Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF11	440560	broad.mit.edu	37	1	12885059	12885059	+	Missense_Mutation	SNP	C	G	G	rs143004725	by1000genomes	TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12885059C>G	uc001auk.2	-	4	1248	c.1052G>C	c.(1051-1053)TGC>TCC	p.C351S		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	351	LRR 6.										0						GGTGGCCATGCAGATGGGATT	0.532													4	204	---	---	---	---	capture	Missense_Mutation	SNP	12885059	12885059	PRAMEF11	1	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	12328	167
SEPN1	57190	broad.mit.edu	37	1	26140414	26140414	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26140414C>A	uc010oer.1	+	14	1485	c.1430C>A	c.(1429-1431)CCC>CAC	p.P477H	SEPN1_uc010oes.1_Missense_Mutation_p.P443H	NM_020451	NP_065184	Q9NZV5	SELN_HUMAN	selenoprotein N, 1 isoform 1 precursor	477						endoplasmic reticulum membrane|extracellular region	protein binding			ovary(2)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		GAAAGTTCGCCCATCCTCACC	0.612													6	188	---	---	---	---	capture	Missense_Mutation	SNP	26140414	26140414	SEPN1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	13949	167
NTNG1	22854	broad.mit.edu	37	1	107867040	107867040	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:107867040A>G	uc001dvh.3	+	3	1101	c.383A>G	c.(382-384)AAG>AGG	p.K128R	NTNG1_uc001dvf.3_Missense_Mutation_p.K128R|NTNG1_uc010out.1_Missense_Mutation_p.K128R|NTNG1_uc001dvc.3_Missense_Mutation_p.K128R|NTNG1_uc001dvd.1_Missense_Mutation_p.K128R	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	128	Laminin N-terminal.				axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GAGTATCCCAAGCCTCTCCAG	0.478													3	177	---	---	---	---	capture	Missense_Mutation	SNP	107867040	107867040	NTNG1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	10611	167
AKNAD1	254268	broad.mit.edu	37	1	109395162	109395162	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109395162T>C	uc001dwa.2	-	2	394	c.125A>G	c.(124-126)GAA>GGA	p.E42G	AKNAD1_uc010ovb.1_Intron|AKNAD1_uc001dwb.2_RNA	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268	42										ovary(3)	3						ATTTAAGACTTCAAGGCCATC	0.408													3	202	---	---	---	---	capture	Missense_Mutation	SNP	109395162	109395162	AKNAD1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	464	167
IFI16	3428	broad.mit.edu	37	1	159015232	159015232	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159015232C>A	uc010pis.1	+	7	1486	c.1307C>A	c.(1306-1308)CCA>CAA	p.P436Q	IFI16_uc001ftg.2_Intron|IFI16_uc001fth.2_Intron|IFI16_uc010pit.1_Missense_Mutation_p.P91Q	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	492					cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					CCATCAACACCAAGCAGCAGT	0.488													75	126	---	---	---	---	capture	Missense_Mutation	SNP	159015232	159015232	IFI16	1	C	A	A	A	1	0	0	0	0	1	0	0	0	261	21	4	4	7436	167
IGSF9	57549	broad.mit.edu	37	1	159897140	159897140	+	Silent	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159897140G>A	uc001fur.2	-	21	3733	c.3535C>T	c.(3535-3537)CTG>TTG	p.L1179L	IGSF9_uc001fuq.2_Silent_p.L1163L|CCDC19_uc001ful.2_5'Flank|TAGLN2_uc001fun.1_5'Flank|TAGLN2_uc001fuo.1_5'Flank|TAGLN2_uc010piy.1_5'Flank|IGSF9_uc001fup.2_Silent_p.L325L	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	1179	PDZ-binding (By similarity).|Cytoplasmic (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GATGTTCACAGCAGAGTGGCC	0.607													4	145	---	---	---	---	capture	Silent	SNP	159897140	159897140	IGSF9	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	7529	167
FMO3	2328	broad.mit.edu	37	1	171077238	171077238	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:171077238G>A	uc001ghi.2	+	5	614	c.503G>A	c.(502-504)GGC>GAC	p.G168D	FMO3_uc001ghh.2_Missense_Mutation_p.G168D|FMO3_uc010pmb.1_Missense_Mutation_p.G148D|FMO3_uc010pmc.1_Missense_Mutation_p.G105D	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	168					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CACTTTAAAGGCAAATGCTTC	0.423													4	213	---	---	---	---	capture	Missense_Mutation	SNP	171077238	171077238	FMO3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5900	167
OR14A16	284532	broad.mit.edu	37	1	247978223	247978223	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247978223A>G	uc001idm.1	-	1	809	c.809T>C	c.(808-810)GTA>GCA	p.V270A		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	270	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CACAGAAATTACAGCATCCAA	0.413													39	45	---	---	---	---	capture	Missense_Mutation	SNP	247978223	247978223	OR14A16	1	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	10849	167
ANKRD26	22852	broad.mit.edu	37	10	27324683	27324683	+	Splice_Site	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:27324683T>C	uc001ith.2	-	24	2867	c.2695_splice	c.e24-1	p.N899_splice	ANKRD26_uc001itg.2_Splice_Site_p.N586_splice|ANKRD26_uc009xku.1_Splice_Site_p.N900_splice	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						ATGAGAATTCTAAGTAAAACA	0.313													11	6	---	---	---	---	capture	Splice_Site	SNP	27324683	27324683	ANKRD26	10	T	C	C	C	1	0	0	0	0	0	0	1	0	689	53	5	3	650	167
TLL2	7093	broad.mit.edu	37	10	98173027	98173027	+	Missense_Mutation	SNP	C	T	T	rs61743696		TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98173027C>T	uc001kml.1	-	8	1196	c.970G>A	c.(970-972)GTC>ATC	p.V324I	TLL2_uc009xvf.1_Missense_Mutation_p.V272I	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	324	Metalloprotease (By similarity).				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GTTGGCCTGACGCCATTGTCA	0.522													24	10	---	---	---	---	capture	Missense_Mutation	SNP	98173027	98173027	TLL2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15831	167
LOC729020	729020	broad.mit.edu	37	10	105005929	105005929	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105005929A>G	uc009xxi.2	+	1	286	c.176A>G	c.(175-177)AAG>AGG	p.K59R	uc001kwr.2_Intron	NM_001143909	NP_001137381	Q2QD12	Q2QD12_HUMAN	rcRPE protein	59					carbohydrate metabolic process		ribulose-phosphate 3-epimerase activity				0						AGCCTTCGAAAGCAGCTAGGC	0.498													127	44	---	---	---	---	capture	Missense_Mutation	SNP	105005929	105005929	LOC729020	10	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	8805	167
INS	3630	broad.mit.edu	37	11	2181187	2181187	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2181187G>C	uc001lvn.1	-	3	283	c.228C>G	c.(226-228)AGC>AGG	p.S76R	INS-IGF2_uc001lvi.2_Intron|INS-IGF2_uc001lvm.2_Intron|INS_uc001lvo.1_Missense_Mutation_p.S76R|INS_uc009ydg.1_Missense_Mutation_p.S64R	NM_000207	NP_000198	P01308	INS_HUMAN	proinsulin precursor	76					activation of protein kinase B activity|acute-phase response|alpha-beta T cell activation|endocrine pancreas development|energy reserve metabolic process|fatty acid homeostasis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|glucose metabolic process|glucose transport|insulin receptor signaling pathway|MAPKKK cascade|negative regulation of acute inflammatory response|negative regulation of apoptosis|negative regulation of fatty acid metabolic process|negative regulation of feeding behavior|negative regulation of gluconeogenesis|negative regulation of glycogen catabolic process|negative regulation of lipid catabolic process|negative regulation of NAD(P)H oxidase activity|negative regulation of protein catabolic process|negative regulation of protein secretion|negative regulation of proteolysis|negative regulation of respiratory burst involved in inflammatory response|negative regulation of vasodilation|positive regulation of cell differentiation|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cytokine secretion|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin receptor signaling pathway|positive regulation of lipid biosynthetic process|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein autophosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of respiratory burst|positive regulation of vasodilation|regulation of cellular amino acid metabolic process|regulation of insulin secretion|regulation of transmembrane transporter activity|wound healing	endoplasmic reticulum lumen|endosome lumen|extracellular space	hormone activity|insulin receptor binding|insulin-like growth factor receptor binding				0		Lung NSC(207;8.94e-06)|all_epithelial(84;3.17e-05)|all_lung(207;3.67e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.14)		AGGGCTGCAGGCTGCCTGCAC	0.662													2	8	---	---	---	---	capture	Missense_Mutation	SNP	2181187	2181187	INS	11	G	C	C	C	1	0	0	0	0	1	0	0	0	542	42	4	4	7685	167
CCKBR	887	broad.mit.edu	37	11	6291993	6291993	+	Silent	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6291993C>T	uc001mcp.2	+	4	964	c.771C>T	c.(769-771)AGC>AGT	p.S257S	CCKBR_uc001mcq.2_Silent_p.S185S|CCKBR_uc001mcr.2_Silent_p.S257S|CCKBR_uc001mcs.2_Silent_p.S257S|CCKBR_uc001mct.1_5'Flank	NM_176875	NP_795344	P32239	GASR_HUMAN	cholecystokinin B receptor	257	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding			lung(5)|ovary(2)|breast(1)	8		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	ACAGTGACAGCGACAGCCAAA	0.622													44	59	---	---	---	---	capture	Silent	SNP	6291993	6291993	CCKBR	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	2854	167
RAG1	5896	broad.mit.edu	37	11	36595309	36595309	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36595309C>T	uc001mwu.3	+	2	579	c.455C>T	c.(454-456)CCG>CTG	p.P152L	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	152	Interaction with importin alpha-1.				histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				ACTTCCTGGCCGGACCTCATT	0.507									Familial_Hemophagocytic_Lymphohistiocytosis				40	53	---	---	---	---	capture	Missense_Mutation	SNP	36595309	36595309	RAG1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12898	167
CREB3L1	90993	broad.mit.edu	37	11	46341859	46341859	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46341859T>C	uc001ncf.2	+	11	1738	c.1303T>C	c.(1303-1305)TGG>CGG	p.W435R	CREB3L1_uc001ncg.2_Missense_Mutation_p.W69R	NM_052854	NP_443086	Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like	435	Lumenal (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L1(6)	soft_tissue(6)|ovary(2)	8				GBM - Glioblastoma multiforme(35;0.0285)		GGCAGGCTTATGGGAAGATGG	0.652			T	FUS	myxofibrosarcoma								10	14	---	---	---	---	capture	Missense_Mutation	SNP	46341859	46341859	CREB3L1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	3821	167
OR5A1	219982	broad.mit.edu	37	11	59211096	59211096	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59211096A>T	uc001nnx.1	+	1	455	c.455A>T	c.(454-456)TAT>TTT	p.Y152F		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	152	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						GTTGGGGCATATGTTGGTGGC	0.547													221	348	---	---	---	---	capture	Missense_Mutation	SNP	59211096	59211096	OR5A1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	11043	167
CABP4	57010	broad.mit.edu	37	11	67225877	67225877	+	Silent	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67225877G>A	uc001olo.2	+	5	764	c.687G>A	c.(685-687)GCG>GCA	p.A229A	CABP4_uc001oln.2_Silent_p.A124A	NM_145200	NP_660201	P57796	CABP4_HUMAN	calcium binding protein 4	229	EF-hand 3.|2 (Potential).				visual perception	cytoplasm|extracellular region|terminal button	calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			TTACGGTGGCGGAGCTGCGGG	0.647													47	55	---	---	---	---	capture	Silent	SNP	67225877	67225877	CABP4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2509	167
APOBEC1	339	broad.mit.edu	37	12	7803627	7803627	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7803627T>C	uc001qtb.2	-	4	587	c.553A>G	c.(553-555)ATA>GTA	p.I185V	APOBEC1_uc001qtc.2_Missense_Mutation_p.I140V|APOBEC1_uc010sgf.1_Missense_Mutation_p.I185V	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	185	Leu-rich.				cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						ACTAGAATTATGCAGTGCAGC	0.433													4	234	---	---	---	---	capture	Missense_Mutation	SNP	7803627	7803627	APOBEC1	12	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	780	167
PRB1	5542	broad.mit.edu	37	12	11506566	11506566	+	Silent	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11506566C>T	uc001qzw.1	-	4	508	c.471G>A	c.(469-471)AAG>AAA	p.K157K	PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	218	9.|15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in clone CP-4).|Missing (in clone CP-5).|Missing (in allele S).			extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GTCCTTGTGGCTTTCCTGGAG	0.597													4	96	---	---	---	---	capture	Silent	SNP	11506566	11506566	PRB1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	12338	167
KRT75	9119	broad.mit.edu	37	12	52828035	52828035	+	Silent	SNP	G	A	A	rs140932366		TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52828035G>A	uc001saj.2	-	1	76	c.54C>T	c.(52-54)AGC>AGT	p.S18S		NM_004693	NP_004684	O95678	K2C75_HUMAN	keratin 75	18	Head.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.192)		CCGAGGTGGTGCTGAAGCCCC	0.672													3	23	---	---	---	---	capture	Silent	SNP	52828035	52828035	KRT75	12	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	8408	167
OR6C68	403284	broad.mit.edu	37	12	55886262	55886262	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55886262T>A	uc010spo.1	+	1	116	c.116T>A	c.(115-117)ATG>AAG	p.M39K		NM_001005519	NP_001005519	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C,	34	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ATCACCTACATGTTGAGTGTA	0.398													143	181	---	---	---	---	capture	Missense_Mutation	SNP	55886262	55886262	OR6C68	12	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	11100	167
FAM19A2	338811	broad.mit.edu	37	12	62148677	62148677	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:62148677G>A	uc001sqw.2	-	3	1748	c.235C>T	c.(235-237)CGA>TGA	p.R79*	FAM19A2_uc001sqv.2_RNA|FAM19A2_uc001sqx.2_Nonsense_Mutation_p.R79*|FAM19A2_uc001sqy.2_RNA	NM_178539	NP_848634	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine	79						cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		GGAGCAGCTCGCGTGGTGCCT	0.502													41	54	---	---	---	---	capture	Nonsense_Mutation	SNP	62148677	62148677	FAM19A2	12	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	5484	167
GRIP1	23426	broad.mit.edu	37	12	66800092	66800092	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66800092A>G	uc001stk.2	-	15	2040	c.1799T>C	c.(1798-1800)CTC>CCC	p.L600P	GRIP1_uc010sta.1_Missense_Mutation_p.L544P|GRIP1_uc001stj.2_Missense_Mutation_p.L382P|GRIP1_uc001stl.1_Missense_Mutation_p.L492P|GRIP1_uc001stm.2_Missense_Mutation_p.L600P	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	652	PDZ 5.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GCGGATTTTGAGCTTCACCAG	0.413													3	170	---	---	---	---	capture	Missense_Mutation	SNP	66800092	66800092	GRIP1	12	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	6720	167
MED13L	23389	broad.mit.edu	37	12	116446291	116446291	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:116446291C>G	uc001tvw.2	-	10	1982	c.1927G>C	c.(1927-1929)GAT>CAT	p.D643H		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	643					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		AACTCAGCATCATCACTGGGT	0.517													23	56	---	---	---	---	capture	Missense_Mutation	SNP	116446291	116446291	MED13L	12	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	9344	167
MPHOSPH9	10198	broad.mit.edu	37	12	123687854	123687854	+	Silent	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123687854G>A	uc001uel.2	-	5	914	c.807C>T	c.(805-807)AAC>AAT	p.N269N	MPHOSPH9_uc010tal.1_5'UTR|MPHOSPH9_uc010tam.1_Intron|MPHOSPH9_uc001uem.2_5'UTR	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	269					M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		GTAACTGCTTGTTTTCCCTTT	0.373													26	163	---	---	---	---	capture	Silent	SNP	123687854	123687854	MPHOSPH9	12	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	9640	167
TGM1	7051	broad.mit.edu	37	14	24730965	24730965	+	Silent	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24730965A>G	uc001wod.2	-	3	568	c.444T>C	c.(442-444)CAT>CAC	p.H148H	TGM1_uc010tog.1_Intron	NM_000359	NP_000350	P22735	TGM1_HUMAN	transglutaminase 1	148					cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GGAGGAGCATATGGAAAGGCT	0.592													80	107	---	---	---	---	capture	Silent	SNP	24730965	24730965	TGM1	14	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	15714	167
SRP54	6729	broad.mit.edu	37	14	35465958	35465958	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:35465958C>T	uc001wso.2	+	2	394	c.43C>T	c.(43-45)CGC>TGC	p.R15C	SRP54_uc010tpp.1_Translation_Start_Site|SRP54_uc010tpq.1_Intron	NM_003136	NP_003127	P61011	SRP54_HUMAN	signal recognition particle 54kDa isoform 1	15	G-domain.				GTP catabolic process|response to drug|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition|SRP-dependent cotranslational protein targeting to membrane, translocation	cytosol|nuclear speck|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|drug binding|endoplasmic reticulum signal peptide binding|GDP binding|GTP binding|nucleoside-triphosphatase activity|ribonucleoprotein binding			ovary(1)	1	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		ATCAGCATTACGCTCGTTGAG	0.343													83	126	---	---	---	---	capture	Missense_Mutation	SNP	35465958	35465958	SRP54	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15047	167
C14orf37	145407	broad.mit.edu	37	14	58471770	58471770	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:58471770C>G	uc001xdc.2	-	7	2363	c.2252G>C	c.(2251-2253)AGA>ACA	p.R751T	C14orf37_uc010tro.1_Missense_Mutation_p.R789T|C14orf37_uc001xdd.2_Missense_Mutation_p.R751T	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	751	Cytoplasmic (Potential).					integral to membrane	binding				0						CCATACCTTTCTTTTATGCCT	0.413													48	114	---	---	---	---	capture	Missense_Mutation	SNP	58471770	58471770	C14orf37	14	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	1757	167
GABRB3	2562	broad.mit.edu	37	15	26825568	26825568	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26825568G>A	uc001zaz.2	-	6	722	c.580C>T	c.(580-582)CGA>TGA	p.R194*	GABRB3_uc010uae.1_Nonsense_Mutation_p.R109*|GABRB3_uc001zba.2_Nonsense_Mutation_p.R194*|GABRB3_uc001zbb.2_Nonsense_Mutation_p.R250*	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	194	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TCCCCGCCTCGCCAGTAAAAC	0.517													4	170	---	---	---	---	capture	Nonsense_Mutation	SNP	26825568	26825568	GABRB3	15	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	6110	167
PCSK6	5046	broad.mit.edu	37	15	101924538	101924538	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101924538G>A	uc002bwy.2	-	11	1717	c.1403C>T	c.(1402-1404)GCG>GTG	p.A468V	PCSK6_uc010bpd.2_Intron|PCSK6_uc010bpe.2_Missense_Mutation_p.A468V|PCSK6_uc002bxa.2_Missense_Mutation_p.A468V|PCSK6_uc002bxb.2_Missense_Mutation_p.A468V|PCSK6_uc002bxc.1_Missense_Mutation_p.A468V|PCSK6_uc002bxd.1_Missense_Mutation_p.A468V|PCSK6_uc002bxe.2_Missense_Mutation_p.A468V|PCSK6_uc002bxg.1_Missense_Mutation_p.A468V|PCSK6_uc002bxf.1_5'Flank	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	468					glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTTATGACCCGCGCCGTTCAC	0.567													21	27	---	---	---	---	capture	Missense_Mutation	SNP	101924538	101924538	PCSK6	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11507	167
GLYR1	84656	broad.mit.edu	37	16	4863830	4863830	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4863830C>T	uc002cxx.3	-	12	1064	c.1027G>A	c.(1027-1029)GGC>AGC	p.G343S	GLYR1_uc002cxy.2_RNA|GLYR1_uc002cxz.1_Missense_Mutation_p.G257S|GLYR1_uc002cya.2_Missense_Mutation_p.G337S|GLYR1_uc010uxv.1_Missense_Mutation_p.G262S	NM_032569	NP_115958	Q49A26	GLYR1_HUMAN	cytokine-like nuclear factor n-pac	343					pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity				0						CCACTGGGGCCCAGCACCAGC	0.612													8	18	---	---	---	---	capture	Missense_Mutation	SNP	4863830	4863830	GLYR1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6419	167
ATF7IP2	80063	broad.mit.edu	37	16	10524533	10524533	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10524533C>T	uc002czu.2	+	3	283	c.56C>T	c.(55-57)CCC>CTC	p.P19L	ATF7IP2_uc002czv.2_Missense_Mutation_p.P19L|ATF7IP2_uc010uyo.1_RNA|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Missense_Mutation_p.P19L|ATF7IP2_uc010uyq.1_RNA	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting	19					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						AAGACAATGCCCCTAAGTTGC	0.383													3	124	---	---	---	---	capture	Missense_Mutation	SNP	10524533	10524533	ATF7IP2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	1079	167
UMOD	7369	broad.mit.edu	37	16	20359594	20359594	+	Silent	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20359594C>T	uc002dgz.2	-	4	1053	c.924G>A	c.(922-924)TCG>TCA	p.S308S	UMOD_uc002dha.2_Silent_p.S308S|UMOD_uc002dhb.2_Silent_p.S341S	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor	308					cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						TGCCATTATTCGATTTGCAGT	0.552													74	130	---	---	---	---	capture	Silent	SNP	20359594	20359594	UMOD	16	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	16861	167
ITGAX	3687	broad.mit.edu	37	16	31373991	31373991	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31373991C>T	uc002ebu.1	+	12	1343	c.1276C>T	c.(1276-1278)CGC>TGC	p.R426C	ITGAX_uc002ebt.2_Missense_Mutation_p.R426C|ITGAX_uc010vfk.1_Missense_Mutation_p.R76C	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	426	FG-GAP 4.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GGGGGCCCCCCGCTACCAGCA	0.657													24	33	---	---	---	---	capture	Missense_Mutation	SNP	31373991	31373991	ITGAX	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7812	167
MYO15A	51168	broad.mit.edu	37	17	18055238	18055238	+	Silent	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18055238C>T	uc010vxh.1	+	40	8204	c.7866C>T	c.(7864-7866)ACC>ACT	p.T2622T	MYO15A_uc010vxi.1_5'Flank|MYO15A_uc010vxj.1_5'Flank|MYO15A_uc010vxk.1_5'Flank	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	2622	Tail.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GGCAGATGACCCACCTGGCAG	0.602													4	3	---	---	---	---	capture	Silent	SNP	18055238	18055238	MYO15A	17	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	9973	167
LLGL1	3996	broad.mit.edu	37	17	18138556	18138556	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18138556C>G	uc002gsp.2	+	10	1275	c.1214C>G	c.(1213-1215)CCC>CGC	p.P405R		NM_004140	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1	405	WD 8.				cortical actin cytoskeleton organization|exocytosis|protein complex assembly	cortical actin cytoskeleton	protein kinase binding|structural molecule activity			breast(2)|skin(2)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)	6	all_neural(463;0.228)					GCCAGTGTCCCCGCCAAGCTG	0.672													16	20	---	---	---	---	capture	Missense_Mutation	SNP	18138556	18138556	LLGL1	17	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	8753	167
KCNJ12	3768	broad.mit.edu	37	17	21319068	21319068	+	Silent	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21319068C>T	uc002gyv.1	+	3	1119	c.414C>T	c.(412-414)ATC>ATT	p.I138I		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	138					blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TCTTCTCCATCGAGACGCAGA	0.672										Prostate(3;0.18)			4	23	---	---	---	---	capture	Silent	SNP	21319068	21319068	KCNJ12	17	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	7968	167
ACCN1	40	broad.mit.edu	37	17	31352958	31352958	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:31352958G>A	uc002hhu.2	-	5	1302	c.1028C>T	c.(1027-1029)GCA>GTA	p.A343V	ACCN1_uc002hht.2_Missense_Mutation_p.A394V	NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	343	Extracellular (By similarity).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GGCAGGCTCTGCACACTCCTT	0.532													3	77	---	---	---	---	capture	Missense_Mutation	SNP	31352958	31352958	ACCN1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	128	167
GAS2L2	246176	broad.mit.edu	37	17	34074081	34074081	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34074081G>A	uc002hjv.1	-	5	1067	c.1039C>T	c.(1039-1041)CGG>TGG	p.R347W		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	347					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTGCTCCCCGTTCCCTGCGG	0.612													38	66	---	---	---	---	capture	Missense_Mutation	SNP	34074081	34074081	GAS2L2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	6187	167
TAF15	8148	broad.mit.edu	37	17	34151174	34151174	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34151174G>T	uc002hkd.2	+	7	663	c.577G>T	c.(577-579)GAT>TAT	p.D193Y	TAF15_uc010ctw.1_RNA|TAF15_uc002hkc.2_Missense_Mutation_p.D190Y	NM_139215	NP_631961	Q92804	RBP56_HUMAN	TBP-associated factor 15 isoform 1	193	Gln/Gly/Ser/Tyr-rich.				positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		ATATGACAAGGATGGAAGAGG	0.428			T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								47	110	---	---	---	---	capture	Missense_Mutation	SNP	34151174	34151174	TAF15	17	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	15406	167
KCNH6	81033	broad.mit.edu	37	17	61607575	61607575	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61607575T>C	uc002jay.2	+	3	511	c.431T>C	c.(430-432)TTG>TCG	p.L144S	KCNH6_uc002jax.1_Missense_Mutation_p.L144S|KCNH6_uc010wpl.1_Missense_Mutation_p.L21S|KCNH6_uc010wpm.1_Missense_Mutation_p.L144S|KCNH6_uc002jaz.1_Missense_Mutation_p.L144S	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	144	PAC.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	AGCCGCAGCTTGTCCCAGCGC	0.642													21	40	---	---	---	---	capture	Missense_Mutation	SNP	61607575	61607575	KCNH6	17	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	7958	167
PSTPIP2	9050	broad.mit.edu	37	18	43572096	43572096	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43572096G>A	uc002lbp.3	-	11	910	c.814C>T	c.(814-816)CGC>TGC	p.R272C	PSTPIP2_uc002lbq.3_Intron	NM_024430	NP_077748	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting	272						membrane				ovary(1)	1						CCAGTTTTGCGTTGATTCACA	0.388													6	15	---	---	---	---	capture	Missense_Mutation	SNP	43572096	43572096	PSTPIP2	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12617	167
DENND1C	79958	broad.mit.edu	37	19	6477231	6477231	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6477231G>C	uc002mfe.2	-	8	603	c.511C>G	c.(511-513)CCG>GCG	p.P171A	DENND1C_uc002mfb.2_5'Flank|DENND1C_uc002mfc.2_5'Flank|DENND1C_uc002mfd.2_5'UTR|DENND1C_uc010xje.1_Missense_Mutation_p.P127A	NM_024898	NP_079174	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	171	DENN.					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1						CCGCTCACCGGCTTGCTATTC	0.667													2	26	---	---	---	---	capture	Missense_Mutation	SNP	6477231	6477231	DENND1C	19	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	4386	167
MUC16	94025	broad.mit.edu	37	19	8997532	8997532	+	Silent	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8997532G>A	uc002mkp.2	-	59	41094	c.40890C>T	c.(40888-40890)GCC>GCT	p.A13630A	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.A447A|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGAGAGGGCTGGCAGCTGTCG	0.468													31	62	---	---	---	---	capture	Silent	SNP	8997532	8997532	MUC16	19	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	9883	167
FBXL12	54850	broad.mit.edu	37	19	9922084	9922084	+	Missense_Mutation	SNP	C	T	T	rs61753275		TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9922084C>T	uc002mme.2	-	3	711	c.469G>A	c.(469-471)GTG>ATG	p.V157M	FBXL12_uc002mmd.2_Missense_Mutation_p.V104M|FBXL12_uc002mmf.2_Missense_Mutation_p.V104M|FBXL12_uc002mmg.2_Missense_Mutation_p.V104M|FBXL12_uc002mmh.2_Missense_Mutation_p.V104M	NM_017703	NP_060173	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12	157							protein binding			lung(1)|kidney(1)	2						CGGTCCAGCACGATGCATTCA	0.667													49	84	---	---	---	---	capture	Missense_Mutation	SNP	9922084	9922084	FBXL12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5654	167
ZNF844	284391	broad.mit.edu	37	19	12187275	12187275	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12187275G>C	uc002mtb.2	+	4	1483	c.1340G>C	c.(1339-1341)CGT>CCT	p.R447P	ZNF844_uc010dym.1_Missense_Mutation_p.R290P	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844	447					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGAGAAACCGTATGAGTGTA	0.433													5	119	---	---	---	---	capture	Missense_Mutation	SNP	12187275	12187275	ZNF844	19	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	18066	167
B3GNT3	10331	broad.mit.edu	37	19	17919127	17919127	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17919127G>A	uc002nhk.1	+	2	596	c.511G>A	c.(511-513)GGA>AGA	p.G171R	B3GNT3_uc002nhl.1_Missense_Mutation_p.G171R|B3GNT3_uc010ebd.1_Missense_Mutation_p.G171R|B3GNT3_uc010ebe.1_Missense_Mutation_p.G171R	NM_014256	NP_055071	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal	171	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1						ACAGACTCACGGAGACATCCT	0.637													35	53	---	---	---	---	capture	Missense_Mutation	SNP	17919127	17919127	B3GNT3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1247	167
SLC5A5	6528	broad.mit.edu	37	19	17986765	17986765	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17986765G>A	uc002nhr.3	+	5	895	c.548G>A	c.(547-549)GGC>GAC	p.G183D		NM_000453	NP_000444	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium iodide	183	Helical; (Potential).				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4						CTGCAGGGCGGCATGAAGGCT	0.557													4	131	---	---	---	---	capture	Missense_Mutation	SNP	17986765	17986765	SLC5A5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14560	167
FAM187B	148109	broad.mit.edu	37	19	35718991	35718991	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35718991A>C	uc002nyk.1	-	1	638	c.593T>G	c.(592-594)GTG>GGG	p.V198G		NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	198	Extracellular (Potential).					integral to membrane				ovary(2)	2						GCAGGCTTCCACCTGCAGCTC	0.542													4	33	---	---	---	---	capture	Missense_Mutation	SNP	35718991	35718991	FAM187B	19	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	5465	167
SYMPK	8189	broad.mit.edu	37	19	46338456	46338456	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46338456C>T	uc002pdn.2	-	11	1518	c.1273G>A	c.(1273-1275)GCC>ACC	p.A425T	SYMPK_uc002pdo.1_Missense_Mutation_p.A425T|SYMPK_uc002pdp.1_Missense_Mutation_p.A425T|SYMPK_uc002pdq.1_Missense_Mutation_p.A425T	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	425					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GCTGGCATGGCCTCGGGTAGG	0.498													40	92	---	---	---	---	capture	Missense_Mutation	SNP	46338456	46338456	SYMPK	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15327	167
FAM83E	54854	broad.mit.edu	37	19	49106813	49106813	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49106813G>A	uc002pjn.2	-	4	1179	c.1114C>T	c.(1114-1116)CGC>TGC	p.R372C		NM_017708	NP_060178	Q2M2I3	FA83E_HUMAN	hypothetical protein LOC54854	372										ovary(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CACATGGAGCGGCTgggccgg	0.517													7	9	---	---	---	---	capture	Missense_Mutation	SNP	49106813	49106813	FAM83E	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5583	167
ZNF845	91664	broad.mit.edu	37	19	53854361	53854361	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53854361C>A	uc010ydv.1	+	4	550	c.433C>A	c.(433-435)CAT>AAT	p.H145N	ZNF845_uc010ydw.1_Missense_Mutation_p.H145N	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	145					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATCAAGCTTTCATTCGCATCT	0.428													4	242	---	---	---	---	capture	Missense_Mutation	SNP	53854361	53854361	ZNF845	19	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	18067	167
ZNF814	730051	broad.mit.edu	37	19	58385762	58385762	+	Silent	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385762C>G	uc002qqo.2	-	3	1268	c.996G>C	c.(994-996)TCG>TCC	p.S332S	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332	C2H2-type 5.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						ATTTGCTAAACGATTTCCCAC	0.358													2	3	---	---	---	---	capture	Silent	SNP	58385762	58385762	ZNF814	19	C	G	G	G	1	0	0	0	0	0	0	0	1	236	19	4	4	18052	167
CTNNA2	1496	broad.mit.edu	37	2	80874750	80874750	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:80874750T>C	uc010ysh.1	+	18	2620	c.2615T>C	c.(2614-2616)CTG>CCG	p.L872P	CTNNA2_uc010yse.1_Missense_Mutation_p.L824P|CTNNA2_uc010ysf.1_Missense_Mutation_p.L824P|CTNNA2_uc010ysg.1_Missense_Mutation_p.L779P|CTNNA2_uc010ysi.1_Missense_Mutation_p.L456P|CTNNA2_uc010ysj.1_Missense_Mutation_p.L153P	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	872					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GCTAAAAACCTGATGAATGCT	0.468													5	231	---	---	---	---	capture	Missense_Mutation	SNP	80874750	80874750	CTNNA2	2	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	3976	167
RGPD4	285190	broad.mit.edu	37	2	108455335	108455335	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108455335A>T	uc010ywk.1	+	4	402	c.320A>T	c.(319-321)AAT>ATT	p.N107I	RGPD4_uc002tdu.2_5'UTR	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	107					intracellular transport		binding			skin(2)	2						CTTTGTAAAAATGATGTTACT	0.333													156	113	---	---	---	---	capture	Missense_Mutation	SNP	108455335	108455335	RGPD4	2	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	13181	167
SCN9A	6335	broad.mit.edu	37	2	167159653	167159653	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167159653T>C	uc010fpl.2	-	7	1189	c.848A>G	c.(847-849)AAT>AGT	p.N283S	SCN9A_uc002udr.1_Missense_Mutation_p.N154S|SCN9A_uc002uds.1_Missense_Mutation_p.N154S|SCN9A_uc002udt.1_Missense_Mutation_p.N154S	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	283	I.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	TAATGTTTCATTATTTTCAAG	0.338													11	15	---	---	---	---	capture	Missense_Mutation	SNP	167159653	167159653	SCN9A	2	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	13818	167
ZSWIM2	151112	broad.mit.edu	37	2	187713851	187713851	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:187713851G>T	uc002upu.1	-	1	47	c.7C>A	c.(7-9)CGC>AGC	p.R3S		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	3					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TAGCCTCGGCGAAGCATGCTG	0.642													15	21	---	---	---	---	capture	Missense_Mutation	SNP	187713851	187713851	ZSWIM2	2	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	18117	167
FAM126B	285172	broad.mit.edu	37	2	201846441	201846441	+	Missense_Mutation	SNP	C	T	T	rs138872845		TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201846441C>T	uc002uws.3	-	12	1333	c.1145G>A	c.(1144-1146)CGT>CAT	p.R382H	FAM126B_uc002uwu.2_Missense_Mutation_p.R356H|FAM126B_uc002uwv.2_Missense_Mutation_p.R382H	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172	382						intracellular				ovary(1)	1						CTTGGCTGAACGCCCAGTTGC	0.493													55	53	---	---	---	---	capture	Missense_Mutation	SNP	201846441	201846441	FAM126B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5384	167
ZDBF2	57683	broad.mit.edu	37	2	207176262	207176262	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207176262G>A	uc002vbp.2	+	5	7260	c.7010G>A	c.(7009-7011)CGT>CAT	p.R2337H		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2337							nucleic acid binding|zinc ion binding			ovary(3)	3						TTACAACAACGTGAGAGAATG	0.428													22	34	---	---	---	---	capture	Missense_Mutation	SNP	207176262	207176262	ZDBF2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17479	167
CHRND	1144	broad.mit.edu	37	2	233394744	233394744	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233394744T>C	uc002vsw.2	+	7	719	c.715T>C	c.(715-717)TAC>CAC	p.Y239H	CHRND_uc010zmg.1_Missense_Mutation_p.Y224H|CHRND_uc010fyc.2_Missense_Mutation_p.Y112H|CHRND_uc010zmh.1_Intron	NM_000751	NP_000742	Q07001	ACHD_HUMAN	nicotinic acetylcholine receptor delta	239	Extracellular (Potential).				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)|breast(1)|skin(1)	3		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)		CATCACCTTCTACCTCATCAT	0.612													47	69	---	---	---	---	capture	Missense_Mutation	SNP	233394744	233394744	CHRND	2	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	3359	167
ATG4B	23192	broad.mit.edu	37	2	242592988	242592988	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242592988C>G	uc002wbv.2	+	4	349	c.246C>G	c.(244-246)ATC>ATG	p.I82M	ATG4B_uc002wbu.2_Missense_Mutation_p.I8M|ATG4B_uc002wbw.2_Missense_Mutation_p.I82M|ATG4B_uc010zox.1_Missense_Mutation_p.I68M|ATG4B_uc010zoy.1_Missense_Mutation_p.I8M|ATG4B_uc010fzp.2_Missense_Mutation_p.I82M|ATG4B_uc010zoz.1_Missense_Mutation_p.I8M	NM_013325	NP_037457	Q9Y4P1	ATG4B_HUMAN	APG4 autophagy 4 homolog B isoform a	82					autophagic vacuole assembly|protein transport|proteolysis	cytoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)		GACAGATGATCTTTGCCCAAG	0.642													6	5	---	---	---	---	capture	Missense_Mutation	SNP	242592988	242592988	ATG4B	2	C	G	G	G	1	0	0	0	0	1	0	0	0	408	32	4	4	1088	167
SEC23B	10483	broad.mit.edu	37	20	18511418	18511418	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:18511418A>G	uc002wqz.1	+	10	1647	c.1204A>G	c.(1204-1206)ATG>GTG	p.M402V	SEC23B_uc002wra.1_Missense_Mutation_p.M402V|SEC23B_uc002wrb.1_Missense_Mutation_p.M402V|SEC23B_uc010zsb.1_Missense_Mutation_p.M384V|SEC23B_uc002wrc.1_Missense_Mutation_p.M402V	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B	402					ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						AGATTTCCGAATGGCATTTGG	0.274													47	178	---	---	---	---	capture	Missense_Mutation	SNP	18511418	18511418	SEC23B	20	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	13885	167
SRC	6714	broad.mit.edu	37	20	36030005	36030005	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36030005G>A	uc002xgx.2	+	11	1489	c.1040G>A	c.(1039-1041)GGG>GAG	p.G347E	SRC_uc002xgy.2_Missense_Mutation_p.G347E	NM_005417	NP_005408	P12931	SRC_HUMAN	proto-oncogene tyrosine-protein kinase SRC	347	Protein kinase.				axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	CTCTGCCCAGGGAGTTTGCTG	0.617													82	208	---	---	---	---	capture	Missense_Mutation	SNP	36030005	36030005	SRC	20	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15026	167
KIAA1755	85449	broad.mit.edu	37	20	36841631	36841631	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36841631C>T	uc002xhy.1	-	14	3688	c.3416G>A	c.(3415-3417)GGC>GAC	p.G1139D	KIAA1755_uc002xhv.1_Missense_Mutation_p.G203D|KIAA1755_uc002xhw.1_Missense_Mutation_p.G194D|KIAA1755_uc002xhx.1_Missense_Mutation_p.G417D	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN	hypothetical protein LOC85449	1139										ovary(4)|pancreas(1)	5		Myeloproliferative disorder(115;0.00874)				GGAGCCTTTGCCGTCTTCAGC	0.652													4	131	---	---	---	---	capture	Missense_Mutation	SNP	36841631	36841631	KIAA1755	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8179	167
LPIN3	64900	broad.mit.edu	37	20	39986528	39986528	+	Silent	SNP	G	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39986528G>T	uc002xjx.2	+	17	2137	c.2046G>T	c.(2044-2046)GGG>GGT	p.G682G	LPIN3_uc010ggh.2_Silent_p.G683G|LPIN3_uc010zwf.1_RNA	NM_022896	NP_075047	Q9BQK8	LPIN3_HUMAN	lipin 3	682	C-LIP.				fatty acid metabolic process	nucleus	phosphatidate phosphatase activity			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.000739)				TCAGAAATGGGTACAAGTTCC	0.622													27	94	---	---	---	---	capture	Silent	SNP	39986528	39986528	LPIN3	20	G	T	T	T	1	0	0	0	0	0	0	0	1	561	44	4	4	8836	167
DPM1	8813	broad.mit.edu	37	20	49574949	49574949	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49574949C>T	uc002xvw.1	-	1	112	c.112G>A	c.(112-114)GAG>AAG	p.E38K	DPM1_uc002xvx.1_RNA|MOCS3_uc002xvy.1_5'Flank	NM_003859	NP_003850	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase 1	38					C-terminal protein lipidation|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|protein N-linked glycosylation via asparagine|protein O-linked mannosylation	dolichol-phosphate-mannose synthase complex|endoplasmic reticulum membrane|membrane fraction	dolichyl-phosphate beta-D-mannosyltransferase activity|dolichyl-phosphate-mannose-protein mannosyltransferase activity|protein binding			ovary(1)	1						GGCAGGTTCTCGCGCTCGTTG	0.582													21	48	---	---	---	---	capture	Missense_Mutation	SNP	49574949	49574949	DPM1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4679	167
NFATC2	4773	broad.mit.edu	37	20	50007936	50007936	+	Silent	SNP	C	T	T	rs148642400		TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50007936C>T	uc002xwd.2	-	10	2995	c.2775G>A	c.(2773-2775)ACG>ACA	p.T925T	NFATC2_uc002xwc.2_3'UTR|NFATC2_uc010zyv.1_3'UTR|NFATC2_uc010zyw.1_Silent_p.T706T|NFATC2_uc010zyx.1_3'UTR|NFATC2_uc010zyy.1_3'UTR|NFATC2_uc010zyz.1_Silent_p.T706T|NFATC2_uc002xwe.2_Silent_p.T905T	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	925					B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					GCTTCTTTTACGTCTGATTTC	0.498													40	136	---	---	---	---	capture	Silent	SNP	50007936	50007936	NFATC2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	10269	167
TMPRSS15	5651	broad.mit.edu	37	21	19651292	19651292	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19651292A>T	uc002ykw.2	-	23	2784	c.2753T>A	c.(2752-2754)GTT>GAT	p.V918D		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	918	Extracellular (Potential).|Peptidase S1.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TTGATATACAACCGTCCCCCA	0.328													6	11	---	---	---	---	capture	Missense_Mutation	SNP	19651292	19651292	TMPRSS15	21	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	16129	167
IFNGR2	3460	broad.mit.edu	37	21	34805024	34805024	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:34805024C>G	uc002yrp.3	+	6	1373	c.725C>G	c.(724-726)TCC>TGC	p.S242C	IFNGR2_uc002yrq.3_Missense_Mutation_p.S261C|IFNGR2_uc010gma.2_Missense_Mutation_p.S163C|IFNGR2_uc002yrr.3_Missense_Mutation_p.S163C|TMEM50B_uc002yrs.1_RNA	NM_005534	NP_005525	P38484	INGR2_HUMAN	interferon gamma receptor 2 precursor	242	Extracellular (Potential).				regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity				0					Interferon gamma-1b(DB00033)	TTTTTAGCCTCCACTGAGCTT	0.468													3	233	---	---	---	---	capture	Missense_Mutation	SNP	34805024	34805024	IFNGR2	21	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	7475	167
ZFYVE20	64145	broad.mit.edu	37	3	15123959	15123959	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15123959C>A	uc003bzm.1	-	9	1369	c.755G>T	c.(754-756)TGT>TTT	p.C252F	ZFYVE20_uc010hek.1_Missense_Mutation_p.C252F|ZFYVE20_uc011avn.1_Intron	NM_022340	NP_071735	Q9H1K0	RBNS5_HUMAN	FYVE-finger-containing Rab5 effector protein	252	FYVE-type.|Necessary for the correct targeting to endosomes.				blood coagulation|endosome transport|protein transport	early endosome membrane|plasma membrane	protein binding|zinc ion binding			skin(2)	2						GCAGTGTGTACAGCAGCGGAT	0.572													3	60	---	---	---	---	capture	Missense_Mutation	SNP	15123959	15123959	ZFYVE20	3	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	17546	167
FLNB	2317	broad.mit.edu	37	3	58141766	58141766	+	Silent	SNP	C	T	T	rs113304692		TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58141766C>T	uc003djj.2	+	41	7017	c.6852C>T	c.(6850-6852)TCC>TCT	p.S2284S	FLNB_uc010hne.2_Silent_p.S2315S|FLNB_uc003djk.2_Silent_p.S2273S|FLNB_uc010hnf.2_Silent_p.S2260S|FLNB_uc003djl.2_Silent_p.S2104S|FLNB_uc003djm.2_Silent_p.S2091S	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	2284	Filamin 22.|Interaction with INPPL1.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TCGCACCCTCCGACGACGCCC	0.587													21	69	---	---	---	---	capture	Silent	SNP	58141766	58141766	FLNB	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5878	167
ROBO1	6091	broad.mit.edu	37	3	78711202	78711202	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:78711202C>T	uc003dqe.2	-	15	2237	c.2029G>A	c.(2029-2031)GTT>ATT	p.V677I	ROBO1_uc003dqb.2_Missense_Mutation_p.V638I|ROBO1_uc003dqc.2_Missense_Mutation_p.V641I|ROBO1_uc003dqd.2_Missense_Mutation_p.V641I|ROBO1_uc010hoh.2_5'UTR|ROBO1_uc011bgl.1_Missense_Mutation_p.V249I|ROBO1_uc003dqf.1_Missense_Mutation_p.V356I	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	677	Extracellular (Potential).|Fibronectin type-III 2.				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AGGTGCAGAACAGCATTTCCC	0.483													9	7	---	---	---	---	capture	Missense_Mutation	SNP	78711202	78711202	ROBO1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	13405	167
OR5H1	26341	broad.mit.edu	37	3	97851558	97851558	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97851558C>G	uc011bgt.1	+	1	17	c.17C>G	c.(16-18)GCA>GGA	p.A6G		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	6	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						GAGGAAAATGCAACATTGCTG	0.393													3	227	---	---	---	---	capture	Missense_Mutation	SNP	97851558	97851558	OR5H1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	11063	167
CEP70	80321	broad.mit.edu	37	3	138216906	138216906	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138216906G>A	uc003esl.2	-	17	1897	c.1699C>T	c.(1699-1701)CAG>TAG	p.Q567*	CEP70_uc011bmk.1_Nonsense_Mutation_p.Q547*|CEP70_uc011bml.1_Nonsense_Mutation_p.Q549*|CEP70_uc011bmm.1_Nonsense_Mutation_p.Q415*	NM_024491	NP_077817	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70 kDa	567					G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1						GTAAATGCCTGAAATGCTGGG	0.343													30	61	---	---	---	---	capture	Nonsense_Mutation	SNP	138216906	138216906	CEP70	3	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	3227	167
NAALADL2	254827	broad.mit.edu	37	3	174814645	174814645	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:174814645G>A	uc003fit.2	+	2	196	c.109G>A	c.(109-111)GAC>AAC	p.D37N	NAALADL2_uc003fiu.1_Missense_Mutation_p.D30N	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	37	Cytoplasmic (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		ACAGTACTTAGACAATGATGA	0.408													17	25	---	---	---	---	capture	Missense_Mutation	SNP	174814645	174814645	NAALADL2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	10040	167
PDGFRA	5156	broad.mit.edu	37	4	55131142	55131142	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55131142G>A	uc003han.3	+	5	1016	c.685G>A	c.(685-687)GAA>AAA	p.E229K	PDGFRA_uc003haa.2_Intron|PDGFRA_uc003hal.2_3'UTR|PDGFRA_uc010igq.1_Missense_Mutation_p.E123K|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	229	Ig-like C2-type 3.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TAAGTCAGGGGAAACGATTGT	0.413			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			23	625	---	---	---	---	capture	Missense_Mutation	SNP	55131142	55131142	PDGFRA	4	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11564	167
LRBA	987	broad.mit.edu	37	4	151357950	151357950	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:151357950C>A	uc010ipj.2	-	46	7354	c.6880G>T	c.(6880-6882)GAT>TAT	p.D2294Y	LRBA_uc010ipi.2_5'UTR|LRBA_uc003ils.3_Missense_Mutation_p.D184Y|LRBA_uc003ilt.3_Missense_Mutation_p.D942Y|LRBA_uc003ilu.3_Missense_Mutation_p.D2283Y	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	2294	BEACH.					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					GGAACTTGATCATCTTCCCAT	0.388													4	67	---	---	---	---	capture	Missense_Mutation	SNP	151357950	151357950	LRBA	4	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	8847	167
FGG	2266	broad.mit.edu	37	4	155528109	155528109	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155528109C>T	uc003ioj.2	-	8	1018	c.877G>A	c.(877-879)GTG>ATG	p.V293M	FGG_uc003iog.2_Missense_Mutation_p.V293M|FGG_uc003ioh.2_Missense_Mutation_p.V301M|FGG_uc010ipx.2_Missense_Mutation_p.V121M|FGG_uc010ipy.2_Missense_Mutation_p.V4M|FGG_uc003ioi.2_Missense_Mutation_p.V4M|FGG_uc003iok.2_Missense_Mutation_p.V301M	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	293	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TCAGGTCCCACCTTGAACATG	0.493													64	102	---	---	---	---	capture	Missense_Mutation	SNP	155528109	155528109	FGG	4	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	5816	167
SPEF2	79925	broad.mit.edu	37	5	35659271	35659271	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:35659271C>T	uc003jjo.2	+	8	1240	c.1129C>T	c.(1129-1131)CGA>TGA	p.R377*	SPEF2_uc003jjn.1_Nonsense_Mutation_p.R377*|SPEF2_uc003jjq.3_Nonsense_Mutation_p.R377*	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	377	Potential.				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGAGGAAAGACGACTTAAAGA	0.408													29	39	---	---	---	---	capture	Nonsense_Mutation	SNP	35659271	35659271	SPEF2	5	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	14927	167
C5orf39	389289	broad.mit.edu	37	5	43040065	43040065	+	Silent	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:43040065C>T	uc003jnf.2	-	1	383	c.84G>A	c.(82-84)GTG>GTA	p.V28V	C5orf39_uc010ivj.1_RNA|LOC153684_uc003jng.2_5'Flank|LOC153684_uc003jni.2_5'Flank	NM_001014279	NP_001014301	Q3ZCQ2	AX2R_HUMAN	annexin II receptor	28							receptor activity				0						CTTCTGAACTCACAATAGGTG	0.557											OREG0016598	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	71	---	---	---	---	capture	Silent	SNP	43040065	43040065	C5orf39	5	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	2274	167
ITGA1	3672	broad.mit.edu	37	5	52145207	52145207	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:52145207C>T	uc003jou.2	+	2	122	c.70C>T	c.(70-72)CGC>TGC	p.R24C	ITGA1_uc003jov.2_RNA	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor	24					axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				AGTTGTTCTACGCTGCTGCGT	0.373													25	47	---	---	---	---	capture	Missense_Mutation	SNP	52145207	52145207	ITGA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7795	167
ANKRD34B	340120	broad.mit.edu	37	5	79855139	79855139	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79855139C>T	uc010jam.2	-	4	1050	c.700G>A	c.(700-702)GCA>ACA	p.A234T	ANKRD34B_uc003kgw.2_Missense_Mutation_p.A234T|ANKRD34B_uc010jan.2_Missense_Mutation_p.A234T	NM_001004441	NP_001004441	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	234						cytoplasm|nucleus				pancreas(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		GGGGCCAATGCAGGTTTCCTC	0.522													52	80	---	---	---	---	capture	Missense_Mutation	SNP	79855139	79855139	ANKRD34B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	659	167
SLCO4C1	353189	broad.mit.edu	37	5	101585466	101585466	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101585466G>A	uc003knm.2	-	9	1783	c.1496C>T	c.(1495-1497)GCC>GTC	p.A499V		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	499	Kazal-like.|Extracellular (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		ATTACAAGGGGCTATCAAGTT	0.373													62	93	---	---	---	---	capture	Missense_Mutation	SNP	101585466	101585466	SLCO4C1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14622	167
TXNDC15	79770	broad.mit.edu	37	5	134223439	134223439	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:134223439A>G	uc003lac.1	+	2	816	c.158A>G	c.(157-159)CAG>CGG	p.Q53R	TXNDC15_uc010jdy.1_Intron|TXNDC15_uc011cxv.1_RNA	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	disulfide isomerase precursor	53	Extracellular (Potential).				cell redox homeostasis	integral to membrane				ovary(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CACCCTCTCCAGGTGGGGGCT	0.567													3	83	---	---	---	---	capture	Missense_Mutation	SNP	134223439	134223439	TXNDC15	5	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	16676	167
CDC23	8697	broad.mit.edu	37	5	137548883	137548883	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137548883G>A	uc003lcl.2	-	1	150	c.119C>T	c.(118-120)GCG>GTG	p.A40V	CDC23_uc003lcm.1_Missense_Mutation_p.A40V	NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23	40					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GGTAAGGCCCGCAATAAGCAG	0.572													5	238	---	---	---	---	capture	Missense_Mutation	SNP	137548883	137548883	CDC23	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3032	167
FAM53C	51307	broad.mit.edu	37	5	137682463	137682463	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137682463A>G	uc003lcv.2	+	5	1464	c.994A>G	c.(994-996)ATG>GTG	p.M332V	FAM53C_uc003lcw.2_Missense_Mutation_p.M332V|FAM53C_uc011cyq.1_RNA|FAM53C_uc011cyr.1_3'UTR	NM_001135647	NP_001129119	Q9NYF3	FA53C_HUMAN	hypothetical protein LOC51307	332										ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ACCATGGTTCATGGCCTGTAG	0.572													42	55	---	---	---	---	capture	Missense_Mutation	SNP	137682463	137682463	FAM53C	5	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	5529	167
PCDHA1	56147	broad.mit.edu	37	5	140167728	140167728	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167728C>T	uc003lhb.2	+	1	1853	c.1853C>T	c.(1852-1854)GCG>GTG	p.A618V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.A618V	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	618	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGGCGGCGCGCGCATCCCG	0.672													65	60	---	---	---	---	capture	Missense_Mutation	SNP	140167728	140167728	PCDHA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11422	167
PCDHB7	56129	broad.mit.edu	37	5	140553181	140553181	+	Silent	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140553181C>T	uc003lit.2	+	1	939	c.765C>T	c.(763-765)AGC>AGT	p.S255S		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	255	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGAAAATAGCCCCGTTGGTT	0.507													3	145	---	---	---	---	capture	Silent	SNP	140553181	140553181	PCDHB7	5	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	11450	167
SLC34A1	6569	broad.mit.edu	37	5	176815108	176815108	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176815108C>A	uc003mgk.3	+	7	859	c.758C>A	c.(757-759)GCC>GAC	p.A253D		NM_003052	NP_003043	Q06495	NPT2A_HUMAN	solute carrier family 34 (sodium phosphate),	253	Extracellular (Potential).				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTGTGGTGGCCTCCTTCAAC	0.592													3	65	---	---	---	---	capture	Missense_Mutation	SNP	176815108	176815108	SLC34A1	5	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	14459	167
FLT4	2324	broad.mit.edu	37	5	180048821	180048821	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180048821C>T	uc003mma.3	-	13	1820	c.1741G>A	c.(1741-1743)GAC>AAC	p.D581N	FLT4_uc003mlz.3_Missense_Mutation_p.D581N|FLT4_uc003mmb.1_Missense_Mutation_p.D114N|FLT4_uc011dgy.1_Missense_Mutation_p.D581N	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	581	Ig-like C2-type 6.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	TTGTAGCTGTCGGCTTGGCAG	0.617									Congenital_Hereditary_Lymphedema				32	51	---	---	---	---	capture	Missense_Mutation	SNP	180048821	180048821	FLT4	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5888	167
NKAPL	222698	broad.mit.edu	37	6	28227888	28227888	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28227888G>A	uc003nkt.2	+	1	791	c.739G>A	c.(739-741)GAA>AAA	p.E247K	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	247										upper_aerodigestive_tract(1)|ovary(1)	2						AACCAAAAAAGAATCCAGTGA	0.308													12	11	---	---	---	---	capture	Missense_Mutation	SNP	28227888	28227888	NKAPL	6	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	10347	167
PKHD1	5314	broad.mit.edu	37	6	51768472	51768472	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51768472C>T	uc003pah.1	-	43	7195	c.6919G>A	c.(6919-6921)GGT>AGT	p.G2307S	PKHD1_uc010jzn.1_Missense_Mutation_p.G290S|PKHD1_uc003pai.2_Missense_Mutation_p.G2307S	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2307	PbH1 3.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CCCTCGGCACCAGAAACCTGG	0.418													87	191	---	---	---	---	capture	Missense_Mutation	SNP	51768472	51768472	PKHD1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	11874	167
BMP5	653	broad.mit.edu	37	6	55638880	55638880	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55638880G>A	uc003pcq.2	-	4	1706	c.994C>T	c.(994-996)CAT>TAT	p.H332Y	BMP5_uc011dxf.1_Missense_Mutation_p.H332Y	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	332					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			GAGTCCTGATGAGAGCTGGAT	0.468													71	117	---	---	---	---	capture	Missense_Mutation	SNP	55638880	55638880	BMP5	6	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	1451	167
BEND6	221336	broad.mit.edu	37	6	56883316	56883316	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56883316C>G	uc010kab.2	+	6	1396	c.810C>G	c.(808-810)AGC>AGG	p.S270R	BEND6_uc003pdi.3_Missense_Mutation_p.S172R	NM_152731	NP_689944	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	270	BEN.										0						CAAATTTAAGCAAAAATCTTA	0.313													18	38	---	---	---	---	capture	Missense_Mutation	SNP	56883316	56883316	BEND6	6	C	G	G	G	1	0	0	0	0	1	0	0	0	324	25	4	4	1391	167
KHDRBS2	202559	broad.mit.edu	37	6	62611257	62611257	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:62611257C>T	uc003peg.2	-	5	750	c.503G>A	c.(502-504)CGT>CAT	p.R168H		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	168					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		TTGTTCCTGACGAATTTCATC	0.403													7	131	---	---	---	---	capture	Missense_Mutation	SNP	62611257	62611257	KHDRBS2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8069	167
SNAP91	9892	broad.mit.edu	37	6	84303343	84303343	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84303343G>C	uc011dze.1	-	17	1867	c.1550C>G	c.(1549-1551)CCA>CGA	p.P517R	SNAP91_uc011dzd.1_Missense_Mutation_p.P20R|SNAP91_uc003pkb.2_Missense_Mutation_p.P480R|SNAP91_uc003pkc.2_Missense_Mutation_p.P515R|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Missense_Mutation_p.P515R	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	517	Ala-rich.				clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TGCGGGAACTGGAGGGGCTGT	0.313													2	19	---	---	---	---	capture	Missense_Mutation	SNP	84303343	84303343	SNAP91	6	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	14725	167
MAP3K7	6885	broad.mit.edu	37	6	91266234	91266234	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:91266234G>A	uc003pnz.1	-	6	754	c.592C>T	c.(592-594)CCT>TCT	p.P198S	MAP3K7_uc003poa.1_Missense_Mutation_p.P198S|MAP3K7_uc003pob.1_Missense_Mutation_p.P198S|MAP3K7_uc003poc.1_Missense_Mutation_p.P198S	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	198	Protein kinase.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		AAAACTTCAGGTGCCATCCAA	0.403													11	259	---	---	---	---	capture	Missense_Mutation	SNP	91266234	91266234	MAP3K7	6	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9169	167
SEPT7	989	broad.mit.edu	37	7	35942771	35942771	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:35942771A>G	uc010kxc.2	+	12	1413	c.1220A>G	c.(1219-1221)GAG>GGG	p.E407G	SEPT7_uc011kat.1_Missense_Mutation_p.E406G|SEPT7_uc011kau.1_Missense_Mutation_p.E371G|SEPT7_uc011kav.1_Missense_Mutation_p.E354G|SEPT7_uc003tey.2_Missense_Mutation_p.E255G	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1	407	Potential.				cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						TTCGAGGATGAGAAAGCAAAC	0.383													2	35	---	---	---	---	capture	Missense_Mutation	SNP	35942771	35942771	SEPT7	7	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	13962	167
SRRT	51593	broad.mit.edu	37	7	100485931	100485931	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100485931C>G	uc003uwy.2	+	20	2750	c.2482C>G	c.(2482-2484)CCG>GCG	p.P828A	SRRT_uc010lhl.1_Missense_Mutation_p.P827A|SRRT_uc003uxa.2_Missense_Mutation_p.P823A|SRRT_uc003uwz.2_Missense_Mutation_p.P824A|uc010lhm.1_5'Flank	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a	828	Pro-rich.				cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						CCCCCATGCCCCGTATGGTGC	0.577													49	85	---	---	---	---	capture	Missense_Mutation	SNP	100485931	100485931	SRRT	7	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	15064	167
LAMB4	22798	broad.mit.edu	37	7	107708521	107708521	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107708521C>T	uc010ljo.1	-	19	2470	c.2386G>A	c.(2386-2388)GGG>AGG	p.G796R	LAMB4_uc003vey.2_Missense_Mutation_p.G796R	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	796	Laminin EGF-like 6.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						CAGCAGCGCCCGACCACAAGA	0.567													7	332	---	---	---	---	capture	Missense_Mutation	SNP	107708521	107708521	LAMB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8533	167
GPR85	54329	broad.mit.edu	37	7	112724397	112724397	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:112724397C>T	uc010ljv.2	-	2	897	c.380G>A	c.(379-381)CGC>CAC	p.R127H	GPR85_uc003vgp.1_Missense_Mutation_p.R127H|GPR85_uc003vgq.2_Missense_Mutation_p.R127H|GPR85_uc010ljw.1_Missense_Mutation_p.R127H	NM_001146266	NP_001139738	P60893	GPR85_HUMAN	G protein-coupled receptor 85	127	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)	2						TGTATAGAAGCGGTGATGGGC	0.493													41	120	---	---	---	---	capture	Missense_Mutation	SNP	112724397	112724397	GPR85	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6648	167
GRM8	2918	broad.mit.edu	37	7	126173579	126173579	+	Silent	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126173579G>A	uc003vlr.2	-	8	2168	c.1857C>T	c.(1855-1857)CGC>CGT	p.R619R	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.R619R|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	619	Cytoplasmic (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	AACTAAGTTCGCGTCCTGAAG	0.458										HNSCC(24;0.065)			3	116	---	---	---	---	capture	Silent	SNP	126173579	126173579	GRM8	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6736	167
CALD1	800	broad.mit.edu	37	7	134618735	134618735	+	Silent	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134618735A>G	uc003vrz.2	+	5	1674	c.1215A>G	c.(1213-1215)AAA>AAG	p.K405K	CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron|CALD1_uc003vsc.2_Intron|CALD1_uc003vsd.2_Intron|CALD1_uc011kpu.1_Intron|CALD1_uc011kpv.1_Intron|CALD1_uc003vse.2_Silent_p.K269K	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1	405					cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						CAAAGATAAAAGGGGAAAAGG	0.418													3	167	---	---	---	---	capture	Silent	SNP	134618735	134618735	CALD1	7	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	2557	167
ADAM2	2515	broad.mit.edu	37	8	39626970	39626970	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:39626970C>A	uc003xnj.2	-	12	1228	c.1153G>T	c.(1153-1155)GCA>TCA	p.A385S	ADAM2_uc003xnk.2_Missense_Mutation_p.A366S|ADAM2_uc011lck.1_Missense_Mutation_p.A385S|ADAM2_uc003xnl.2_Missense_Mutation_p.A259S	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	385	Extracellular (Potential).|Disintegrin.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CCACACACTGCTTGCTGTTTG	0.448													51	57	---	---	---	---	capture	Missense_Mutation	SNP	39626970	39626970	ADAM2	8	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	241	167
PLAT	5327	broad.mit.edu	37	8	42042617	42042617	+	Missense_Mutation	SNP	T	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42042617T>G	uc003xos.2	-	7	822	c.613A>C	c.(613-615)ACC>CCC	p.T205P	PLAT_uc010lxf.1_Missense_Mutation_p.T122P|PLAT_uc010lxg.1_Intron|PLAT_uc003xot.2_Missense_Mutation_p.T159P|PLAT_uc011lcm.1_Intron|PLAT_uc011lcn.1_Intron	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1	205	Kringle 1.				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CAGGCAGGGGTGCTGCAGAAC	0.587													6	57	---	---	---	---	capture	Missense_Mutation	SNP	42042617	42042617	PLAT	8	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	11924	167
TMEM55A	55529	broad.mit.edu	37	8	92007945	92007945	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:92007945C>T	uc003yes.2	-	7	960	c.734G>A	c.(733-735)GGA>GAA	p.G245E		NM_018710	NP_061180	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A	245	Helical; (Potential).					integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity				0			BRCA - Breast invasive adenocarcinoma(11;0.033)			TCTTATGGCTCCCCAATAACA	0.438													3	141	---	---	---	---	capture	Missense_Mutation	SNP	92007945	92007945	TMEM55A	8	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	16064	167
TRPS1	7227	broad.mit.edu	37	8	116430676	116430676	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:116430676C>T	uc003ynz.2	-	5	3125	c.2666G>A	c.(2665-2667)CGT>CAT	p.R889H	TRPS1_uc011lhy.1_Missense_Mutation_p.R893H|TRPS1_uc003yny.2_Missense_Mutation_p.R902H|TRPS1_uc010mcy.2_Missense_Mutation_p.R889H	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	889					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.R889C(1)		ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GGAGCCTCTACGCCTCTGAAA	0.478									Langer-Giedion_syndrome				6	192	---	---	---	---	capture	Missense_Mutation	SNP	116430676	116430676	TRPS1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16476	167
RANBP6	26953	broad.mit.edu	37	9	6012502	6012502	+	Missense_Mutation	SNP	T	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:6012502T>G	uc003zjr.2	-	1	3117	c.3106A>C	c.(3106-3108)ATT>CTT	p.I1036L	RANBP6_uc011lmf.1_Missense_Mutation_p.I684L|RANBP6_uc003zjs.2_Missense_Mutation_p.I624L	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	1036					protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		TTTGGACCAATTACAACTGGG	0.368													48	64	---	---	---	---	capture	Missense_Mutation	SNP	6012502	6012502	RANBP6	9	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	12926	167
C9orf41	138199	broad.mit.edu	37	9	77631261	77631261	+	Missense_Mutation	SNP	T	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:77631261T>G	uc004ajq.2	-	3	666	c.513A>C	c.(511-513)GAA>GAC	p.E171D	C9orf41_uc011lsi.1_RNA	NM_152420	NP_689633	Q8N4J0	CI041_HUMAN	hypothetical protein LOC138199	171										ovary(1)|skin(1)	2						CTTTCCCAGTTTCACTCCAGT	0.353													8	350	---	---	---	---	capture	Missense_Mutation	SNP	77631261	77631261	C9orf41	9	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	2458	167
TLE1	7088	broad.mit.edu	37	9	84200544	84200544	+	Silent	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:84200544G>A	uc004aly.2	-	18	2445	c.2004C>T	c.(2002-2004)ACC>ACT	p.T668T	TLE1_uc004alz.2_Silent_p.T678T|TLE1_uc011lsr.1_Silent_p.T653T	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1	668					negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						GCCACTCCCCGGTGGGGCAGT	0.557													6	30	---	---	---	---	capture	Silent	SNP	84200544	84200544	TLE1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15823	167
FAM22F	54754	broad.mit.edu	37	9	97081002	97081002	+	Silent	SNP	G	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97081002G>T	uc004aup.1	-	7	2037	c.2016C>A	c.(2014-2016)CCC>CCA	p.P672P		NM_017561	NP_060031	A1L443	FA22F_HUMAN	hypothetical protein LOC54754	672											0		Acute lymphoblastic leukemia(62;0.136)				GAGCTCCCTGGGGTCCTCTCC	0.607													4	13	---	---	---	---	capture	Silent	SNP	97081002	97081002	FAM22F	9	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	5494	167
FAM22G	441457	broad.mit.edu	37	9	99694201	99694201	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:99694201G>A	uc004awq.1	+	2	929	c.214G>A	c.(214-216)GGC>AGC	p.G72S		NM_001045477	NP_001038942	Q5VZR2	FA22G_HUMAN	hypothetical protein LOC441457	72										skin(1)	1		Acute lymphoblastic leukemia(62;0.0527)				GGATGGCCGCGGCCCAAGTGG	0.642													3	46	---	---	---	---	capture	Missense_Mutation	SNP	99694201	99694201	FAM22G	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5495	167
ZBED1	9189	broad.mit.edu	37	X	2407889	2407889	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2407889A>G	uc004cqg.2	-	2	1073	c.872T>C	c.(871-873)CTG>CCG	p.L291P	DHRSX_uc004cqf.3_Intron|ZBED1_uc004cqh.1_Missense_Mutation_p.L291P	NM_004729	NP_004720	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	291						nuclear chromosome	DNA binding|metal ion binding|protein dimerization activity|transposase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGTGTGGCCCAGGCAGGGCAT	0.647													71	221	---	---	---	---	capture	Missense_Mutation	SNP	2407889	2407889	ZBED1	23	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	17398	167
DMD	1756	broad.mit.edu	37	X	32305784	32305784	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32305784C>T	uc004dda.1	-	43	6396	c.6152G>A	c.(6151-6153)CGG>CAG	p.R2051Q	DMD_uc004dcw.2_Missense_Mutation_p.R707Q|DMD_uc004dcx.2_Missense_Mutation_p.R710Q|DMD_uc004dcz.2_Missense_Mutation_p.R1928Q|DMD_uc004dcy.1_Missense_Mutation_p.R2047Q|DMD_uc004ddb.1_Missense_Mutation_p.R2043Q|DMD_uc010ngo.1_Intron|DMD_uc010ngn.1_RNA	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2051	Spectrin 14.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AATGTCAATCCGACCTGAGCT	0.348													39	81	---	---	---	---	capture	Missense_Mutation	SNP	32305784	32305784	DMD	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4538	167
RBM3	5935	broad.mit.edu	37	X	48433596	48433596	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48433596G>C	uc004dkf.1	+	2	167	c.28G>C	c.(28-30)GTG>CTG	p.V10L	RBM3_uc004dkd.1_RNA|RBM3_uc004dkg.2_Missense_Mutation_p.V10L	NM_006743	NP_006734	P98179	RBM3_HUMAN	RNA binding motif protein 3	10	RRM.				positive regulation of translation	dendrite|nucleus	nucleotide binding|RNA binding			ovary(1)	1						AAAGCTCTTCGTGGGAGGGCT	0.502											OREG0019765	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	47	---	---	---	---	capture	Missense_Mutation	SNP	48433596	48433596	RBM3	23	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	13024	167
USP51	158880	broad.mit.edu	37	X	55513943	55513943	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55513943G>A	uc004dun.1	-	2	1509	c.1430C>T	c.(1429-1431)CCC>CTC	p.P477L	USP51_uc011moo.1_Missense_Mutation_p.P181L	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	477					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						ACAGCAGTTGGGGTTATTGGC	0.478													12	362	---	---	---	---	capture	Missense_Mutation	SNP	55513943	55513943	USP51	23	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16965	167
NRK	203447	broad.mit.edu	37	X	105159747	105159747	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105159747C>T	uc004emd.2	+	15	2678	c.2375C>T	c.(2374-2376)CCT>CTT	p.P792L	NRK_uc010npc.1_Missense_Mutation_p.P460L	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	792							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CCTTCTGTGCCTAACAACCAG	0.313										HNSCC(51;0.14)			36	115	---	---	---	---	capture	Missense_Mutation	SNP	105159747	105159747	NRK	23	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	10562	167
LHFPL1	340596	broad.mit.edu	37	X	111914414	111914414	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:111914414G>A	uc004epq.2	-	2	538	c.205C>T	c.(205-207)CGC>TGC	p.R69C	LHFPL1_uc004epp.2_Missense_Mutation_p.R92C|LHFPL1_uc010nqa.2_Intron|LHFPL1_uc010nqb.2_Missense_Mutation_p.R69C	NM_178175	NP_835469	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1 precursor	69						integral to membrane					0						CTGGCATAGCGCCCACATTCT	0.592													123	248	---	---	---	---	capture	Missense_Mutation	SNP	111914414	111914414	LHFPL1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8684	167
HTR2C	3358	broad.mit.edu	37	X	114082719	114082719	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:114082719G>A	uc004epu.1	+	5	1231	c.503G>A	c.(502-504)CGG>CAG	p.R168Q	HTR2C_uc010nqc.1_Missense_Mutation_p.R168Q|HTR2C_uc004epv.1_Intron	NM_000868	NP_000859	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C	168	Cytoplasmic (By similarity).				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity			ovary(3)	3					Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)	TTCAATTCGCGGACTAAGGCC	0.408													69	157	---	---	---	---	capture	Missense_Mutation	SNP	114082719	114082719	HTR2C	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7368	167
MAGEC3	139081	broad.mit.edu	37	X	140985023	140985023	+	Silent	SNP	T	C	C			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140985023T>C	uc011mwp.1	+	7	1479	c.1479T>C	c.(1477-1479)TAT>TAC	p.Y493Y	MAGEC3_uc004fbs.2_Silent_p.Y195Y|MAGEC3_uc010nsj.2_Silent_p.Y195Y	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	493	MAGE 2.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATAAGGACTATTTTCCCATGA	0.438													229	183	---	---	---	---	capture	Silent	SNP	140985023	140985023	MAGEC3	23	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	9096	167
MTMR1	8776	broad.mit.edu	37	X	149924177	149924177	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149924177C>T	uc004fei.2	+	14	1808	c.1673C>T	c.(1672-1674)ACG>ATG	p.T558M	MTMR1_uc011mya.1_Missense_Mutation_p.T464M|MTMR1_uc004feh.1_Missense_Mutation_p.T566M|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_RNA	NM_003828	NP_003819	Q13613	MTMR1_HUMAN	myotubularin-related protein 1	558	Myotubularin phosphatase.					plasma membrane	protein tyrosine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TATACAAAGACGATATCTTTA	0.323													63	54	---	---	---	---	capture	Missense_Mutation	SNP	149924177	149924177	MTMR1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9848	167
FAM3A	60343	broad.mit.edu	37	X	153736149	153736149	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153736149C>A	uc004fls.1	-	6	655	c.378G>T	c.(376-378)TGG>TGT	p.W126C	FAM3A_uc004flt.1_Missense_Mutation_p.W140C|FAM3A_uc011mzp.1_Intron|FAM3A_uc004flu.1_Intron|FAM3A_uc011mzq.1_Missense_Mutation_p.W126C|FAM3A_uc004flw.1_Missense_Mutation_p.W126C	NM_021806	NP_068578	P98173	FAM3A_HUMAN	family 3, member A protein precursor	126						extracellular region				large_intestine(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CACCTCCGGCCCACATGTCAA	0.627													2	17	---	---	---	---	capture	Missense_Mutation	SNP	153736149	153736149	FAM3A	23	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	5504	167
ACCSL	390110	broad.mit.edu	37	11	44077630	44077630	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:44077630delA	uc001mxw.1	+	10	1236	c.1180delA	c.(1180-1182)AGTfs	p.S394fs	ACCSL_uc009ykr.2_Frame_Shift_Del_p.S213fs	NM_001031854	NP_001027025	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase	394							1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(5)	5						CTGGGGTACCAGTAAGGTGAG	0.443													90	97	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	44077630	44077630	ACCSL	11	A	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	134	167
THOC1	9984	broad.mit.edu	37	18	247872	247874	+	In_Frame_Del	DEL	TCT	-	-			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:247872_247874delTCT	uc002kkj.3	-	10	801_803	c.761_763delAGA	c.(760-765)AAGATT>ATT	p.K254del	THOC1_uc002kkk.3_RNA|THOC1_uc002kkl.2_In_Frame_Del_p.K254del	NM_005131	NP_005122	Q96FV9	THOC1_HUMAN	THO complex 1	254					apoptosis|intronless viral mRNA export from host nucleus|mRNA processing|regulation of transcription elongation, DNA-dependent|RNA splicing|signal transduction|transcription, DNA-dependent	cytoplasm|nuclear matrix|nuclear speck|THO complex part of transcription export complex	DNA binding|protein binding|RNA binding			ovary(1)	1		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TTCCATGAAATCTTCTCATAGCA	0.350													45	89	---	---	---	---	capture_indel	In_Frame_Del	DEL	247872	247874	THOC1	18	TCT	-	-	-	1	0	1	0	1	0	0	0	0	650	50	5	5	15749	167
KIAA1012	22878	broad.mit.edu	37	18	29496353	29496353	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29496353delA	uc002kxc.3	-	4	863	c.499delT	c.(499-501)TCAfs	p.S167fs	KIAA1012_uc002kxb.3_Frame_Shift_Del_p.S113fs|KIAA1012_uc002kxd.3_RNA|KIAA1012_uc002kxe.2_Frame_Shift_Del_p.S167fs	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	167					ER to Golgi vesicle-mediated transport	cis-Golgi network					0						TGTTCTTGTGACAACTTTGAA	0.348													26	33	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	29496353	29496353	KIAA1012	18	A	-	-	-	1	0	1	0	1	0	0	0	0	130	10	5	5	8126	167
C7orf64	84060	broad.mit.edu	37	7	92163996	92163997	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92163996_92163997delTT	uc003ulz.2	+	4	770_771	c.729_730delTT	c.(727-732)TCTTTGfs	p.S243fs	C7orf64_uc003uma.2_Frame_Shift_Del_p.S243fs	NM_032120	NP_115496	Q5RL73	CG064_HUMAN	hypothetical protein LOC84060	243_244							nucleotide binding			ovary(2)	2						ACAATGACTCTTTGCGGAAAAC	0.450													65	147	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	92163996	92163997	C7orf64	7	TT	-	-	-	1	0	1	0	1	0	0	0	0	717	56	5	5	2387	167
NOM1	64434	broad.mit.edu	37	7	156743209	156743211	+	In_Frame_Del	DEL	GAG	-	-			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:156743209_156743211delGAG	uc003wmy.2	+	1	793_795	c.778_780delGAG	c.(778-780)GAGdel	p.E264del		NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	264	Glu-rich.|Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.				RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		ggacgaaagtgaggaggaggagg	0.236													7	135	---	---	---	---	capture_indel	In_Frame_Del	DEL	156743209	156743211	NOM1	7	GAG	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	10437	167
CLCN5	1184	broad.mit.edu	37	X	49851112	49851112	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-2631-01	TCGA-19-2631-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49851112delA	uc004dos.1	+	8	1180	c.932delA	c.(931-933)CACfs	p.H311fs	CLCN5_uc004dor.1_Frame_Shift_Del_p.H381fs|CLCN5_uc004doq.1_Frame_Shift_Del_p.H381fs|CLCN5_uc004dot.1_Frame_Shift_Del_p.H311fs	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b	311					excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					GTGGAGTTTCACACCCCATGG	0.498													59	143	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	49851112	49851112	CLCN5	23	A	-	-	-	1	0	1	0	1	0	0	0	0	78	6	5	5	3431	167
