.1	+	9	1357	c.1254G>A	c.(1252-1254)ACG>ACA	p.T418T	ECT2L_uc011edq.1_Silent_p.T349T	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2	418					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						CGTTCTTTACGGCCCCCACTG	0.463													33	77	---	---	---	---	capture	Silent	SNP	139183819	139183819	ECT2L	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4857	162
MAP3K4	4216	broad.mit.edu	37	6	161470034	161470034	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161470034A>G	uc003qtn.2	+	3	872	c.730A>G	c.(730-732)AGG>GGG	p.R244G	MAP3K4_uc010kkc.1_Missense_Mutation_p.R244G|MAP3K4_uc003qto.2_Missense_Mutation_p.R244G|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	244					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GAAAAAAGACAGGGAGCAAAG	0.433													14	34	---	---	---	---	capture	Missense_Mutation	SNP	161470034	161470034	MAP3K4	6	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	9166	162
NPC1L1	29881	broad.mit.edu	37	7	44579249	44579249	+	Silent	SNP	G	A	A	rs148698796		TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44579249G>A	uc003tlb.2	-	2	803	c.747C>T	c.(745-747)GAC>GAT	p.D249D	NPC1L1_uc003tlc.2_Silent_p.D249D|NPC1L1_uc011kbw.1_Silent_p.D249D|NPC1L1_uc003tld.2_Silent_p.D249D	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	249	Extracellular (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	TCGCCACGTCGTCACCTTGGG	0.632													28	54	---	---	---	---	capture	Silent	SNP	44579249	44579249	NPC1L1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10478	162
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			124	823	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	162
CACNA2D1	781	broad.mit.edu	37	7	81598223	81598223	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81598223C>T	uc003uhr.1	-	29	2631	c.2375G>A	c.(2374-2376)GGG>GAG	p.G792E	CACNA2D1_uc011kgy.1_Intron	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	804	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	AAGAAGTTTCCCTTGAATATA	0.284													16	53	---	---	---	---	capture	Missense_Mutation	SNP	81598223	81598223	CACNA2D1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	2524	162
CHMP4C	92421	broad.mit.edu	37	8	82644913	82644913	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:82644913G>A	uc003ycl.2	+	1	226	c.52G>A	c.(52-54)GCC>ACC	p.A18T		NM_152284	NP_689497	Q96CF2	CHM4C_HUMAN	chromatin modifying protein 4C	18	Intramolecular interaction with C- terminus (By similarity).				cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			ovary(2)	2						TAAGAGCCGAGCCGCTCCCAG	0.587													5	4	---	---	---	---	capture	Missense_Mutation	SNP	82644913	82644913	CHMP4C	8	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	3323	162
WDYHV1	55093	broad.mit.edu	37	8	124453566	124453566	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124453566G>A	uc003yqn.1	+	6	654	c.529G>A	c.(529-531)GAT>AAT	p.D177N	WDYHV1_uc011lij.1_Missense_Mutation_p.D117N|WDYHV1_uc003yqo.1_RNA	NM_018024	NP_060494	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	177					protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity			ovary(1)|skin(1)	2						GAACCTGAACGATTTCATCAG	0.373													8	13	---	---	---	---	capture	Missense_Mutation	SNP	124453566	124453566	WDYHV1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17224	162
SLC45A4	57210	broad.mit.edu	37	8	142228261	142228261	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142228261G>A	uc003ywd.1	-	4	1633	c.1325C>T	c.(1324-1326)ACG>ATG	p.T442M	SLC45A4_uc003ywc.1_Missense_Mutation_p.T442M|SLC45A4_uc010meq.1_Missense_Mutation_p.T440M	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4	493					transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CAGGCGCACCGTGGTCTCGCC	0.682													14	54	---	---	---	---	capture	Missense_Mutation	SNP	142228261	142228261	SLC45A4	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14535	162
RHPN1	114822	broad.mit.edu	37	8	144462083	144462083	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144462083G>A	uc003yyb.2	+	9	1163	c.1030G>A	c.(1030-1032)GTG>ATG	p.V344M		NM_052924	NP_443156	Q8TCX5	RHPN1_HUMAN	rhophilin 1	344	BRO1.				signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			GACTGCCCTGGTGCATGTCAA	0.657													7	7	---	---	---	---	capture	Missense_Mutation	SNP	144462083	144462083	RHPN1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	13242	162
TAF1L	138474	broad.mit.edu	37	9	32633610	32633610	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32633610T>A	uc003zrg.1	-	1	2058	c.1968A>T	c.(1966-1968)CAA>CAT	p.Q656H	uc003zrh.1_RNA	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	656					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTAGCAAAGGTTGGACTGAAT	0.502													10	100	---	---	---	---	capture	Missense_Mutation	SNP	32633610	32633610	TAF1L	9	T	A	A	A	1	0	0	0	0	1	0	0	0	777	60	4	4	15411	162
PALM2-AKAP2	445815	broad.mit.edu	37	9	112899196	112899196	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112899196C>T	uc004bei.2	+	9	2260	c.2068C>T	c.(2068-2070)CGC>TGC	p.R690C	PALM2-AKAP2_uc004bek.3_Missense_Mutation_p.R458C|PALM2-AKAP2_uc004bej.3_Missense_Mutation_p.R458C|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.R268C|AKAP2_uc011lwi.1_Missense_Mutation_p.R316C|AKAP2_uc004bem.2_Missense_Mutation_p.R316C|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.R276C|AKAP2_uc011lwj.1_Missense_Mutation_p.R227C|PALM2-AKAP2_uc004ben.2_Missense_Mutation_p.R227C	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	227	Potential.						enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						AGAGCTCATCCGCAGCCAGGC	0.512													29	53	---	---	---	---	capture	Missense_Mutation	SNP	112899196	112899196	PALM2-AKAP2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11314	162
PMPCA	23203	broad.mit.edu	37	9	139306464	139306464	+	Silent	SNP	G	A	A			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139306464G>A	uc004chl.2	+	2	92	c.87G>A	c.(85-87)GCG>GCA	p.A29A	SDCCAG3_uc004chi.2_5'Flank|SDCCAG3_uc004chj.2_5'Flank|SDCCAG3_uc004chk.2_5'Flank|PMPCA_uc011mdy.1_Silent_p.A29A|PMPCA_uc010nbk.2_RNA|PMPCA_uc010nbl.2_5'UTR|PMPCA_uc011mdz.1_5'UTR	NM_015160	NP_055975	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	29					proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		GACCTCCTGCGTACAGACGGT	0.493													3	49	---	---	---	---	capture	Silent	SNP	139306464	139306464	PMPCA	9	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	12043	162
KLHL13	90293	broad.mit.edu	37	X	117043736	117043736	+	Silent	SNP	C	T	T			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117043736C>T	uc004eql.2	-	5	956	c.894G>A	c.(892-894)ACG>ACA	p.T298T	KLHL13_uc004eqk.2_Silent_p.T247T|KLHL13_uc011mtn.1_Silent_p.T138T|KLHL13_uc011mto.1_Silent_p.T292T|KLHL13_uc011mtp.1_Silent_p.T300T|KLHL13_uc004eqm.2_Silent_p.T247T|KLHL13_uc011mtq.1_Silent_p.T282T	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	298					cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						TGAAATCCACCGTTTGCACGT	0.423													20	89	---	---	---	---	capture	Silent	SNP	117043736	117043736	KLHL13	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8289	162
OR52I1	390037	broad.mit.edu	37	11	4616048	4616048	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4616048delG	uc010qyi.1	+	1	780	c.780delG	c.(778-780)ATGfs	p.M260fs		NM_001005169	NP_001005169	Q8NGK6	O52I1_HUMAN	olfactory receptor, family 52, subfamily I,	260	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;7.98e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TACCTGGGATGGCATCCATCT	0.507													8	192	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	4616048	4616048	OR52I1	11	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	11024	162
MED23	9439	broad.mit.edu	37	6	131929144	131929144	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-2620-01	TCGA-19-2620-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:131929144delC	uc003qcs.1	-	12	1319	c.1145delG	c.(1144-1146)GGAfs	p.G382fs	MED23_uc003qcq.2_Frame_Shift_Del_p.G388fs|MED23_uc011eca.1_Intron|MED23_uc003qct.1_Frame_Shift_Del_p.G388fs|MED23_uc011ecb.1_RNA	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a	382					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CTGAATACTTCCAGAAATGAA	0.378													41	65	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	131929144	131929144	MED23	6	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	9354	162
