Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ACTL8	81569	broad.mit.edu	37	1	18149715	18149715	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:18149715G>A	uc001bat.2	+	2	428	c.212G>A	c.(211-213)CGC>CAC	p.R71H		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	71						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		GAGCGGGGCCGCATCCTCAAC	0.597													65	155	---	---	---	---	capture	Missense_Mutation	SNP	18149715	18149715	ACTL8	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	202	165
SPOCD1	90853	broad.mit.edu	37	1	32280067	32280067	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32280067C>T	uc001bts.1	-	2	926	c.868G>A	c.(868-870)GCT>ACT	p.A290T	SPOCD1_uc001btu.2_Missense_Mutation_p.A290T|SPOCD1_uc001btv.2_Intron	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	290					transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TCCCCTGTAGCGGGCAAATAT	0.632													12	57	---	---	---	---	capture	Missense_Mutation	SNP	32280067	32280067	SPOCD1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14970	165
PTPRF	5792	broad.mit.edu	37	1	44056912	44056912	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44056912C>T	uc001cjr.2	+	9	1559	c.1219C>T	c.(1219-1221)CGC>TGC	p.R407C	PTPRF_uc001cjs.2_Missense_Mutation_p.R407C|PTPRF_uc001cju.2_Translation_Start_Site|PTPRF_uc009vwt.2_Translation_Start_Site|PTPRF_uc001cjv.2_Translation_Start_Site	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	407	Extracellular (Potential).|Fibronectin type-III 1.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGTGCGGGCACGCACGGGAGA	0.701													8	29	---	---	---	---	capture	Missense_Mutation	SNP	44056912	44056912	PTPRF	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12696	165
SLAMF6	114836	broad.mit.edu	37	1	160465979	160465979	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160465979C>T	uc001fwe.1	-	2	314	c.254G>A	c.(253-255)CGA>CAA	p.R85Q	SLAMF6_uc001fwd.1_Missense_Mutation_p.R85Q|SLAMF6_uc010pjh.1_Missense_Mutation_p.R36Q|SLAMF6_uc010pji.1_Intron|SLAMF6_uc010pjj.1_Intron|SLAMF6_uc009wtm.1_Missense_Mutation_p.R36Q	NM_052931	NP_443163	Q96DU3	SLAF6_HUMAN	activating NK receptor precursor	85	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			GAAGTTCAGTCGCTTTCCCTG	0.463													138	161	---	---	---	---	capture	Missense_Mutation	SNP	160465979	160465979	SLAMF6	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14261	165
NPHS2	7827	broad.mit.edu	37	1	179520378	179520378	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179520378A>G	uc001gmq.3	-	8	1167	c.1082T>C	c.(1081-1083)CTC>CCC	p.L361P	C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmo.2_Intron|C1orf125_uc001gmp.2_Intron|C1orf125_uc009wxh.2_Intron|NPHS2_uc009wxi.2_Missense_Mutation_p.L293P|C1orf125_uc001gmr.2_RNA	NM_014625	NP_055440	Q9NP85	PODO_HUMAN	podocin	361	Cytoplasmic (Potential).				excretion	integral to plasma membrane	protein binding				0						TGGGAAGGGGAGGCTTCCCTG	0.473													29	104	---	---	---	---	capture	Missense_Mutation	SNP	179520378	179520378	NPHS2	1	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10490	165
CENPF	1063	broad.mit.edu	37	1	214816089	214816089	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214816089G>A	uc001hkm.2	+	12	4582	c.4408G>A	c.(4408-4410)GAG>AAG	p.E1470K		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	1566	1-2.|2 X 96 AA approximate tandem repeats.		Missing.		cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGGCTTGGAGGAGGGGCTCGT	0.478													58	68	---	---	---	---	capture	Missense_Mutation	SNP	214816089	214816089	CENPF	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3199	165
EPRS	2058	broad.mit.edu	37	1	220154727	220154727	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:220154727T>C	uc001hly.1	-	24	3716	c.3446A>G	c.(3445-3447)AAT>AGT	p.N1149S		NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	1149	Prolyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	TACCACCACATTGCACCACTG	0.358													42	50	---	---	---	---	capture	Missense_Mutation	SNP	220154727	220154727	EPRS	1	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	5146	165
ARMC4	55130	broad.mit.edu	37	10	28229643	28229643	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:28229643G>T	uc009xky.2	-	13	1933	c.1835C>A	c.(1834-1836)GCA>GAA	p.A612E	ARMC4_uc010qds.1_Missense_Mutation_p.A137E|ARMC4_uc010qdt.1_Missense_Mutation_p.A304E|ARMC4_uc001itz.2_Missense_Mutation_p.A612E|ARMC4_uc010qdu.1_Missense_Mutation_p.A304E	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	612							binding			ovary(4)|skin(2)	6						CAGGGCCAGTGCCCCACAGCG	0.517													27	51	---	---	---	---	capture	Missense_Mutation	SNP	28229643	28229643	ARMC4	10	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	946	165
PTEN	5728	broad.mit.edu	37	10	89685314	89685314	+	Missense_Mutation	SNP	T	A	A	rs121909226		TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89685314T>A	uc001kfb.2	+	4	1240	c.209T>A	c.(208-210)CTT>CAT	p.L70H		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	70	Phosphatase tensin-type.		L -> P (in CD).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(4)|p.L70fs*7(4)|p.R55fs*1(4)|p.Y27_N212>Y(2)|p.Y27fs*1(2)|p.L70F(1)|p.L70P(1)|p.R55_L70>S(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ATATACAATCTGTAAGTATGT	0.279		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			6	13	---	---	---	---	capture	Missense_Mutation	SNP	89685314	89685314	PTEN	10	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	12633	165
CDHR5	53841	broad.mit.edu	37	11	618758	618758	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:618758T>C	uc001lqj.2	-	13	1906	c.1801A>G	c.(1801-1803)ACA>GCA	p.T601A	IRF7_uc001lqh.2_5'Flank|IRF7_uc001lqi.2_5'Flank|IRF7_uc010qwh.1_5'Flank|CDHR5_uc001lqk.2_Intron|CDHR5_uc009ycc.2_Missense_Mutation_p.T435A|CDHR5_uc009ycd.2_Missense_Mutation_p.T595A|CDHR5_uc001lql.2_Missense_Mutation_p.T601A	NM_021924	NP_068743	Q9HBB8	CDHR5_HUMAN	mucin and cadherin-like isoform 1	601	4 X 31 AA approximate tandem repeats.|2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						GTCTGTGCTGTGCCCCCACCG	0.667													52	124	---	---	---	---	capture	Missense_Mutation	SNP	618758	618758	CDHR5	11	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	3092	165
CD3E	916	broad.mit.edu	37	11	118184559	118184559	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118184559C>T	uc001psq.3	+	7	746	c.490C>T	c.(490-492)CGA>TGA	p.R164*		NM_000733	NP_000724	P07766	CD3E_HUMAN	CD3E antigen, epsilon polypeptide precursor	164	Cytoplasmic (Potential).				G-protein coupled receptor protein signaling pathway|signal complex assembly|T cell costimulation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	external side of plasma membrane|integral to plasma membrane	protein heterodimerization activity|protein kinase binding|receptor signaling complex scaffold activity|receptor signaling protein activity|SH3 domain binding|T cell receptor binding|transmembrane receptor activity			ovary(2)	2	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.09e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0251)	Muromonab(DB00075)	GCCTGTGACACGAGGAGCGGG	0.597													16	47	---	---	---	---	capture	Nonsense_Mutation	SNP	118184559	118184559	CD3E	11	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	2982	165
WNT10B	7480	broad.mit.edu	37	12	49361974	49361974	+	Silent	SNP	G	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49361974G>T	uc001rss.2	-	4	812	c.466C>A	c.(466-468)CGG>AGG	p.R156R	WNT10B_uc001rst.2_Silent_p.R156R	NM_003394	NP_003385	O00744	WN10B_HUMAN	wingless-type MMTV integration site family,	156					axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity	p.R156Q(1)		skin(4)|lung(3)	7						GCCCTCAGCCGATCCTGCTCA	0.532													11	42	---	---	---	---	capture	Silent	SNP	49361974	49361974	WNT10B	12	G	T	T	T	1	0	0	0	0	0	0	0	1	480	37	4	4	17264	165
EP400	57634	broad.mit.edu	37	12	132471269	132471269	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132471269C>A	uc001ujn.2	+	5	2175	c.2140C>A	c.(2140-2142)CCC>ACC	p.P714T	EP400_uc001ujl.2_Missense_Mutation_p.P713T|EP400_uc001ujm.2_Missense_Mutation_p.P714T|EP400_uc001ujj.1_Missense_Mutation_p.P677T|EP400_uc001ujk.2_Missense_Mutation_p.P750T	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	750					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GGCATCTGCCCCCACCAAACC	0.532													43	201	---	---	---	---	capture	Missense_Mutation	SNP	132471269	132471269	EP400	12	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	5104	165
KIAA0317	9870	broad.mit.edu	37	14	75149998	75149998	+	Splice_Site	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75149998C>T	uc001xqb.2	-	5	986	c.481_splice	c.e5+1	p.G161_splice	KIAA0317_uc010tut.1_Splice_Site|KIAA0317_uc001xqc.2_Splice_Site_p.G161_splice	NM_001039479	NP_001034568	O15033	K0317_HUMAN	hypothetical protein LOC9870						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)		aaagaaCCTACCAGGTTGAAA	0.239													25	30	---	---	---	---	capture	Splice_Site	SNP	75149998	75149998	KIAA0317	14	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	8089	165
PGP	283871	broad.mit.edu	37	16	2263929	2263929	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2263929C>A	uc002cpk.1	-	2	810	c.766G>T	c.(766-768)GTC>TTC	p.V256F	C16orf79_uc002cpi.1_5'Flank|C16orf79_uc010bsh.2_5'Flank|PGP_uc010uvz.1_RNA	NM_001042371	NP_001035830	A6NDG6	PGP_HUMAN	phosphoglycolate phosphatase	256					carbohydrate metabolic process		phosphoglycolate phosphatase activity			skin(1)	1						CCCACCATGACGGTGCGCTCG	0.632													4	205	---	---	---	---	capture	Missense_Mutation	SNP	2263929	2263929	PGP	16	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	11705	165
CDH5	1003	broad.mit.edu	37	16	66426078	66426078	+	Missense_Mutation	SNP	G	A	A	rs147523967		TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66426078G>A	uc002eom.3	+	7	1165	c.1009G>A	c.(1009-1011)GTC>ATC	p.V337I	CDH5_uc002eon.1_Missense_Mutation_p.V337I	NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	337	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		CAGCTTCATCGTCGAGGCCAC	0.433													69	171	---	---	---	---	capture	Missense_Mutation	SNP	66426078	66426078	CDH5	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3084	165
PMFBP1	83449	broad.mit.edu	37	16	72153835	72153835	+	Silent	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72153835G>A	uc002fcc.3	-	20	3109	c.2937C>T	c.(2935-2937)TGC>TGT	p.C979C	PMFBP1_uc002fcd.2_Silent_p.C974C|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Silent_p.C849C	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	979										ovary(2)	2		Ovarian(137;0.179)				CCAAGGTGCCGCACACTTTCT	0.557													4	99	---	---	---	---	capture	Silent	SNP	72153835	72153835	PMFBP1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	12037	165
KARS	3735	broad.mit.edu	37	16	75669879	75669879	+	Silent	SNP	C	T	T	rs143003475		TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75669879C>T	uc002feq.2	-	5	648	c.600G>A	c.(598-600)CCG>CCA	p.P200P	KARS_uc002fer.2_Silent_p.P228P|KARS_uc002fes.2_Silent_p.P44P|KARS_uc010cgz.2_Silent_p.P44P	NM_005548	NP_005539	Q15046	SYK_HUMAN	lysyl-tRNA synthetase isoform 2	200					interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding			ovary(2)	2					L-Lysine(DB00123)	TGATCTCATACGGAATGATGC	0.448													16	55	---	---	---	---	capture	Silent	SNP	75669879	75669879	KARS	16	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	7903	165
OR1G1	8390	broad.mit.edu	37	17	3030338	3030338	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3030338C>T	uc002fvc.1	-	1	508	c.508G>A	c.(508-510)GCA>ACA	p.A170T		NM_003555	NP_003546	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G,	170	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCATGGTTTGCGCAGAAGGAC	0.532													56	167	---	---	---	---	capture	Missense_Mutation	SNP	3030338	3030338	OR1G1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10861	165
TP53	7157	broad.mit.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577568C>T	uc002gim.2	-	7	907	c.713G>A	c.(712-714)TGT>TAT	p.C238Y	TP53_uc002gig.1_Missense_Mutation_p.C238Y|TP53_uc002gih.2_Missense_Mutation_p.C238Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C106Y|TP53_uc010cng.1_Missense_Mutation_p.C106Y|TP53_uc002gii.1_Missense_Mutation_p.C106Y|TP53_uc010cnh.1_Missense_Mutation_p.C238Y|TP53_uc010cni.1_Missense_Mutation_p.C238Y|TP53_uc002gij.2_Missense_Mutation_p.C238Y|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C145Y|TP53_uc002gio.2_Missense_Mutation_p.C106Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	238	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C238Y(47)|p.C238F(34)|p.C238S(18)|p.C238R(14)|p.0?(7)|p.C238*(4)|p.C238W(2)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.C238fs*9(1)|p.M237_N239delMCN(1)|p.C238fs*21(1)|p.C238del(1)|p.C238G(1)|p.C238C(1)|p.M237fs*1(1)|p.C145F(1)|p.H233fs*6(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.M237_C238insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGAACTGTTACACATGTAGTT	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			19	50	---	---	---	---	capture	Missense_Mutation	SNP	7577568	7577568	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16264	165
TP53	7157	broad.mit.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578235T>C	uc002gim.2	-	6	808	c.614A>G	c.(613-615)TAT>TGT	p.Y205C	TP53_uc002gig.1_Missense_Mutation_p.Y205C|TP53_uc002gih.2_Missense_Mutation_p.Y205C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y73C|TP53_uc010cng.1_Missense_Mutation_p.Y73C|TP53_uc002gii.1_Missense_Mutation_p.Y73C|TP53_uc010cnh.1_Missense_Mutation_p.Y205C|TP53_uc010cni.1_Missense_Mutation_p.Y205C|TP53_uc002gij.2_Missense_Mutation_p.Y205C|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y112C|TP53_uc002gio.2_Missense_Mutation_p.Y73C|TP53_uc010vug.1_Missense_Mutation_p.Y166C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	205	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> N (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> C (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y205C(55)|p.Y205D(13)|p.Y205S(11)|p.Y205F(8)|p.0?(7)|p.Y205H(5)|p.Y205*(4)|p.Y205N(2)|p.K164_P219del(1)|p.Y205fs*42(1)|p.Y112C(1)|p.Y205fs*43(1)|p.E204fs*39(1)|p.Y73C(1)|p.E204_N210delEYLDDRN(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTCATCCAAATACTCCACACG	0.542		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			27	62	---	---	---	---	capture	Missense_Mutation	SNP	7578235	7578235	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	16264	165
MYH2	4620	broad.mit.edu	37	17	10432765	10432765	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10432765G>A	uc010coi.2	-	25	3279	c.3151C>T	c.(3151-3153)CGC>TGC	p.R1051C	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1051C|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1051	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						AGGTCCATGCGAAGTTTCTTT	0.383													45	95	---	---	---	---	capture	Missense_Mutation	SNP	10432765	10432765	MYH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9945	165
MUC16	94025	broad.mit.edu	37	19	9068025	9068025	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9068025T>C	uc002mkp.2	-	3	19625	c.19421A>G	c.(19420-19422)CAC>CGC	p.H6474R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6476	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CATAGCTGAGTGGGTCCCTGC	0.488													27	157	---	---	---	---	capture	Missense_Mutation	SNP	9068025	9068025	MUC16	19	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	9883	165
LDLR	3949	broad.mit.edu	37	19	11224247	11224247	+	Silent	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11224247T>C	uc002mqk.3	+	10	1563	c.1395T>C	c.(1393-1395)TAT>TAC	p.Y465Y	LDLR_uc010xlk.1_Silent_p.Y465Y|LDLR_uc010xll.1_Silent_p.Y424Y|LDLR_uc010xlm.1_Silent_p.Y318Y|LDLR_uc010xln.1_Silent_p.Y338Y|LDLR_uc010xlo.1_Silent_p.Y297Y	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	465	LDL-receptor class B 2.|Extracellular (Potential).				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	TCTCTTCCTATGACACCGTCA	0.622													22	63	---	---	---	---	capture	Silent	SNP	11224247	11224247	LDLR	19	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	8624	165
PRPF31	26121	broad.mit.edu	37	19	54621969	54621969	+	Missense_Mutation	SNP	T	C	C	rs145505952	byFrequency	TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54621969T>C	uc002qdh.2	+	3	590	c.194T>C	c.(193-195)ATG>ACG	p.M65T	TFPT_uc010yej.1_5'Flank|TFPT_uc010erd.2_5'Flank|PRPF31_uc010yek.1_Missense_Mutation_p.M65T	NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog	65					assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAGATTATGATGAAGATTGAG	0.502													85	185	---	---	---	---	capture	Missense_Mutation	SNP	54621969	54621969	PRPF31	19	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	12462	165
TGFA	7039	broad.mit.edu	37	2	70742029	70742029	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70742029G>A	uc002sgs.3	-	2	262	c.56C>T	c.(55-57)GCG>GTG	p.A19V	TGFA_uc010fdq.2_Missense_Mutation_p.A25V|TGFA_uc010fdr.2_Missense_Mutation_p.A25V|TGFA_uc002sgt.3_Missense_Mutation_p.A19V|TGFA_uc002sgu.2_Missense_Mutation_p.A19V|TGFA_uc002sgv.2_Missense_Mutation_p.A19V|TGFA_uc002sgw.2_Missense_Mutation_p.A19V	NM_003236	NP_003227	P01135	TGFA_HUMAN	transforming growth factor, alpha isoform 1	19					activation of MAPK activity|cell proliferation|positive regulation of cell division|positive regulation of epidermal growth factor receptor activity|positive regulation of epithelial cell proliferation|positive regulation of mitosis	cell surface|extracellular space|integral to membrane|plasma membrane	epidermal growth factor receptor binding|growth factor activity|MAP kinase kinase activity|signal transducer activity			prostate(1)	1						GGCCTGGCACGCAGCCAACAC	0.597													6	15	---	---	---	---	capture	Missense_Mutation	SNP	70742029	70742029	TGFA	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15700	165
THNSL2	55258	broad.mit.edu	37	2	88472749	88472749	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:88472749G>A	uc002ssz.3	+	2	233	c.80G>A	c.(79-81)GGG>GAG	p.G27E	THNSL2_uc002ssv.2_Intron|THNSL2_uc002ssw.3_Missense_Mutation_p.G27E|THNSL2_uc002ssx.3_Intron|THNSL2_uc002sta.3_Intron|THNSL2_uc002ssy.3_Missense_Mutation_p.G27E	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2	27					threonine biosynthetic process		threonine synthase activity			ovary(1)	1						GCACCTGACGGGGGCCTCTTT	0.607													29	123	---	---	---	---	capture	Missense_Mutation	SNP	88472749	88472749	THNSL2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15748	165
YSK4	80122	broad.mit.edu	37	2	135745654	135745654	+	Missense_Mutation	SNP	T	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135745654T>G	uc002tue.1	-	7	819	c.788A>C	c.(787-789)GAG>GCG	p.E263A	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Missense_Mutation_p.E150A|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_5'UTR|YSK4_uc002tui.3_Missense_Mutation_p.E280A	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	263							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCCCGGAGGCTCGTTTGATGG	0.443													23	92	---	---	---	---	capture	Missense_Mutation	SNP	135745654	135745654	YSK4	2	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	17376	165
ARHGAP15	55843	broad.mit.edu	37	2	143913090	143913090	+	Missense_Mutation	SNP	G	A	A	rs140767178		TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:143913090G>A	uc002tvm.3	+	2	182	c.31G>A	c.(31-33)GTG>ATG	p.V11M	ARHGAP15_uc010zbl.1_Missense_Mutation_p.V11M	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	11					regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)		TGATACTTCCGTGGAAACACT	0.363													12	51	---	---	---	---	capture	Missense_Mutation	SNP	143913090	143913090	ARHGAP15	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	859	165
SCN7A	6332	broad.mit.edu	37	2	167262458	167262458	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167262458C>A	uc002udu.1	-	25	4808	c.4681G>T	c.(4681-4683)GCT>TCT	p.A1561S		NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	1561					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						AGGTCCAAAGCAATGAGCTGG	0.453													39	125	---	---	---	---	capture	Missense_Mutation	SNP	167262458	167262458	SCN7A	2	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	13816	165
INPP5D	3635	broad.mit.edu	37	2	234106832	234106832	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234106832G>A	uc010zmo.1	+	24	2938	c.2785G>A	c.(2785-2787)GTG>ATG	p.V929M	INPP5D_uc010zmp.1_Missense_Mutation_p.V928M	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a	929	Pro-rich.				apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		GCCCCTGCACGTGAAGCAGAC	0.647													4	44	---	---	---	---	capture	Missense_Mutation	SNP	234106832	234106832	INPP5D	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7679	165
UGT1A1	54658	broad.mit.edu	37	2	234669017	234669017	+	Silent	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234669017G>A	uc002vvb.2	+	1	99	c.84G>A	c.(82-84)GGG>GGA	p.G28G	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_Intron|UGT1A1_uc010znc.1_Silent_p.G28G	NM_000463	NP_000454	P22309	UD11_HUMAN	UDP glycosyltransferase 1 family, polypeptide A1	28					bilirubin conjugation|digestion|estrogen metabolic process|flavone metabolic process|heme catabolic process	endoplasmic reticulum membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding|steroid binding			central_nervous_system(1)|skin(1)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Adenine(DB00173)|Diclofenac(DB00586)|Estradiol(DB00783)|Ezetimibe(DB00973)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Rifampin(DB01045)|Troglitazone(DB00197)	CCCATGCTGGGAAGATACTGT	0.617													7	25	---	---	---	---	capture	Silent	SNP	234669017	234669017	UGT1A1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	16826	165
PPP1R7	5510	broad.mit.edu	37	2	242105797	242105797	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242105797C>G	uc002wat.1	+	8	775	c.760C>G	c.(760-762)CTG>GTG	p.L254V	PPP1R7_uc010fzm.1_Missense_Mutation_p.L238V|PPP1R7_uc002war.2_Missense_Mutation_p.L248V|PPP1R7_uc002was.2_Missense_Mutation_p.L254V|PPP1R7_uc002wau.1_Missense_Mutation_p.L211V|PPP1R7_uc002wav.1_Missense_Mutation_p.L180V	NM_002712	NP_002703	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	254	LRR 9.					cytoplasm|nucleus	protein binding|protein phosphatase type 1 regulator activity			ovary(3)	3		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		CCTGGTGAACCTGCGGGAGCT	0.552													15	28	---	---	---	---	capture	Missense_Mutation	SNP	242105797	242105797	PPP1R7	2	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	12277	165
C20orf72	92667	broad.mit.edu	37	20	17950509	17950509	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:17950509A>G	uc002wqh.2	+	2	89	c.7A>G	c.(7-9)ATG>GTG	p.M3V	C20orf72_uc010gco.2_RNA|C20orf72_uc010gcp.2_5'Flank|SNX5_uc002wqc.2_5'Flank|SNX5_uc002wqd.2_5'Flank|SNX5_uc002wqe.2_5'Flank|SNX5_uc010zrt.1_5'Flank|SNX5_uc010gcn.1_5'Flank	NM_052865	NP_443097	Q9BQP7	CT072_HUMAN	hypothetical protein LOC92667	3											0						CTGAATGAAGATGAAGTTATT	0.408													31	82	---	---	---	---	capture	Missense_Mutation	SNP	17950509	17950509	C20orf72	20	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	2099	165
WFDC8	90199	broad.mit.edu	37	20	44184401	44184401	+	Silent	SNP	G	A	A	rs150100809	byFrequency;by1000genomes	TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44184401G>A	uc002xow.2	-	4	463	c.384C>T	c.(382-384)TGC>TGT	p.C128C	WFDC8_uc002xox.2_Silent_p.C128C	NM_181510	NP_852611	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8 precursor	128	BPTI/Kunitz inhibitor.					extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				CATTCCCTTCGCAGCCCCTGT	0.468													42	110	---	---	---	---	capture	Silent	SNP	44184401	44184401	WFDC8	20	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	17237	165
MC3R	4159	broad.mit.edu	37	20	54824279	54824279	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54824279C>T	uc002xxb.2	+	1	492	c.380C>T	c.(379-381)TCC>TTC	p.S127F		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	164	Helical; Name=3; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			ATCTGCATCTCCCTGGTGGCC	0.557													47	99	---	---	---	---	capture	Missense_Mutation	SNP	54824279	54824279	MC3R	20	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	9278	165
KRTAP24-1	643803	broad.mit.edu	37	21	31654689	31654689	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31654689C>T	uc002ynv.2	-	1	588	c.562G>A	c.(562-564)GTC>ATC	p.V188I		NM_001085455	NP_001078924	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	188						keratin filament	structural molecule activity				0						AATGGTGAGACGTAGCTGGGT	0.418													45	135	---	---	---	---	capture	Missense_Mutation	SNP	31654689	31654689	KRTAP24-1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8462	165
PRDM15	63977	broad.mit.edu	37	21	43281674	43281674	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43281674G>A	uc002yzq.1	-	7	1000	c.889C>T	c.(889-891)CCG>TCG	p.P297S	PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	297					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTGCGCACCGGCATGTCCTTC	0.463													4	155	---	---	---	---	capture	Missense_Mutation	SNP	43281674	43281674	PRDM15	21	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12352	165
COL6A2	1292	broad.mit.edu	37	21	47546138	47546138	+	Silent	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47546138C>T	uc002zia.1	+	26	2491	c.2409C>T	c.(2407-2409)GAC>GAT	p.D803D	COL6A2_uc002zhy.1_Silent_p.D803D|COL6A2_uc002zhz.1_Silent_p.D803D|COL6A2_uc002zib.1_Silent_p.D209D|COL6A2_uc002zic.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	803	VWFA 2.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		ACATGGAGGACGTCCTCTGCC	0.647													86	167	---	---	---	---	capture	Silent	SNP	47546138	47546138	COL6A2	21	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3665	165
RIMBP3	85376	broad.mit.edu	37	22	20458331	20458331	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20458331C>G	uc002zsd.3	-	1	3456	c.2971G>C	c.(2971-2973)GTG>CTG	p.V991L		NM_015672	NP_056487			RIMS binding protein 3												0	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			ATACGGAGCACCCCTTTGGTC	0.602													5	6	---	---	---	---	capture	Missense_Mutation	SNP	20458331	20458331	RIMBP3	22	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	13256	165
PISD	23761	broad.mit.edu	37	22	32017352	32017352	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32017352C>T	uc003alm.3	-	5	672	c.665G>A	c.(664-666)CGT>CAT	p.R222H	PISD_uc003alk.2_Missense_Mutation_p.R188H|PISD_uc003all.2_Missense_Mutation_p.R187H|PISD_uc011alr.1_Missense_Mutation_p.R187H|PISD_uc003aln.3_Missense_Mutation_p.R222H	NM_014338	NP_055153	Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase	222					phospholipid biosynthetic process	mitochondrion	phosphatidylserine decarboxylase activity			central_nervous_system(2)|ovary(1)	3					Phosphatidylserine(DB00144)	TGTGCACATACGCGGGCCCAG	0.627											OREG0003530	type=REGULATORY REGION|Gene=PISD|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	48	73	---	---	---	---	capture	Missense_Mutation	SNP	32017352	32017352	PISD	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11849	165
CAND2	23066	broad.mit.edu	37	3	12856870	12856870	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12856870T>A	uc003bxk.2	+	8	1286	c.1237T>A	c.(1237-1239)TGG>AGG	p.W413R	CAND2_uc003bxj.2_Missense_Mutation_p.W320R	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	413					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4						CCCGAAGGGATGGCTGGAGGC	0.607													19	36	---	---	---	---	capture	Missense_Mutation	SNP	12856870	12856870	CAND2	3	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	2592	165
LRIG1	26018	broad.mit.edu	37	3	66455660	66455660	+	Silent	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:66455660C>T	uc003dmx.2	-	9	1136	c.1122G>A	c.(1120-1122)ACG>ACA	p.T374T	LRIG1_uc011bfu.1_5'Flank|LRIG1_uc003dmw.2_Silent_p.T40T|LRIG1_uc010hnz.2_Silent_p.T114T|LRIG1_uc010hoa.2_Silent_p.T374T	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	374	Extracellular (Potential).|LRR 13.					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		AGGCGCCGCTCGTGTCCTCTA	0.612													13	21	---	---	---	---	capture	Silent	SNP	66455660	66455660	LRIG1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	8860	165
GPR15	2838	broad.mit.edu	37	3	98251885	98251885	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98251885C>G	uc011bgy.1	+	1	1008	c.1008C>G	c.(1006-1008)CAC>CAG	p.H336Q		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	336	Cytoplasmic (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		CAGATAGTCACCTCACTAAGG	0.483													39	105	---	---	---	---	capture	Missense_Mutation	SNP	98251885	98251885	GPR15	3	C	G	G	G	1	0	0	0	0	1	0	0	0	233	18	4	4	6589	165
PDLIM5	10611	broad.mit.edu	37	4	95575673	95575673	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:95575673G>A	uc003hti.2	+	10	1497	c.1346G>A	c.(1345-1347)TGC>TAC	p.C449Y	PDLIM5_uc011cdx.1_Missense_Mutation_p.C346Y|PDLIM5_uc003hth.2_Missense_Mutation_p.C340Y|PDLIM5_uc003htj.2_Missense_Mutation_p.C124Y|PDLIM5_uc003htk.2_Missense_Mutation_p.C478Y|PDLIM5_uc011cdy.1_Missense_Mutation_p.C327Y|PDLIM5_uc003htl.2_Missense_Mutation_p.C124Y	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	449	LIM zinc-binding 1.				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TGCGCTCACTGCAAAAATACA	0.448													4	170	---	---	---	---	capture	Missense_Mutation	SNP	95575673	95575673	PDLIM5	4	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	11586	165
ODZ3	55714	broad.mit.edu	37	4	183710311	183710311	+	Silent	SNP	C	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183710311C>T	uc003ivd.1	+	24	5407	c.5370C>T	c.(5368-5370)GAC>GAT	p.D1790D		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1790	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		AGATCTATGACGACCACCGTA	0.448													8	17	---	---	---	---	capture	Silent	SNP	183710311	183710311	ODZ3	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10741	165
SLC12A7	10723	broad.mit.edu	37	5	1085433	1085433	+	Silent	SNP	C	T	T	rs112522540		TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1085433C>T	uc003jbu.2	-	7	897	c.831G>A	c.(829-831)GCG>GCA	p.A277A		NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride	277	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GGAAGACCAGCGCCAGCTTGT	0.637													14	28	---	---	---	---	capture	Silent	SNP	1085433	1085433	SLC12A7	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14281	165
JMY	133746	broad.mit.edu	37	5	78533329	78533329	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:78533329T>C	uc003kfx.3	+	1	1376	c.856T>C	c.(856-858)TGT>CGT	p.C286R		NM_152405	NP_689618	Q8N9B5	JMY_HUMAN	junction-mediating and regulatory protein	286					'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity				0		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		CGACACTCTGTGTTACCAGCT	0.632													58	138	---	---	---	---	capture	Missense_Mutation	SNP	78533329	78533329	JMY	5	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	7880	165
MED7	9443	broad.mit.edu	37	5	156566183	156566183	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156566183A>G	uc010jik.2	-	2	652	c.260T>C	c.(259-261)ATT>ACT	p.I87T	MED7_uc003lwm.3_Missense_Mutation_p.I87T	NM_001100816	NP_001094286	O43513	MED7_HUMAN	mediator complex subunit 7	87					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	protein binding|transcription coactivator activity				0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CAAGAAATTAATAAGGATAGA	0.378													40	89	---	---	---	---	capture	Missense_Mutation	SNP	156566183	156566183	MED7	5	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9365	165
HSP90AB1	3326	broad.mit.edu	37	6	44217828	44217828	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44217828G>C	uc003oxa.1	+	5	669	c.585G>C	c.(583-585)GAG>GAC	p.E195D	HSP90AB1_uc011dvr.1_Missense_Mutation_p.E185D|HSP90AB1_uc003oxb.1_Missense_Mutation_p.E195D|HSP90AB1_uc011dvs.1_Missense_Mutation_p.E15D|HSP90AB1_uc003oxc.1_5'UTR	NM_007355	NP_031381	P08238	HS90B_HUMAN	heat shock 90kDa protein 1, beta	195					axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding			lung(3)|breast(1)	4	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACCTAGAAGAGAGGCGGGTCA	0.428													43	104	---	---	---	---	capture	Missense_Mutation	SNP	44217828	44217828	HSP90AB1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	7327	165
GSTA4	2941	broad.mit.edu	37	6	52850376	52850376	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52850376G>A	uc003pbc.2	-	3	209	c.145C>T	c.(145-147)CAC>TAC	p.H49Y	GSTA4_uc003pbd.2_5'UTR|GSTA4_uc003pbe.2_Intron|GSTA4_uc003pbf.2_Missense_Mutation_p.H49Y	NM_001512	NP_001503	O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	49	GST N-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity				0	Lung NSC(77;0.103)				Glutathione(DB00143)	AACAGCAGGTGGTTACCTGAG	0.458													45	114	---	---	---	---	capture	Missense_Mutation	SNP	52850376	52850376	GSTA4	6	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	6765	165
PHF3	23469	broad.mit.edu	37	6	64416078	64416078	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:64416078A>T	uc003pep.1	+	11	3553	c.3527A>T	c.(3526-3528)CAG>CTG	p.Q1176L	PHF3_uc010kah.1_Missense_Mutation_p.Q990L|PHF3_uc003pen.2_Missense_Mutation_p.Q1088L|PHF3_uc011dxs.1_Missense_Mutation_p.Q445L	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	1176					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GAGGAGAAACAGGAGTCTCCA	0.378													32	71	---	---	---	---	capture	Missense_Mutation	SNP	64416078	64416078	PHF3	6	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	11739	165
EZR	7430	broad.mit.edu	37	6	159210403	159210403	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159210403T>C	uc003qrt.3	-	2	228	c.13A>G	c.(13-15)ATC>GTC	p.I5V	EZR_uc011efs.1_Missense_Mutation_p.I5V|EZR_uc003qru.3_Missense_Mutation_p.I5V	NM_003379	NP_003370	P15311	EZRI_HUMAN	ezrin	5	FERM.				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		CGGACATTGATCTGAAAAACA	0.428													23	71	---	---	---	---	capture	Missense_Mutation	SNP	159210403	159210403	EZR	6	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	5289	165
MLLT4	4301	broad.mit.edu	37	6	168343837	168343837	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:168343837A>G	uc003qwd.2	+	23	3246	c.3104A>G	c.(3103-3105)TAT>TGT	p.Y1035C	MLLT4_uc003qwb.1_Missense_Mutation_p.Y1020C|MLLT4_uc003qwc.1_Missense_Mutation_p.Y1036C|MLLT4_uc003qwg.1_Missense_Mutation_p.Y345C	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1036	PDZ.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CTAGGAATCTATGTGAAGTCG	0.373			T	MLL	AL								34	73	---	---	---	---	capture	Missense_Mutation	SNP	168343837	168343837	MLLT4	6	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	9541	165
CYP3A5	1577	broad.mit.edu	37	7	99277452	99277452	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99277452T>C	uc003urq.2	-	1	155	c.68A>G	c.(67-69)TAT>TGT	p.Y23C	ZNF498_uc003urn.2_Intron|CYP3A5_uc003urr.2_5'UTR|CYP3A5_uc011kiy.1_5'UTR|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron|CYP3A5_uc003urt.2_Missense_Mutation_p.Y23C	NM_000777	NP_000768	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A,	23					alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)	TACTCACAGATAGAGGAGCAC	0.488													4	138	---	---	---	---	capture	Missense_Mutation	SNP	99277452	99277452	CYP3A5	7	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	4140	165
DOCK5	80005	broad.mit.edu	37	8	25232155	25232155	+	Silent	SNP	C	T	T	rs138488512		TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25232155C>T	uc003xeg.2	+	37	3938	c.3801C>T	c.(3799-3801)CAC>CAT	p.H1267H	DOCK5_uc003xeh.1_Silent_p.H981H|PPP2R2A_uc003xek.2_Silent_p.H56H|DOCK5_uc003xei.2_Silent_p.H837H|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1267	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TTCTCTTGCACGCTGAGCTTC	0.463													77	187	---	---	---	---	capture	Silent	SNP	25232155	25232155	DOCK5	8	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4646	165
TBC1D2	55357	broad.mit.edu	37	9	101017509	101017509	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101017509G>C	uc011lvb.1	-	1	495	c.315C>G	c.(313-315)GAC>GAG	p.D105E	TBC1D2_uc004ayq.2_Missense_Mutation_p.D105E|TBC1D2_uc004ayr.2_5'UTR|TBC1D2_uc004ayo.3_Missense_Mutation_p.D105E	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	105	PH.|Interaction with CADH1.					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		CCTCCTCAGCGTCCGCCTTAC	0.537													13	75	---	---	---	---	capture	Missense_Mutation	SNP	101017509	101017509	TBC1D2	9	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	15496	165
PLCXD1	55344	broad.mit.edu	37	X	215977	215977	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:215977T>C	uc004cpc.2	+	7	1259	c.947T>C	c.(946-948)CTC>CCC	p.L316P	PLCXD1_uc011mgx.1_RNA	NM_018390	NP_060860	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X	316					intracellular signal transduction|lipid metabolic process		phospholipase C activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GTCATCGCGCTCAATCAGAAG	0.602													26	69	---	---	---	---	capture	Missense_Mutation	SNP	215977	215977	PLCXD1	23	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	11944	165
WWC3	55841	broad.mit.edu	37	X	10096087	10096087	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:10096087G>A	uc004csx.3	+	16	2364	c.2166G>A	c.(2164-2166)TGG>TGA	p.W722*	WWC3_uc010nds.2_Nonsense_Mutation_p.W386*|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	722										ovary(4)	4						AGCTGCGCTGGCATTCCGTGC	0.562													4	182	---	---	---	---	capture	Nonsense_Mutation	SNP	10096087	10096087	WWC3	23	G	A	A	A	1	0	0	0	0	0	1	0	0	546	42	5	2	17294	165
PDHA1	5160	broad.mit.edu	37	X	19369427	19369427	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:19369427G>A	uc004czg.3	+	4	465	c.320G>A	c.(319-321)GGC>GAC	p.G107D	PDHA1_uc004czh.3_Missense_Mutation_p.G142D|PDHA1_uc011mjc.1_Missense_Mutation_p.G111D|PDHA1_uc011mjd.1_Missense_Mutation_p.G104D|PDHA1_uc010nfk.2_Missense_Mutation_p.G104D	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor	107					glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	CTGGAGGCCGGCATCAACCCC	0.507													4	229	---	---	---	---	capture	Missense_Mutation	SNP	19369427	19369427	PDHA1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11567	165
CCNB3	85417	broad.mit.edu	37	X	50051674	50051674	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50051674G>A	uc004dox.3	+	6	803	c.505G>A	c.(505-507)GAA>AAA	p.E169K	CCNB3_uc004doy.2_Missense_Mutation_p.E169K|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	169					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					TATTGAGGATGAAACCCTTAT	0.433													4	201	---	---	---	---	capture	Missense_Mutation	SNP	50051674	50051674	CCNB3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	2885	165
TBX22	50945	broad.mit.edu	37	X	79281244	79281244	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:79281244C>G	uc010nmg.1	+	5	735	c.601C>G	c.(601-603)CTC>GTC	p.L201V	TBX22_uc004edi.1_Missense_Mutation_p.L81V|TBX22_uc004edj.1_Missense_Mutation_p.L201V	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	201	T-box.				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	p.L201I(1)		lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						TCGCATGAAACTCACCAACAA	0.537													12	44	---	---	---	---	capture	Missense_Mutation	SNP	79281244	79281244	TBX22	23	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	15545	165
ATP11C	286410	broad.mit.edu	37	X	138897124	138897124	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138897124T>A	uc004faz.2	-	5	447	c.348A>T	c.(346-348)AGA>AGT	p.R116S	ATP11C_uc004fba.2_Missense_Mutation_p.R116S	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	116	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					CAGCTCTGTGTCTCAGACAAT	0.303													30	73	---	---	---	---	capture	Missense_Mutation	SNP	138897124	138897124	ATP11C	23	T	A	A	A	1	0	0	0	0	1	0	0	0	751	58	4	4	1112	165
CLCA1	1179	broad.mit.edu	37	1	86951220	86951220	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86951220delC	uc001dlt.2	+	6	1059	c.930delC	c.(928-930)GTCfs	p.V310fs	CLCA1_uc001dls.1_Frame_Shift_Del_p.V249fs	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	310	VWFA.				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TGTGTTTAGTCCTTGACAAAT	0.448													54	227	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	86951220	86951220	CLCA1	1	C	-	-	-	1	0	1	0	1	0	0	0	0	379	30	5	5	3422	165
ABCC9	10060	broad.mit.edu	37	12	22065805	22065805	+	Splice_Site	DEL	C	-	-			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:22065805delC	uc001rfi.1	-	6	1031	c.1011_splice	c.e6+1	p.G337_splice	ABCC9_uc001rfh.2_Splice_Site_p.G337_splice|ABCC9_uc001rfj.1_Splice_Site_p.G337_splice	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CAGGAACTTACTCCAGTTGTG	0.353													20	69	---	---	---	---	capture_indel	Splice_Site	DEL	22065805	22065805	ABCC9	12	C	-	-	-	1	0	1	0	1	0	0	1	0	260	20	5	5	59	165
RB1	5925	broad.mit.edu	37	13	48919325	48919332	+	Frame_Shift_Del	DEL	AAATTGGA	-	-	rs66624868		TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48919325_48919332delAAATTGGA	uc001vcb.2	+	4	656_663	c.490_497delAAATTGGA	c.(490-498)AAATTGGAAfs	p.K164fs	RB1_uc010acs.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	164_166					androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(5)|p.E166*(1)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ACTCTTCAGCAAATTGGAAAGGTAAAGT	0.284		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			8	69	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	48919325	48919332	RB1	13	AAATTGGA	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	12993	165
EGR1	1958	broad.mit.edu	37	5	137801566	137801568	+	In_Frame_Del	DEL	TGC	-	-			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137801566_137801568delTGC	uc003ldb.1	+	1	386_388	c.116_118delTGC	c.(115-120)ATGCTG>ATG	p.L41del	EGR1_uc011cyu.1_In_Frame_Del_p.L41del	NM_001964	NP_001955	P18146	EGR1_HUMAN	early growth response 1	41					cellular response to heparin|cellular response to mycophenolic acid|glomerular mesangial cell proliferation|interleukin-1-mediated signaling pathway|positive regulation of glomerular metanephric mesangial cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of protein sumoylation|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytoplasm|nucleus	histone acetyltransferase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GAGGAGATGATGCTGCTGAGCAA	0.488													25	89	---	---	---	---	capture_indel	In_Frame_Del	DEL	137801566	137801568	EGR1	5	TGC	-	-	-	1	0	1	0	1	0	0	0	0	663	51	5	5	4926	165
SQSTM1	8878	broad.mit.edu	37	5	179260112	179260114	+	In_Frame_Del	DEL	GAG	-	-			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179260112_179260114delGAG	uc003mkw.3	+	6	930_932	c.835_837delGAG	c.(835-837)GAGdel	p.E280del	SQSTM1_uc011dgr.1_In_Frame_Del_p.E196del|SQSTM1_uc011dgs.1_In_Frame_Del_p.E196del|SQSTM1_uc003mkv.3_In_Frame_Del_p.E280del|SQSTM1_uc003mkx.2_In_Frame_Del_p.E196del	NM_003900	NP_003891	Q13501	SQSTM_HUMAN	sequestosome 1 isoform 1	280	Interaction with NTRK1 (By similarity).|Ser-rich.				anti-apoptosis|apoptosis|cell differentiation|endosome transport|induction of apoptosis by extracellular signals|intracellular signal transduction|macroautophagy|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein localization|regulation of I-kappaB kinase/NF-kappaB cascade|ubiquitin-dependent protein catabolic process	cytosol|late endosome|nucleoplasm	protein kinase C binding|receptor tyrosine kinase binding|SH2 domain binding|ubiquitin binding|zinc ion binding		SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCCAGCACAGAGGAGAAGAGCA	0.596									Paget_Disease_of_Bone				18	84	---	---	---	---	capture_indel	In_Frame_Del	DEL	179260112	179260114	SQSTM1	5	GAG	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	15022	165
EGFR	1956	broad.mit.edu	37	7	55249002	55249003	+	In_Frame_Ins	INS	-	CAGCGTGGA	CAGCGTGGA			TCGA-19-2625-01	TCGA-19-2625-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55249002_55249003insCAGCGTGGA	uc003tqk.2	+	20	2546_2547	c.2300_2301insCAGCGTGGA	c.(2299-2301)GCC>GCCAGCGTGGAC	p.770_771insSVD	EGFR_uc010kzg.1_In_Frame_Ins_p.725_726insSVD|EGFR_uc011kco.1_In_Frame_Ins_p.717_718insSVD|uc003tqo.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	770_771	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.D770_N771insSVD(21)|p.V769_D770insASV(20)|p.D770_N771insG(6)|p.D770>GY(3)|p.V769_D770insMASVD(2)|p.A767V(2)|p.V769_D770insGVV(2)|p.V769_D770insCV(1)|p.D770N(1)|p.D770_N771insGD(1)|p.D770_N771>AGG(1)|p.D770_N771insGL(1)|p.D770fs*61(1)|p.D770_P772>ASVDNR(1)|p.D770_N771insD(1)|p.V769_D770insGSV(1)|p.D770_N771insN(1)|p.V769_D770insDNV(1)|p.D770_N771insAPW(1)|p.D770_N771insSVP(1)|p.D770_N771insSVQ(1)|p.D770>GF(1)|p.D770_N771insMATP(1)|p.D770_N771insDG(1)|p.D770_N771insNPH(1)|p.V769_D770insGV(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TACGTGATGGCCAGCGTGGACA	0.649		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			14	204	---	---	---	---	capture_indel	In_Frame_Ins	INS	55249002	55249003	EGFR	7	-	CAGCGTGGA	CAGCGTGGA	CAGCGTGGA	1	0	1	1	0	0	0	0	0	338	26	5	5	4922	165
