Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CDK11A	728642	broad.mit.edu	37	1	1636296	1636296	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1636296C>T	uc010nyt.1	-	13	1613	c.1505G>A	c.(1504-1506)CGA>CAA	p.R502Q	CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agv.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc001ahj.3_5'UTR|CDK11A_uc009vkp.2_Intron|CDK11A_uc009vkq.2_Intron|CDK11A_uc009vkr.2_Intron|CDK11A_uc009vks.2_Intron|CDK11A_uc010nys.1_Intron			Q9UQ88	CD11A_HUMAN	SubName: Full=cDNA FLJ56415, highly similar to PITSLRE serine/threonine-protein kinase CDC2L1 (EC 2.7.11.22);	Error:Variant_position_missing_in_Q9UQ88_after_alignment					apoptosis|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			stomach(1)	1						GGGGCCCTGTCGGAAAAGCCT	0.607													77	89	---	---	---	---	capture	Missense_Mutation	SNP	1636296	1636296	CDK11A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	391	31	1	1	3096	164
HES5	388585	broad.mit.edu	37	1	2461382	2461382	+	Silent	SNP	C	G	G			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2461382C>G	uc001ajn.2	-	2	204	c.123G>C	c.(121-123)CTG>CTC	p.L41L		NM_001010926	NP_001010926	Q5TA89	HES5_HUMAN	hairy and enhancer of split 5	41	Helix-loop-helix motif.				transcription, DNA-dependent	nucleus					0	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;4.41e-16)|all_lung(118;6.66e-07)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Lung SC(97;0.109)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;2.59e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		GCTCCAGCAGCAGCTTCAGCT	0.647													2	21	---	---	---	---	capture	Silent	SNP	2461382	2461382	HES5	1	C	G	G	G	1	0	0	0	0	0	0	0	1	314	25	4	4	6994	164
PTPRF	5792	broad.mit.edu	37	1	44085120	44085120	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44085120C>A	uc001cjr.2	+	28	5148	c.4808C>A	c.(4807-4809)GCG>GAG	p.A1603E	PTPRF_uc001cjs.2_Missense_Mutation_p.A1594E|PTPRF_uc001cju.2_Missense_Mutation_p.A992E|PTPRF_uc009vwt.2_Missense_Mutation_p.A1163E|PTPRF_uc001cjv.2_Missense_Mutation_p.A1074E|PTPRF_uc001cjw.2_Missense_Mutation_p.A829E	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1603	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATCCATGAGGCGCTGCTGGAG	0.607													3	77	---	---	---	---	capture	Missense_Mutation	SNP	44085120	44085120	PTPRF	1	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	12696	164
KANK4	163782	broad.mit.edu	37	1	62728946	62728946	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62728946C>T	uc001dah.3	-	7	2734	c.2357G>A	c.(2356-2358)CGC>CAC	p.R786H	KANK4_uc001dai.3_Missense_Mutation_p.R158H|KANK4_uc001daf.3_5'UTR|KANK4_uc001dag.3_Missense_Mutation_p.R142H	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	786				R -> H (in Ref. 1; BAC03774).						ovary(3)|skin(2)|lung(1)	6						GCTGGAGACGCGGAACCACTC	0.562													3	39	---	---	---	---	capture	Missense_Mutation	SNP	62728946	62728946	KANK4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7902	164
CSDE1	7812	broad.mit.edu	37	1	115272925	115272925	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115272925G>C	uc001efk.2	-	12	1776	c.1310C>G	c.(1309-1311)ACT>AGT	p.T437S	CSDE1_uc001efi.2_Missense_Mutation_p.T483S|CSDE1_uc001efj.2_RNA|CSDE1_uc001efl.2_Missense_Mutation_p.T406S|CSDE1_uc001efm.2_Missense_Mutation_p.T452S|CSDE1_uc009wgv.2_Missense_Mutation_p.T437S|CSDE1_uc001efn.2_Missense_Mutation_p.T406S	NM_001007553	NP_001007554	O75534	CSDE1_HUMAN	upstream of NRAS isoform 1	437					male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding			ovary(1)	1	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTGGAAAAAGTGGCTTCTTT	0.378													64	83	---	---	---	---	capture	Missense_Mutation	SNP	115272925	115272925	CSDE1	1	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	3894	164
F11R	50848	broad.mit.edu	37	1	160970003	160970003	+	Missense_Mutation	SNP	G	A	A	rs144844671	by1000genomes	TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160970003G>A	uc009wtt.2	-	5	794	c.524C>T	c.(523-525)ACG>ATG	p.T175M	F11R_uc010pjv.1_Missense_Mutation_p.T126M|F11R_uc001fxe.3_Missense_Mutation_p.T175M|F11R_uc009wtu.2_Missense_Mutation_p.T175M|F11R_uc010pjw.1_Missense_Mutation_p.T179M|F11R_uc001fxf.3_Missense_Mutation_p.T175M	NM_016946	NP_058642	Q9Y624	JAM1_HUMAN	F11 receptor precursor	175	Ig-like V-type 2.|Extracellular (Potential).				blood coagulation|inflammatory response|interspecies interaction between organisms|leukocyte migration|tight junction assembly	integral to membrane|tight junction				ovary(2)	2	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			TTTGGGATTCGTAGGCATCAC	0.517													70	70	---	---	---	---	capture	Missense_Mutation	SNP	160970003	160970003	F11R	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5292	164
LAMC1	3915	broad.mit.edu	37	1	183101569	183101569	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183101569G>A	uc001gpy.3	+	21	3858	c.3601G>A	c.(3601-3603)GCA>ACA	p.A1201T		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1201	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGTTCGAGTGGCAAAGACAGC	0.388													4	121	---	---	---	---	capture	Missense_Mutation	SNP	183101569	183101569	LAMC1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8534	164
ZC3H11A	9877	broad.mit.edu	37	1	203818961	203818961	+	Silent	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:203818961G>A	uc001hac.2	+	17	2362	c.1746G>A	c.(1744-1746)CGG>CGA	p.R582R	ZC3H11A_uc001had.2_Silent_p.R582R|ZC3H11A_uc001hae.2_Silent_p.R582R|ZC3H11A_uc001haf.2_Silent_p.R582R|ZC3H11A_uc010pqm.1_Silent_p.R528R|ZC3H11A_uc001hag.1_Silent_p.R582R	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	582							nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CACCTCTTCGGGGAGATGTAG	0.493													67	63	---	---	---	---	capture	Silent	SNP	203818961	203818961	ZC3H11A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	17440	164
CEP170	9859	broad.mit.edu	37	1	243362438	243362438	+	Silent	SNP	A	G	G			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:243362438A>G	uc001hzs.2	-	7	963	c.555T>C	c.(553-555)GAT>GAC	p.D185D	CEP170_uc001hzt.2_Silent_p.D185D|CEP170_uc001hzu.2_Silent_p.D185D	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	185						centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			CCACCTCATCATCCCCCCACC	0.428													3	32	---	---	---	---	capture	Silent	SNP	243362438	243362438	CEP170	1	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	3218	164
ALDH18A1	5832	broad.mit.edu	37	10	97396856	97396856	+	Silent	SNP	A	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:97396856A>T	uc001kkz.2	-	5	794	c.552T>A	c.(550-552)GCT>GCA	p.A184A	ALDH18A1_uc001kky.2_Silent_p.A184A|ALDH18A1_uc010qog.1_Silent_p.A73A|ALDH18A1_uc010qoh.1_Intron	NM_002860	NP_002851	P54886	P5CS_HUMAN	pyrroline-5-carboxylate synthetase isoform 1	184	Glutamate 5-kinase.				proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)	TCACCTGGGCAGCACAGATGC	0.458													37	12	---	---	---	---	capture	Silent	SNP	97396856	97396856	ALDH18A1	10	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	489	164
ADAM8	101	broad.mit.edu	37	10	135084467	135084467	+	Silent	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135084467G>A	uc010qva.1	-	13	1416	c.1365C>T	c.(1363-1365)AAC>AAT	p.N455N	ADAM8_uc010quz.1_Silent_p.N494N|ADAM8_uc009ybi.2_Silent_p.N494N			P78325	ADAM8_HUMAN	SubName: Full=cDNA FLJ50704, highly similar to ADAM 8 (EC 3.4.24.-) (A disintegrinand metalloproteinase domain 8);	455					integrin-mediated signaling pathway|proteolysis		metalloendopeptidase activity			large_intestine(2)|central_nervous_system(1)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)		AGGGCGTGCCGTTCTCCTGGA	0.667													16	24	---	---	---	---	capture	Silent	SNP	135084467	135084467	ADAM8	10	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	252	164
C11orf35	256329	broad.mit.edu	37	11	558885	558885	+	Silent	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:558885G>A	uc001lpx.2	-	2	192	c.129C>T	c.(127-129)CCC>CCT	p.P43P	uc001lpy.2_RNA|uc001lpz.2_5'Flank|RASSF7_uc001lqa.2_5'Flank|RASSF7_uc001lqb.2_5'Flank|RASSF7_uc001lqc.2_5'Flank|RASSF7_uc001lqd.2_5'Flank	NM_173573	NP_775844	Q8IXW0	CK035_HUMAN	hypothetical protein LOC256329	43										pancreas(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCACCGGTGCGGGGTGGGGCG	0.692													24	44	---	---	---	---	capture	Silent	SNP	558885	558885	C11orf35	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	1624	164
OR51E2	81285	broad.mit.edu	37	11	4703127	4703127	+	Missense_Mutation	SNP	C	T	T	rs138231892		TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4703127C>T	uc001lzk.2	-	2	1059	c.815G>A	c.(814-816)CGT>CAT	p.R272H		NM_030774	NP_110401	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E,	272	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(3)|ovary(2)	5		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		CATGACAACACGCACAATGGG	0.507													14	82	---	---	---	---	capture	Missense_Mutation	SNP	4703127	4703127	OR51E2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10999	164
OR52N4	390072	broad.mit.edu	37	11	5776764	5776764	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5776764G>A	uc001mbu.2	+	1	842	c.794G>A	c.(793-795)CGC>CAC	p.R265H	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		TTTTCCCACCGCTTTGGGGAA	0.468													92	123	---	---	---	---	capture	Missense_Mutation	SNP	5776764	5776764	OR52N4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11033	164
OR8I2	120586	broad.mit.edu	37	11	55861299	55861299	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55861299C>A	uc010rix.1	+	1	516	c.516C>A	c.(514-516)AGC>AGA	p.S172R		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					GTGATTCCAGCATCAATCATT	0.448													93	130	---	---	---	---	capture	Missense_Mutation	SNP	55861299	55861299	OR8I2	11	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	11144	164
ST14	6768	broad.mit.edu	37	11	130069857	130069857	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130069857C>T	uc001qfw.2	+	16	2012	c.1819C>T	c.(1819-1821)CGG>TGG	p.R607W		NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase	607	Extracellular (Potential).				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CTGTGGGCTGCGGTCATTCAC	0.612													15	91	---	---	---	---	capture	Missense_Mutation	SNP	130069857	130069857	ST14	11	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15101	164
FOXJ2	55810	broad.mit.edu	37	12	8201337	8201337	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8201337A>G	uc001qtu.2	+	8	2355	c.1270A>G	c.(1270-1272)AGC>GGC	p.S424G	FOXJ2_uc001qtt.1_Missense_Mutation_p.S424G	NM_018416	NP_060886	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	424					embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	nucleolus|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding			upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				Kidney(36;0.0944)		TTTAAAGGAAAGCTTCAAGAT	0.428													122	174	---	---	---	---	capture	Missense_Mutation	SNP	8201337	8201337	FOXJ2	12	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	5956	164
CACNB3	784	broad.mit.edu	37	12	49217552	49217552	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49217552A>G	uc001rsl.1	+	3	458	c.257A>G	c.(256-258)AAC>AGC	p.N86S	CACNB3_uc010slx.1_Missense_Mutation_p.N73S|CACNB3_uc010sly.1_Missense_Mutation_p.N73S|CACNB3_uc010slz.1_Missense_Mutation_p.N85S|CACNB3_uc001rsk.1_5'UTR	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3	86	SH3.				axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	TCTGGAGTCAACTTTGAGGCC	0.493													3	100	---	---	---	---	capture	Missense_Mutation	SNP	49217552	49217552	CACNB3	12	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	2530	164
ESPL1	9700	broad.mit.edu	37	12	53662942	53662942	+	Silent	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53662942G>A	uc001sck.2	+	3	307	c.216G>A	c.(214-216)GGG>GGA	p.G72G	ESPL1_uc001scj.2_5'UTR	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	72					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						GGCATCTGGGGAGCCTGCTGG	0.567													42	82	---	---	---	---	capture	Silent	SNP	53662942	53662942	ESPL1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	5208	164
NEDD1	121441	broad.mit.edu	37	12	97345747	97345747	+	Silent	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:97345747G>A	uc001teu.3	+	16	2238	c.1899G>A	c.(1897-1899)CTG>CTA	p.L633L	NEDD1_uc001tev.3_Silent_p.L633L|NEDD1_uc010svc.1_Silent_p.L544L|NEDD1_uc001tew.2_Silent_p.L640L|NEDD1_uc001tex.2_Silent_p.L544L	NM_152905	NP_690869	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally	633					cell division|G2/M transition of mitotic cell cycle|mitosis	cytosol					0						ATTCTTTGCTGGAAAGATACT	0.323													24	21	---	---	---	---	capture	Silent	SNP	97345747	97345747	NEDD1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	10216	164
ATXN2	6311	broad.mit.edu	37	12	111895056	111895056	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111895056G>A	uc001tsj.2	-	22	3640	c.3478C>T	c.(3478-3480)CAA>TAA	p.Q1160*	ATXN2_uc001tsh.2_Nonsense_Mutation_p.Q895*|ATXN2_uc001tsi.2_Nonsense_Mutation_p.Q853*|ATXN2_uc001tsk.2_RNA|ATXN2_uc001tsg.2_Nonsense_Mutation_p.Q348*|ATXN2_uc001tsl.1_Nonsense_Mutation_p.Q161*	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2	1160					cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						CCACCATGTTGGCTTTGCTGC	0.552													32	32	---	---	---	---	capture	Nonsense_Mutation	SNP	111895056	111895056	ATXN2	12	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	1202	164
FZD10	11211	broad.mit.edu	37	12	130648665	130648665	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130648665C>T	uc001uii.2	+	1	1634	c.1178C>T	c.(1177-1179)GCG>GTG	p.A393V	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	393	Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		GACGTCAACGCGCTCACCGGC	0.657													35	56	---	---	---	---	capture	Missense_Mutation	SNP	130648665	130648665	FZD10	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6071	164
CYP46A1	10858	broad.mit.edu	37	14	100166408	100166408	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:100166408G>A	uc001ygo.2	+	5	413	c.413G>A	c.(412-414)CGG>CAG	p.R138Q	CYP46A1_uc001ygn.1_Missense_Mutation_p.R100Q	NM_006668	NP_006659	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46	138					bile acid biosynthetic process|cholesterol catabolic process|nervous system development|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol 24-hydroxylase activity|electron carrier activity|heme binding|steroid hydroxylase activity				0		Melanoma(154;0.0866)|all_epithelial(191;0.179)				CACAAGCAGCGGAGAGTCATA	0.592													20	44	---	---	---	---	capture	Missense_Mutation	SNP	100166408	100166408	CYP46A1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4142	164
AHNAK2	113146	broad.mit.edu	37	14	105410901	105410901	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105410901C>A	uc010axc.1	-	7	11007	c.10887G>T	c.(10885-10887)AAG>AAT	p.K3629N	AHNAK2_uc001ypx.2_Missense_Mutation_p.K3529N	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3629						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CAGTCACGTCCTTGTCAGCCA	0.597													21	276	---	---	---	---	capture	Missense_Mutation	SNP	105410901	105410901	AHNAK2	14	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	415	164
AHNAK2	113146	broad.mit.edu	37	14	105418389	105418389	+	Silent	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105418389G>A	uc010axc.1	-	7	3519	c.3399C>T	c.(3397-3399)GTC>GTT	p.V1133V	AHNAK2_uc001ypx.2_Silent_p.V1033V	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1133						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCGGGGCCTCGACGTCCACCT	0.632													155	205	---	---	---	---	capture	Silent	SNP	105418389	105418389	AHNAK2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	415	164
OR4N4	283694	broad.mit.edu	37	15	22332433	22332433	+	Translation_Start_Site	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:22332433G>A	uc001yuc.1	+	3	240	c.-741G>A	c.(-743--739)ACGTG>ACATG		LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		AGATTCTAACGTGACAGAACT	0.328													40	304	---	---	---	---	capture	Translation_Start_Site	SNP	22332433	22332433	OR4N4	15	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	10982	164
DUOX2	50506	broad.mit.edu	37	15	45393418	45393418	+	Missense_Mutation	SNP	C	T	T	rs146664125	byFrequency	TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45393418C>T	uc010bea.2	-	22	3109	c.2906G>A	c.(2905-2907)CGG>CAG	p.R969Q	DUOX2_uc001zun.2_Missense_Mutation_p.R969Q	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	969	Cytoplasmic (Potential).|Interaction with TXNDC11 (By similarity).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CCCAGGTGTCCGAGTGATGAA	0.547													11	34	---	---	---	---	capture	Missense_Mutation	SNP	45393418	45393418	DUOX2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4756	164
GFOD2	81577	broad.mit.edu	37	16	67709764	67709764	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67709764C>T	uc002eub.2	-	3	747	c.452G>A	c.(451-453)CGC>CAC	p.R151H	GFOD2_uc002eua.1_RNA|GFOD2_uc002euc.2_Missense_Mutation_p.R46H	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain	151						proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		TGAGTAGATGCGGGCATCACA	0.592													4	99	---	---	---	---	capture	Missense_Mutation	SNP	67709764	67709764	GFOD2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6284	164
CBFA2T3	863	broad.mit.edu	37	16	88945788	88945788	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:88945788C>T	uc002fmm.1	-	11	1738	c.1552G>A	c.(1552-1554)GAG>AAG	p.E518K	CBFA2T3_uc002fml.1_Missense_Mutation_p.E432K|CBFA2T3_uc002fmk.1_Missense_Mutation_p.E17K	NM_005187	NP_005178	O75081	MTG16_HUMAN	myeloid translocation gene on chromosome 16	518	Potential.		E -> K (in a colorectal cancer sample; somatic mutation).		cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.E518K(1)		large_intestine(3)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0275)		GTGATGAGCTCGTGCGCTTTG	0.657			T	RUNX1	AML								12	68	---	---	---	---	capture	Missense_Mutation	SNP	88945788	88945788	CBFA2T3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2674	164
GPR179	440435	broad.mit.edu	37	17	36499303	36499303	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36499303C>G	uc002hpz.2	-	1	391	c.370G>C	c.(370-372)GAG>CAG	p.E124Q		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	124	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ACATCCTCCTCCACACTGGAC	0.627													42	54	---	---	---	---	capture	Missense_Mutation	SNP	36499303	36499303	GPR179	17	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	6608	164
C18orf45	85019	broad.mit.edu	37	18	20889650	20889650	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:20889650G>A	uc002kuf.2	-	14	933	c.824C>T	c.(823-825)ACG>ATG	p.T275M	C18orf45_uc010xaq.1_RNA|C18orf45_uc010xar.1_RNA|C18orf45_uc002kug.2_RNA|C18orf45_uc002kuh.2_RNA|C18orf45_uc002kue.2_RNA	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019	275	Helical; (Potential).					integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)					TTACCATCCCGTGGTTGCACT	0.403													51	98	---	---	---	---	capture	Missense_Mutation	SNP	20889650	20889650	C18orf45	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1887	164
MIER2	54531	broad.mit.edu	37	19	307371	307371	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:307371T>C	uc002lok.1	-	13	1373	c.1364A>G	c.(1363-1365)TAC>TGC	p.Y455C		NM_017550	NP_060020	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family	455					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCTGGCTGGTATGAGGCTGG	0.687													2	9	---	---	---	---	capture	Missense_Mutation	SNP	307371	307371	MIER2	19	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	9493	164
CHAF1A	10036	broad.mit.edu	37	19	4409704	4409704	+	Missense_Mutation	SNP	C	A	A	rs150305585		TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4409704C>A	uc002mal.2	+	3	1008	c.908C>A	c.(907-909)CCA>CAA	p.P303Q		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	303	Binds to CBX1 chromo shadow domain.				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCTCCCCCAAAGCAGCAC	0.612								Chromatin_Structure					6	131	---	---	---	---	capture	Missense_Mutation	SNP	4409704	4409704	CHAF1A	19	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	3277	164
PLEKHG2	64857	broad.mit.edu	37	19	39913972	39913972	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39913972G>A	uc010xuz.1	+	18	2603	c.2278G>A	c.(2278-2280)GCA>ACA	p.A760T	PLEKHG2_uc010xuy.1_Missense_Mutation_p.A701T|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Missense_Mutation_p.A538T	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	760					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGATGAGCTGGCATTCCGCTC	0.597													24	29	---	---	---	---	capture	Missense_Mutation	SNP	39913972	39913972	PLEKHG2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11972	164
TTN	7273	broad.mit.edu	37	2	179442793	179442793	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179442793G>A	uc010zfg.1	-	271	60969	c.60745C>T	c.(60745-60747)CGA>TGA	p.R20249*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.R13944*|TTN_uc010zfi.1_Nonsense_Mutation_p.R13877*|TTN_uc010zfj.1_Nonsense_Mutation_p.R13752*|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21176							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCATAACTCGGAATTCATAT	0.423													5	97	---	---	---	---	capture	Nonsense_Mutation	SNP	179442793	179442793	TTN	2	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	16617	164
KCTD18	130535	broad.mit.edu	37	2	201371625	201371625	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201371625C>A	uc002uvs.2	-	2	632	c.115G>T	c.(115-117)GCA>TCA	p.A39S	KCTD18_uc002uvt.2_Missense_Mutation_p.A39S|KCTD18_uc002uvu.1_Missense_Mutation_p.A39S	NM_152387	NP_689600	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain	39	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1						AACATAGATGCCAACATGGAG	0.458													27	49	---	---	---	---	capture	Missense_Mutation	SNP	201371625	201371625	KCTD18	2	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	8027	164
PARD3B	117583	broad.mit.edu	37	2	205986432	205986432	+	Silent	SNP	T	C	C			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:205986432T>C	uc002var.1	+	8	1131	c.924T>C	c.(922-924)GGT>GGC	p.G308G	PARD3B_uc010fub.1_Silent_p.G308G|PARD3B_uc002vao.1_Silent_p.G308G|PARD3B_uc002vap.1_Silent_p.G308G|PARD3B_uc002vaq.1_Silent_p.G308G	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	308					cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		ACATTTTTGGTAATAATGATG	0.453													60	80	---	---	---	---	capture	Silent	SNP	205986432	205986432	PARD3B	2	T	C	C	C	1	0	0	0	0	0	0	0	1	730	57	3	3	11348	164
ALPP	250	broad.mit.edu	37	2	233244353	233244353	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233244353G>A	uc002vsq.2	+	4	605	c.440G>A	c.(439-441)CGC>CAC	p.R147H	ALPP_uc002vsr.2_5'Flank	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein	147						anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		AACACGACACGCGGCAACGAG	0.607													10	25	---	---	---	---	capture	Missense_Mutation	SNP	233244353	233244353	ALPP	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	548	164
TGM3	7053	broad.mit.edu	37	20	2320632	2320632	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2320632G>A	uc002wfx.3	+	12	2030	c.1933G>A	c.(1933-1935)GAC>AAC	p.D645N		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	645					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	CCTGAAGATCGAGTGAGTCCT	0.642													7	9	---	---	---	---	capture	Missense_Mutation	SNP	2320632	2320632	TGM3	20	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15716	164
SEMG1	6406	broad.mit.edu	37	20	43836470	43836470	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43836470G>A	uc002xni.2	+	2	589	c.532G>A	c.(532-534)GTC>ATC	p.V178I	SEMG1_uc002xnj.2_Missense_Mutation_p.V178I|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Missense_Mutation_p.V178I	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	178	42 AA repeat 1.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				ACAAACTTCCGTCTCTGGTGC	0.423													55	57	---	---	---	---	capture	Missense_Mutation	SNP	43836470	43836470	SEMG1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13937	164
KRTAP6-1	337966	broad.mit.edu	37	21	31986055	31986055	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31986055A>T	uc002yop.2	-	1	169	c.169T>A	c.(169-171)TGT>AGT	p.C57S	KRTAP20-1_uc011ade.1_5'Flank	NM_181602	NP_853633	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	57						cytosol|intermediate filament					0						CCATAGCCACAGAGGGAGCGG	0.567													27	108	---	---	---	---	capture	Missense_Mutation	SNP	31986055	31986055	KRTAP6-1	21	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	8489	164
MYH9	4627	broad.mit.edu	37	22	36689392	36689392	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:36689392C>T	uc003apg.2	-	30	4309	c.4078G>A	c.(4078-4080)GCC>ACC	p.A1360T		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1360	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						TGGAGGGTGGCGATCTGCTTC	0.662			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				47	52	---	---	---	---	capture	Missense_Mutation	SNP	36689392	36689392	MYH9	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9952	164
HES1	3280	broad.mit.edu	37	3	193855643	193855643	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:193855643A>C	uc003ftq.1	+	4	700	c.464A>C	c.(463-465)TAC>TCC	p.Y155S		NM_005524	NP_005515	Q14469	HES1_HUMAN	hairy and enhancer of split 1	155					endocrine pancreas development|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway	nucleus	histone deacetylase binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)	2	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		GCCATGACCTACCCCGGGCAG	0.731													8	42	---	---	---	---	capture	Missense_Mutation	SNP	193855643	193855643	HES1	3	A	C	C	C	1	0	0	0	0	1	0	0	0	182	14	4	4	6991	164
PLCXD3	345557	broad.mit.edu	37	5	41313846	41313846	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41313846A>T	uc003jmm.1	-	3	941	c.839T>A	c.(838-840)GTC>GAC	p.V280D		NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X	280					intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						CTGCGTGCGGACCCACTGCAT	0.433													31	33	---	---	---	---	capture	Missense_Mutation	SNP	41313846	41313846	PLCXD3	5	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	11946	164
NMUR2	56923	broad.mit.edu	37	5	151784217	151784217	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151784217C>T	uc003luv.2	-	1	624	c.458G>A	c.(457-459)CGC>CAC	p.R153H		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	153	Cytoplasmic (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			CAGTTTGGCGCGGAACGGGTG	0.637													41	51	---	---	---	---	capture	Missense_Mutation	SNP	151784217	151784217	NMUR2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10414	164
DOCK2	1794	broad.mit.edu	37	5	169508958	169508958	+	Silent	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169508958G>A	uc003maf.2	+	51	5480	c.5400G>A	c.(5398-5400)CGG>CGA	p.R1800R	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.R1292R|DOCK2_uc003mah.2_Silent_p.R356R	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1800					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACTCACACGGAAGAAGGTCA	0.527													4	85	---	---	---	---	capture	Silent	SNP	169508958	169508958	DOCK2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	4643	164
C6orf195	154386	broad.mit.edu	37	6	2623743	2623743	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:2623743G>C	uc003mtw.2	-	3	1299	c.314C>G	c.(313-315)GCC>GGC	p.A105G		NM_152554	NP_689767	Q96MT4	CF195_HUMAN	hypothetical protein LOC154386	105											0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				GCAGGGAGTGGCCTGGTCACT	0.547													34	25	---	---	---	---	capture	Missense_Mutation	SNP	2623743	2623743	C6orf195	6	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	2327	164
LRRC1	55227	broad.mit.edu	37	6	53784332	53784332	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:53784332G>C	uc003pcd.1	+	12	1420	c.1143G>C	c.(1141-1143)AAG>AAC	p.K381N		NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	381						cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CTGCCTTGAAGTTGAAGGCTC	0.398													3	73	---	---	---	---	capture	Missense_Mutation	SNP	53784332	53784332	LRRC1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	8882	164
AKD1	221264	broad.mit.edu	37	6	109993332	109993332	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109993332C>T	uc003ptn.2	-	4	297	c.220G>A	c.(220-222)GAA>AAA	p.E74K	AKD1_uc003ptr.3_Missense_Mutation_p.E74K|AKD1_uc003pts.1_RNA	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	74					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						ACTCCTGATTCGGTTTCAGCA	0.279													21	33	---	---	---	---	capture	Missense_Mutation	SNP	109993332	109993332	AKD1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	460	164
VNN1	8876	broad.mit.edu	37	6	133005540	133005540	+	Silent	SNP	G	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:133005540G>A	uc003qdo.2	-	6	1313	c.1293C>T	c.(1291-1293)TTC>TTT	p.F431F	VNN1_uc003qdn.2_RNA	NM_004666	NP_004657	O95497	VNN1_HUMAN	vanin 1 precursor	431					acute inflammatory response|anti-apoptosis|cell-cell adhesion|cellular component movement|chronic inflammatory response|innate immune response|pantothenate metabolic process|positive regulation of T cell differentiation in thymus|response to oxidative stress	anchored to membrane|integral to membrane|plasma membrane	GPI anchor binding|pantetheine hydrolase activity			ovary(3)	3	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		ACTGGGTTCCGAAAGTGCCAC	0.418													48	50	---	---	---	---	capture	Silent	SNP	133005540	133005540	VNN1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	17064	164
C7orf28A	51622	broad.mit.edu	37	7	5959509	5959509	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5959509C>T	uc003spf.2	+	12	1108	c.1018C>T	c.(1018-1020)CGA>TGA	p.R340*		NM_015622	NP_056437	P86791	CCZ1_HUMAN	hypothetical protein LOC51622	340						lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)		GGATTTTTGCCGAAGACTGGA	0.468													47	210	---	---	---	---	capture	Nonsense_Mutation	SNP	5959509	5959509	C7orf28A	7	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	2360	164
EGFR	1956	broad.mit.edu	37	7	55210077	55210078	+	Missense_Mutation	DNP	GG	AA	AA			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55210077_55210078GG>AA	uc003tqk.2	+	2	433_434	c.187_188GG>AA	c.(187-189)GGG>AAG	p.G63K	EGFR_uc003tqh.2_Missense_Mutation_p.G63K|EGFR_uc003tqi.2_Missense_Mutation_p.G63K|EGFR_uc003tqj.2_Missense_Mutation_p.G63K|EGFR_uc010kzg.1_Missense_Mutation_p.G63K|EGFR_uc011kco.1_Missense_Mutation_p.G10K	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	63	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.G63R(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GGTGGTCCTTGGGAATTTGGAA	0.396		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			43	929	---	---	---	---	capture	Missense_Mutation	DNP	55210077	55210078	EGFR	7	GG	AA	AA	AA	1	0	0	0	0	1	0	0	0	611	47	2	2	4922	164
STEAP1	26872	broad.mit.edu	37	7	89794038	89794038	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:89794038C>A	uc003ujx.2	+	5	1210	c.1010C>A	c.(1009-1011)TCC>TAC	p.S337Y	STEAP2_uc003ujy.2_5'Flank	NM_012449	NP_036581	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the	337					electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	all_hematologic(106;0.112)					GAGATATGTTCCCAGTTGTAG	0.299													13	52	---	---	---	---	capture	Missense_Mutation	SNP	89794038	89794038	STEAP1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	15167	164
LHFPL3	375612	broad.mit.edu	37	7	104377161	104377161	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:104377161G>C	uc003vce.2	+	2	609	c.485G>C	c.(484-486)GGC>GCC	p.G162A	LHFPL3_uc003vcf.2_Missense_Mutation_p.G162A	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	148						integral to membrane					0						TTCCCTGATGGCTGGGACTCA	0.418													12	34	---	---	---	---	capture	Missense_Mutation	SNP	104377161	104377161	LHFPL3	7	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	8686	164
DAB2IP	153090	broad.mit.edu	37	9	124538504	124538504	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:124538504C>T	uc004bln.2	+	14	3133	c.3064C>T	c.(3064-3066)CGA>TGA	p.R1022*	DAB2IP_uc004blo.2_Nonsense_Mutation_p.R926*|DAB2IP_uc004blp.2_Nonsense_Mutation_p.R455*	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform	1050	Potential.				activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						GGACAAGCTGCGAATCTCCAC	0.622													2	2	---	---	---	---	capture	Nonsense_Mutation	SNP	124538504	124538504	DAB2IP	9	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	4179	164
MAGEB18	286514	broad.mit.edu	37	X	26157310	26157310	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:26157310A>G	uc004dbq.1	+	2	395	c.208A>G	c.(208-210)ACC>GCC	p.T70A		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	70							protein binding			central_nervous_system(1)	1						AGCCCCATCCACCACCAATGC	0.532													22	5	---	---	---	---	capture	Missense_Mutation	SNP	26157310	26157310	MAGEB18	23	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	9089	164
TBC1D10C	374403	broad.mit.edu	37	11	67177159	67177159	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67177159delC	uc001ola.2	+	10	1304	c.1275delC	c.(1273-1275)GGCfs	p.G425fs	PPP1CA_uc001okx.1_Intron|TBC1D10C_uc001okz.2_3'UTR|TBC1D10C_uc001olb.2_RNA	NM_198517	NP_940919	Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	425	Interaction with calcineurin.					intracellular	Rab GTPase activator activity				0			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GGGCCCGGGGCCCCCCCATCG	0.682													26	29	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	67177159	67177159	TBC1D10C	11	C	-	-	-	1	0	1	0	1	0	0	0	0	327	26	5	5	15488	164
CCPG1	9236	broad.mit.edu	37	15	55652558	55652559	+	Frame_Shift_Ins	INS	-	C	C			TCGA-19-2624-01	TCGA-19-2624-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:55652558_55652559insC	uc002acv.1	-	8	1577_1578	c.1412_1413insG	c.(1411-1413)GGCfs	p.G471fs	CCPG1_uc002acy.2_Frame_Shift_Ins_p.G471fs|CCPG1_uc002acu.1_Frame_Shift_Ins_p.G327fs|CCPG1_uc002acw.1_Frame_Shift_Ins_p.G196fs|CCPG1_uc002acx.2_Intron|CCPG1_uc010bfk.1_Frame_Shift_Ins_p.G471fs|CCPG1_uc002acz.1_Frame_Shift_Ins_p.G471fs	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2	471	Lumenal (Potential).				cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		GGCTTCCTCTGCCCCCTTTCTT	0.391													9	726	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	55652558	55652559	CCPG1	15	-	C	C	C	1	0	1	1	0	0	0	0	0	587	46	5	5	2909	164
