Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHA8	2046	broad.mit.edu	37	1	22903296	22903296	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22903296C>T	uc001bfx.1	+	3	871	c.746C>T	c.(745-747)GCG>GTG	p.A249V	EPHA8_uc001bfw.2_Missense_Mutation_p.A249V	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	249	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TACTGCAGCGCGGAGGGCGAG	0.687													8	22	---	---	---	---	capture	Missense_Mutation	SNP	22903296	22903296	EPHA8	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5128	170
TSSK3	81629	broad.mit.edu	37	1	32828323	32828323	+	Silent	SNP	C	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32828323C>A	uc001bvf.2	+	1	462	c.21C>A	c.(19-21)TCC>TCA	p.S7S	uc001bve.1_RNA	NM_052841	NP_443073	Q96PN8	TSSK3_HUMAN	testis-specific serine kinase 3	7					cell differentiation|multicellular organismal development|spermatogenesis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			stomach(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.17)|Breast(348;0.212)				TTCTGCTCTCCAATGGGTACC	0.502													37	54	---	---	---	---	capture	Silent	SNP	32828323	32828323	TSSK3	1	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	16552	170
GRIK3	2899	broad.mit.edu	37	1	37356541	37356541	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:37356541C>G	uc001caz.2	-	2	407	c.272G>C	c.(271-273)AGC>ACC	p.S91T	GRIK3_uc001cba.1_Missense_Mutation_p.S91T	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	91	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	CGCCTCGAAGCTGTCATGGAA	0.527													32	81	---	---	---	---	capture	Missense_Mutation	SNP	37356541	37356541	GRIK3	1	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	6708	170
ITIH2	3698	broad.mit.edu	37	10	7763617	7763617	+	Silent	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:7763617C>T	uc001ijs.2	+	8	906	c.744C>T	c.(742-744)CAC>CAT	p.H248H		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	248					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						TCTAGGCGCACGTCTCCTTCA	0.587													50	29	---	---	---	---	capture	Silent	SNP	7763617	7763617	ITIH2	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7827	170
EXOC6	54536	broad.mit.edu	37	10	94653171	94653171	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:94653171G>A	uc001kig.2	+	2	233	c.167G>A	c.(166-168)CGT>CAT	p.R56H	EXOC6_uc010qnr.1_Missense_Mutation_p.R72H|EXOC6_uc001kie.2_Missense_Mutation_p.R51H|EXOC6_uc001kif.3_Missense_Mutation_p.R56H|EXOC6_uc009xub.2_Missense_Mutation_p.R56H|EXOC6_uc009xuc.2_Missense_Mutation_p.R56H	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a	56					protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				GCTTGTATCCGTAATCATGAC	0.333													3	48	---	---	---	---	capture	Missense_Mutation	SNP	94653171	94653171	EXOC6	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5263	170
SORBS1	10580	broad.mit.edu	37	10	97194458	97194458	+	Missense_Mutation	SNP	T	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:97194458T>A	uc001kkp.2	-	3	138	c.93A>T	c.(91-93)TTA>TTT	p.L31F	SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Missense_Mutation_p.L19F|SORBS1_uc001kko.2_Missense_Mutation_p.L31F|SORBS1_uc001kkq.2_Missense_Mutation_p.L31F|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Missense_Mutation_p.L31F|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Missense_Mutation_p.L31F|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron|SORBS1_uc001kkx.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	31					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AGCGTGCGCGTAAAGGGTCGG	0.483													12	21	---	---	---	---	capture	Missense_Mutation	SNP	97194458	97194458	SORBS1	10	T	A	A	A	1	0	0	0	0	1	0	0	0	738	57	4	4	14819	170
NLRP14	338323	broad.mit.edu	37	11	7065151	7065151	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7065151A>G	uc001mfb.1	+	4	2217	c.1894A>G	c.(1894-1896)AGG>GGG	p.R632G		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	632					cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GCGGACCATCAGGCTGTCTGT	0.423													3	89	---	---	---	---	capture	Missense_Mutation	SNP	7065151	7065151	NLRP14	11	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	10383	170
OR5AN1	390195	broad.mit.edu	37	11	59132528	59132528	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59132528G>A	uc010rks.1	+	1	597	c.597G>A	c.(595-597)ATG>ATA	p.M199I		NM_001004729	NP_001004729	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN,	199	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TACAGGTCATGACTGCTATAT	0.408													74	109	---	---	---	---	capture	Missense_Mutation	SNP	59132528	59132528	OR5AN1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11047	170
ATM	472	broad.mit.edu	37	11	108172455	108172455	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108172455A>G	uc001pkb.1	+	35	5643	c.5258A>G	c.(5257-5259)TAT>TGT	p.Y1753C	ATM_uc009yxr.1_Missense_Mutation_p.Y1753C|ATM_uc001pke.1_Missense_Mutation_p.Y405C|ATM_uc001pkg.1_Missense_Mutation_p.Y110C|ATM_uc009yxt.1_5'Flank	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1753					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		TGGGAGATTTATAAGATGACA	0.343			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			57	56	---	---	---	---	capture	Missense_Mutation	SNP	108172455	108172455	ATM	11	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	1100	170
BUD13	84811	broad.mit.edu	37	11	116633616	116633616	+	Missense_Mutation	SNP	C	T	T	rs139478949		TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:116633616C>T	uc001ppn.2	-	4	723	c.689G>A	c.(688-690)CGA>CAA	p.R230Q	BUD13_uc001ppo.2_Intron|BUD13_uc009yzc.2_Missense_Mutation_p.R230Q	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog isoform 1	230	Arg-rich.									large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		ATGACGGGCTCGCCTAGGAGG	0.532													77	104	---	---	---	---	capture	Missense_Mutation	SNP	116633616	116633616	BUD13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1561	170
TIMELESS	8914	broad.mit.edu	37	12	56822356	56822356	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56822356C>T	uc001slf.2	-	12	1553	c.1385G>A	c.(1384-1386)AGG>AAG	p.R462K	TIMELESS_uc001slg.2_Missense_Mutation_p.R461K	NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog	462					cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						GCTGCTCTCCCTCACAGCCTC	0.557													17	23	---	---	---	---	capture	Missense_Mutation	SNP	56822356	56822356	TIMELESS	12	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	15789	170
KCNC2	3747	broad.mit.edu	37	12	75601221	75601221	+	Silent	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:75601221G>A	uc001sxg.1	-	2	1087	c.543C>T	c.(541-543)GAC>GAT	p.D181D	KCNC2_uc009zry.2_Silent_p.D181D|KCNC2_uc001sxe.2_Silent_p.D181D|KCNC2_uc001sxf.2_Silent_p.D181D|KCNC2_uc010stw.1_Silent_p.D181D	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	181	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						GGTCCTCGTCGTCGCCGGGGT	0.726													3	6	---	---	---	---	capture	Silent	SNP	75601221	75601221	KCNC2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7937	170
NTN4	59277	broad.mit.edu	37	12	96076575	96076575	+	Missense_Mutation	SNP	T	G	G			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96076575T>G	uc001tei.2	-	7	1867	c.1418A>C	c.(1417-1419)CAT>CCT	p.H473P	NTN4_uc009ztf.2_Missense_Mutation_p.H473P|NTN4_uc009ztg.2_Missense_Mutation_p.H436P	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor	473					axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AGGAACTTCATGATACCAGTC	0.423													27	42	---	---	---	---	capture	Missense_Mutation	SNP	96076575	96076575	NTN4	12	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	10609	170
FOXA1	3169	broad.mit.edu	37	14	38061515	38061515	+	Silent	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38061515G>A	uc001wuf.2	-	2	786	c.474C>T	c.(472-474)GAC>GAT	p.D158D	FOXA1_uc010tpz.1_Silent_p.D125D	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	158					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		ACGTCTTGGCGTcgccgccgc	0.557													10	47	---	---	---	---	capture	Silent	SNP	38061515	38061515	FOXA1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5933	170
TMEM229B	161145	broad.mit.edu	37	14	67940157	67940157	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:67940157C>T	uc001xjk.2	-	3	894	c.484G>A	c.(484-486)GGC>AGC	p.G162S	TMEM229B_uc001xjj.1_RNA	NM_182526	NP_872332	Q8NBD8	T229B_HUMAN	transmembrane protein 229B	162	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(1)	1						TTGACATGGCCGTTGGCCAGG	0.632													27	68	---	---	---	---	capture	Missense_Mutation	SNP	67940157	67940157	TMEM229B	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16031	170
RPS6KL1	83694	broad.mit.edu	37	14	75388196	75388196	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75388196C>A	uc010tux.1	-	2	577	c.49G>T	c.(49-51)GAG>TAG	p.E17*	RPS6KL1_uc001xqw.2_Nonsense_Mutation_p.E17*|RPS6KL1_uc010asd.1_RNA|RPS6KL1_uc001xqy.1_Nonsense_Mutation_p.E17*	NM_031464	NP_113652	Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	17						ribosome	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00658)		GAGCAAGGCTCAGGCTCCAGG	0.607													3	50	---	---	---	---	capture	Nonsense_Mutation	SNP	75388196	75388196	RPS6KL1	14	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	13551	170
ACAN	176	broad.mit.edu	37	15	89386832	89386832	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89386832C>T	uc010upo.1	+	6	1378	c.1004C>T	c.(1003-1005)ACG>ATG	p.T335M	ACAN_uc002bmx.2_Missense_Mutation_p.T335M|ACAN_uc010upp.1_Missense_Mutation_p.T335M|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	335					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GCCAACCAGACGGGCTACCCC	0.657													17	43	---	---	---	---	capture	Missense_Mutation	SNP	89386832	89386832	ACAN	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	117	170
LRRK1	79705	broad.mit.edu	37	15	101567475	101567475	+	Silent	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101567475C>T	uc002bwr.2	+	18	2734	c.2415C>T	c.(2413-2415)TCC>TCT	p.S805S	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	805	Roc.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTGAGATTTCCTGCAAGAGCC	0.562													7	41	---	---	---	---	capture	Silent	SNP	101567475	101567475	LRRK1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	8947	170
WFIKKN2	124857	broad.mit.edu	37	17	48917794	48917794	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48917794C>T	uc002isv.3	+	2	1839	c.1145C>T	c.(1144-1146)CCG>CTG	p.P382L	WFIKKN2_uc010dbu.2_Missense_Mutation_p.P289L	NM_175575	NP_783165	Q8TEU8	WFKN2_HUMAN	WFIKKN2 protein	382						extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			ATGAGCGGGCCGCTGGCCGCG	0.652													26	41	---	---	---	---	capture	Missense_Mutation	SNP	48917794	48917794	WFIKKN2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17240	170
ABCA10	10349	broad.mit.edu	37	17	67188731	67188731	+	Missense_Mutation	SNP	C	T	T	rs138792982	byFrequency	TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67188731C>T	uc010dfa.1	-	17	2723	c.1844G>A	c.(1843-1845)CGA>CAA	p.R615Q	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Missense_Mutation_p.R216Q	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	615	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					ACCCCACTTTCGCTTCAGAAA	0.328													54	78	---	---	---	---	capture	Missense_Mutation	SNP	67188731	67188731	ABCA10	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	29	170
DNAH17	8632	broad.mit.edu	37	17	76557880	76557880	+	Silent	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76557880G>A	uc002jvv.1	-	8	964	c.858C>T	c.(856-858)CCC>CCT	p.P286P						RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GCCCGGCCACGGGAGGCATGT	0.577													3	18	---	---	---	---	capture	Silent	SNP	76557880	76557880	DNAH17	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4558	170
ANKRD12	23253	broad.mit.edu	37	18	9258903	9258903	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:9258903C>T	uc002knv.2	+	9	5895	c.5638C>T	c.(5638-5640)CCC>TCC	p.P1880S	ANKRD12_uc002knw.2_Missense_Mutation_p.P1857S|ANKRD12_uc002knx.2_Missense_Mutation_p.P1857S|ANKRD12_uc010dkx.1_Missense_Mutation_p.P1587S	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	1880						nucleus				ovary(2)|central_nervous_system(1)	3						GGATGGAAACCCCTTAAGCAA	0.303													33	89	---	---	---	---	capture	Missense_Mutation	SNP	9258903	9258903	ANKRD12	18	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	637	170
ATCAY	85300	broad.mit.edu	37	19	3907801	3907801	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3907801C>T	uc002lyy.3	+	5	858	c.428C>T	c.(427-429)ACG>ATG	p.T143M	ATCAY_uc010xhz.1_Missense_Mutation_p.T149M|ATCAY_uc010dts.2_5'Flank	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin	143					transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		GACGGCACGACGGAGGACGGC	0.637													23	58	---	---	---	---	capture	Missense_Mutation	SNP	3907801	3907801	ATCAY	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1068	170
LSM14A	26065	broad.mit.edu	37	19	34710329	34710329	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:34710329G>A	uc002nvb.3	+	7	1011	c.815G>A	c.(814-816)CGT>CAT	p.R272H	LSM14A_uc002nva.3_Missense_Mutation_p.R272H|LSM14A_uc010xru.1_Missense_Mutation_p.R231H|LSM14A_uc002nvc.3_Missense_Mutation_p.R78H	NM_001114093	NP_001107565	Q8ND56	LS14A_HUMAN	LSM14 homolog A isoform a	272					cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule				skin(1)	1	Esophageal squamous(110;0.162)					AGGAGAGGGCGTGGGGGTCAT	0.443													75	145	---	---	---	---	capture	Missense_Mutation	SNP	34710329	34710329	LSM14A	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8969	170
SDC1	6382	broad.mit.edu	37	2	20403674	20403674	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:20403674T>C	uc002rdo.1	-	3	826	c.527A>G	c.(526-528)CAC>CGC	p.H176R	SDC1_uc002rdp.1_Missense_Mutation_p.H176R|SDC1_uc010exv.2_Intron	NM_002997	NP_002988	P18827	SDC1_HUMAN	syndecan 1 precursor	176	Extracellular (Potential).				lipid metabolic process|lipoprotein metabolic process|myoblast development|striated muscle cell development	cytoplasm|extracellular region|focal adhesion|integral to plasma membrane	cytoskeletal protein binding|protein C-terminus binding			ovary(4)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		GTGGGGAGTGTGAAGGTCAGC	0.662													43	63	---	---	---	---	capture	Missense_Mutation	SNP	20403674	20403674	SDC1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	13844	170
CHGB	1114	broad.mit.edu	37	20	5903378	5903378	+	Silent	SNP	C	T	T	rs149359798	by1000genomes	TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5903378C>T	uc002wmg.2	+	4	894	c.588C>T	c.(586-588)AAC>AAT	p.N196N	CHGB_uc010zqz.1_Translation_Start_Site	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	196						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						AGACACAAAACGCTTTTCTCA	0.483													28	83	---	---	---	---	capture	Silent	SNP	5903378	5903378	CHGB	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3305	170
CD93	22918	broad.mit.edu	37	20	23066544	23066544	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23066544C>T	uc002wsv.2	-	1	434	c.286G>A	c.(286-288)GGG>AGG	p.G96R		NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN	CD93 antigen precursor	96	Extracellular (Potential).|C-type lectin.				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding			large_intestine(2)	2	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CGCTGGAGCCCAATCCAGAAC	0.642													5	16	---	---	---	---	capture	Missense_Mutation	SNP	23066544	23066544	CD93	20	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	3018	170
REM1	28954	broad.mit.edu	37	20	30070096	30070096	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30070096A>T	uc002wwa.2	+	4	714	c.430A>T	c.(430-432)AGC>TGC	p.S144C		NM_014012	NP_054731	O75628	REM1_HUMAN	RAS-like GTP-binding protein REM	144					small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GCAGGATAAAAGCTGGAGCCA	0.587													26	54	---	---	---	---	capture	Missense_Mutation	SNP	30070096	30070096	REM1	20	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	13117	170
RBL1	5933	broad.mit.edu	37	20	35690525	35690525	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35690525C>A	uc002xgi.2	-	8	1124	c.1045G>T	c.(1045-1047)GCT>TCT	p.A349S	RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.A349S|RBL1_uc010gfv.1_RNA	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a	349					cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				TCCACATTAGCCTGTGCTGTC	0.423													23	82	---	---	---	---	capture	Missense_Mutation	SNP	35690525	35690525	RBL1	20	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	13004	170
KRTAP11-1	337880	broad.mit.edu	37	21	32253366	32253366	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:32253366G>A	uc002yov.2	-	1	509	c.478C>T	c.(478-480)CGA>TGA	p.R160*		NM_175858	NP_787054	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	160						keratin filament	structural molecule activity			pancreas(1)	1						CAGGTTCTTCGGCAGCTGGAC	0.562													14	71	---	---	---	---	capture	Nonsense_Mutation	SNP	32253366	32253366	KRTAP11-1	21	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	8437	170
KCNH8	131096	broad.mit.edu	37	3	19574895	19574895	+	Silent	SNP	A	G	G			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:19574895A>G	uc003cbk.1	+	16	2823	c.2628A>G	c.(2626-2628)ACA>ACG	p.T876T	KCNH8_uc010hex.1_Silent_p.T337T	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	876	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						AGGTAACAACATTGACTCAGG	0.413													24	36	---	---	---	---	capture	Silent	SNP	19574895	19574895	KCNH8	3	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	7960	170
ERC2	26059	broad.mit.edu	37	3	56468977	56468977	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:56468977C>T	uc003dhr.1	-	2	315	c.59G>A	c.(58-60)CGT>CAT	p.R20H		NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110	20						cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		CCTTGGCAAACGAGGGGATCT	0.468													23	35	---	---	---	---	capture	Missense_Mutation	SNP	56468977	56468977	ERC2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5166	170
SLC33A1	9197	broad.mit.edu	37	3	155547581	155547581	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:155547581C>T	uc003fan.3	-	5	1759	c.1378G>A	c.(1378-1380)GGA>AGA	p.G460R	SLC33A1_uc003fao.1_Missense_Mutation_p.G460R|SLC33A1_uc003fap.1_RNA	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	460	Cytoplasmic (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GGCCAGTTTCCTCCCAGATTG	0.428													10	70	---	---	---	---	capture	Missense_Mutation	SNP	155547581	155547581	SLC33A1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	14458	170
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													3	7	---	---	---	---	capture	Missense_Mutation	SNP	195505836	195505836	MUC4	3	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	9888	170
ABCG2	9429	broad.mit.edu	37	4	89061129	89061129	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:89061129C>T	uc003hrg.2	-	2	512	c.19G>A	c.(19-21)GAA>AAA	p.E7K	ABCG2_uc003hrh.2_Missense_Mutation_p.E7K|ABCG2_uc003hri.1_Missense_Mutation_p.E7K|ABCG2_uc003hrj.1_Missense_Mutation_p.E7K|ABCG2_uc003hrk.1_Missense_Mutation_p.E7K	NM_004827	NP_004818	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G, member 2	7	Cytoplasmic (Potential).				cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)	ATAAAAACTTCGACATTACTG	0.413													9	25	---	---	---	---	capture	Missense_Mutation	SNP	89061129	89061129	ABCG2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	69	170
TRAM1L1	133022	broad.mit.edu	37	4	118005603	118005603	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:118005603A>G	uc003ibv.3	-	1	1134	c.947T>C	c.(946-948)ATT>ACT	p.I316T		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	316	Helical; (Potential).|TLC.				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1						CCAGAGAGTAATTAAGTTCCA	0.408													69	119	---	---	---	---	capture	Missense_Mutation	SNP	118005603	118005603	TRAM1L1	4	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	16335	170
DNAH5	1767	broad.mit.edu	37	5	13901576	13901576	+	Missense_Mutation	SNP	C	T	T	rs141072655		TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13901576C>T	uc003jfd.2	-	14	1879	c.1837G>A	c.(1837-1839)GAT>AAT	p.D613N		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	613	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGAGGAGGATCGTATTTCTGC	0.448									Kartagener_syndrome				18	17	---	---	---	---	capture	Missense_Mutation	SNP	13901576	13901576	DNAH5	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4561	170
PRDM9	56979	broad.mit.edu	37	5	23527545	23527545	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23527545G>A	uc003jgo.2	+	11	2530	c.2348G>A	c.(2347-2349)CGG>CAG	p.R783Q		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	783	C2H2-type 11.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GAGTGTGGGCGGGGCTTTAGA	0.577										HNSCC(3;0.000094)			53	86	---	---	---	---	capture	Missense_Mutation	SNP	23527545	23527545	PRDM9	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12359	170
EMB	133418	broad.mit.edu	37	5	49698154	49698154	+	Splice_Site	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:49698154C>T	uc003jom.2	-	7	1127	c.878_splice	c.e7-1	p.D293_splice	EMB_uc010ivq.2_Splice_Site_p.D87_splice|EMB_uc003jol.2_Splice_Site_p.D224_splice|EMB_uc011cpy.1_Splice_Site_p.D243_splice|EMB_uc010ivr.2_Splice_Site_p.D239_splice	NM_198449	NP_940851	Q6PCB8	EMB_HUMAN	embigin precursor							integral to membrane					0	Lung SC(58;0.218)	Lung NSC(810;0.0795)				TTCCCCTCATCTGTGTAACAA	0.318													11	38	---	---	---	---	capture	Splice_Site	SNP	49698154	49698154	EMB	5	C	T	T	T	1	0	0	0	0	0	0	1	0	416	32	5	2	5040	170
OCLN	4950	broad.mit.edu	37	5	68805174	68805174	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:68805174C>T	uc003jwu.2	+	3	693	c.257C>T	c.(256-258)ACG>ATG	p.T86M	OCLN_uc003jwv.3_Missense_Mutation_p.T86M	NM_002538	NP_002529			occludin												0		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		GTGGCCTCCACGCTTGCCTGG	0.478													65	101	---	---	---	---	capture	Missense_Mutation	SNP	68805174	68805174	OCLN	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10725	170
PKHD1	5314	broad.mit.edu	37	6	51491843	51491843	+	Missense_Mutation	SNP	G	A	A	rs151198392		TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51491843G>A	uc003pah.1	-	66	12013	c.11737C>T	c.(11737-11739)CGC>TGC	p.R3913C		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3913	Cytoplasmic (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GATTCTCGGCGTTTGGATGAG	0.433													28	163	---	---	---	---	capture	Missense_Mutation	SNP	51491843	51491843	PKHD1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11874	170
COL12A1	1303	broad.mit.edu	37	6	75898089	75898089	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:75898089C>A	uc003phs.2	-	8	1152	c.986G>T	c.(985-987)AGT>ATT	p.S329I	COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_5'UTR	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	329					cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TTCTTCTCCACTAACCAATTC	0.373													40	82	---	---	---	---	capture	Missense_Mutation	SNP	75898089	75898089	COL12A1	6	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	3634	170
DOPEY1	23033	broad.mit.edu	37	6	83841949	83841949	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:83841949C>T	uc003pjs.1	+	18	2931	c.2671C>T	c.(2671-2673)CAG>TAG	p.Q891*	DOPEY1_uc011dyy.1_Nonsense_Mutation_p.Q882*|DOPEY1_uc010kbl.1_Nonsense_Mutation_p.Q882*	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	891					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TCAGCATCACCAGAAGAGTGT	0.373													44	61	---	---	---	---	capture	Nonsense_Mutation	SNP	83841949	83841949	DOPEY1	6	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	4663	170
PREP	5550	broad.mit.edu	37	6	105771589	105771589	+	Missense_Mutation	SNP	C	T	T	rs141737006		TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:105771589C>T	uc003prc.2	-	10	1471	c.1268G>A	c.(1267-1269)CGA>CAA	p.R423Q		NM_002726	NP_002717	P48147	PPCE_HUMAN	prolyl endopeptidase	423					proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	GGTCACCTCTCGGAAAACTCT	0.408													33	83	---	---	---	---	capture	Missense_Mutation	SNP	105771589	105771589	PREP	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12370	170
DNAH11	8701	broad.mit.edu	37	7	21939697	21939697	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21939697C>T	uc003svc.2	+	82	13314	c.13283C>T	c.(13282-13284)CCG>CTG	p.P4428L		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4428					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TATGGACACCCGCCAAGGGAA	0.488									Kartagener_syndrome				11	47	---	---	---	---	capture	Missense_Mutation	SNP	21939697	21939697	DNAH11	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4557	170
PPP1R9A	55607	broad.mit.edu	37	7	94879506	94879506	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94879506T>C	uc003unp.2	+	9	2551	c.2269T>C	c.(2269-2271)TAT>CAT	p.Y757H	PPP1R9A_uc010lfj.2_Missense_Mutation_p.Y779H|PPP1R9A_uc011kif.1_Missense_Mutation_p.Y757H|PPP1R9A_uc003unq.2_Missense_Mutation_p.Y757H|PPP1R9A_uc011kig.1_Missense_Mutation_p.Y757H	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	757	Interacts with TGN38 (By similarity).|Potential.					cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TCAAAGCCAGTATCAGGCCTT	0.373										HNSCC(28;0.073)			26	41	---	---	---	---	capture	Missense_Mutation	SNP	94879506	94879506	PPP1R9A	7	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	12279	170
IRF5	3663	broad.mit.edu	37	7	128585975	128585975	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128585975G>A	uc003vog.2	+	3	393	c.272G>A	c.(271-273)CGC>CAC	p.R91H	IRF5_uc010llr.1_Missense_Mutation_p.R91H|IRF5_uc011kot.1_Missense_Mutation_p.R91H|IRF5_uc011kou.1_Missense_Mutation_p.R91H|IRF5_uc010lls.1_Missense_Mutation_p.R91H|IRF5_uc003voh.2_Missense_Mutation_p.R91H|IRF5_uc010llt.2_Missense_Mutation_p.R91H|IRF5_uc003voi.2_Missense_Mutation_p.R91H|IRF5_uc010llu.1_Missense_Mutation_p.R91H|IRF5_uc003vok.2_Missense_Mutation_p.R91H|IRF5_uc003voj.3_Missense_Mutation_p.R91H|IRF5_uc010llv.1_Missense_Mutation_p.R91H|IRF5_uc010llw.1_Missense_Mutation_p.R91H	NM_002200	NP_002191	Q13568	IRF5_HUMAN	interferon regulatory factor 5 isoform a	91	IRF tryptophan pentad repeat.				interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						GCCAACCTGCGCTGTGCCCTT	0.612													29	59	---	---	---	---	capture	Missense_Mutation	SNP	128585975	128585975	IRF5	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7756	170
OR2A12	346525	broad.mit.edu	37	7	143792799	143792799	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143792799C>T	uc011kty.1	+	1	599	c.599C>T	c.(598-600)GCG>GTG	p.A200V		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	200	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.A200V(1)		ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					GTCCTATTTGCGGGTTCTGCG	0.532													66	224	---	---	---	---	capture	Missense_Mutation	SNP	143792799	143792799	OR2A12	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10879	170
CSMD1	64478	broad.mit.edu	37	8	3057257	3057257	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:3057257C>T	uc011kwk.1	-	33	5566	c.5176G>A	c.(5176-5178)GGC>AGC	p.G1726S	CSMD1_uc011kwj.1_Missense_Mutation_p.G1118S|CSMD1_uc003wqe.2_Missense_Mutation_p.G882S	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1726	Extracellular (Potential).|CUB 10.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAGTGGAAGCCGCGGGCAGAG	0.512													3	6	---	---	---	---	capture	Missense_Mutation	SNP	3057257	3057257	CSMD1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3909	170
MSR1	4481	broad.mit.edu	37	8	15978016	15978016	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:15978016C>T	uc003wwz.2	-	9	1331	c.1133G>A	c.(1132-1134)CGC>CAC	p.R378H	MSR1_uc010lsu.2_Missense_Mutation_p.R396H|MSR1_uc003wxa.2_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	378	SRCR.|Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CACTTCCCAGCGATCGTCACA	0.562													29	112	---	---	---	---	capture	Missense_Mutation	SNP	15978016	15978016	MSR1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9796	170
CDCA2	157313	broad.mit.edu	37	8	25341581	25341581	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25341581C>A	uc003xep.1	+	10	1699	c.1220C>A	c.(1219-1221)TCT>TAT	p.S407Y	PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.S407Y|CDCA2_uc003xeq.1_Missense_Mutation_p.S392Y|CDCA2_uc003xer.1_Missense_Mutation_p.S70Y	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	407					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		TTTGATGAATCTTTGCCAGCA	0.428													25	53	---	---	---	---	capture	Missense_Mutation	SNP	25341581	25341581	CDCA2	8	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	3057	170
PKHD1L1	93035	broad.mit.edu	37	8	110424605	110424605	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110424605C>T	uc003yne.2	+	20	2301	c.2197C>T	c.(2197-2199)CGA>TGA	p.R733*		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	733	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACCAAACAGACGACCATATGG	0.368										HNSCC(38;0.096)			13	20	---	---	---	---	capture	Nonsense_Mutation	SNP	110424605	110424605	PKHD1L1	8	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	11875	170
ZNF250	58500	broad.mit.edu	37	8	146108024	146108024	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:146108024T>C	uc003zeq.3	-	6	676	c.559A>G	c.(559-561)ACT>GCT	p.T187A	COMMD5_uc010mgf.2_Intron|ZNF250_uc003zer.3_Missense_Mutation_p.T182A|ZNF250_uc010mgg.2_Missense_Mutation_p.T182A	NM_021061	NP_066405	P15622	ZN250_HUMAN	zinc finger protein 250 isoform a	187					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		TGGTGCGGAGTGAGTGGCATG	0.498													41	55	---	---	---	---	capture	Missense_Mutation	SNP	146108024	146108024	ZNF250	8	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	17675	170
MOBKL2B	79817	broad.mit.edu	37	9	27455216	27455216	+	Silent	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27455216C>T	uc003zqn.2	-	2	829	c.333G>A	c.(331-333)GCG>GCA	p.A111A		NM_024761	NP_079037	Q86TA1	MOL2B_HUMAN	MOB1, Mps One Binder kinase activator-like 2B	111							metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)		GAGCTGGCAGCGCTGTTGGCT	0.488													38	14	---	---	---	---	capture	Silent	SNP	27455216	27455216	MOBKL2B	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9597	170
FBP2	8789	broad.mit.edu	37	9	97329591	97329591	+	Silent	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97329591C>T	uc004auv.2	-	5	733	c.666G>A	c.(664-666)GCG>GCA	p.A222A	uc004aus.1_Intron|uc004aut.1_Intron|uc004auu.2_Intron	NM_003837	NP_003828	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	222					fructose metabolic process|gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)				CAGTGGTGGCCGCATCAAAAT	0.463													84	87	---	---	---	---	capture	Silent	SNP	97329591	97329591	FBP2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5652	170
ARSE	415	broad.mit.edu	37	X	2873479	2873479	+	Silent	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2873479C>T	uc004crc.3	-	4	535	c.285G>A	c.(283-285)ACG>ACA	p.T95T	ARSE_uc011mhi.1_Silent_p.T41T|ARSE_uc011mhh.1_Silent_p.T120T	NM_000047	NP_000038	P51690	ARSE_HUMAN	arylsulfatase E precursor	95					skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGTATCTGCCCGTGAGGAAGG	0.527													5	28	---	---	---	---	capture	Silent	SNP	2873479	2873479	ARSE	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	983	170
TLR7	51284	broad.mit.edu	37	X	12903821	12903821	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12903821C>T	uc004cvc.2	+	3	333	c.194C>T	c.(193-195)ACG>ATG	p.T65M		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	65	Extracellular (Potential).|LRR 2.				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	GGTATTCCCACGAACACCACG	0.488													64	77	---	---	---	---	capture	Missense_Mutation	SNP	12903821	12903821	TLR7	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15841	170
DMD	1756	broad.mit.edu	37	X	32407637	32407637	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32407637G>A	uc004dda.1	-	32	4743	c.4499C>T	c.(4498-4500)TCA>TTA	p.S1500L	DMD_uc004dcw.2_Missense_Mutation_p.S156L|DMD_uc004dcx.2_Missense_Mutation_p.S159L|DMD_uc004dcz.2_Missense_Mutation_p.S1377L|DMD_uc004dcy.1_Missense_Mutation_p.S1496L|DMD_uc004ddb.1_Missense_Mutation_p.S1492L|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1500	Spectrin 10.|Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATTTAGCTGTGACTGTACTAC	0.393													57	72	---	---	---	---	capture	Missense_Mutation	SNP	32407637	32407637	DMD	23	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	4538	170
P2RY10	27334	broad.mit.edu	37	X	78216970	78216970	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78216970G>A	uc004ede.2	+	4	1322	c.953G>A	c.(952-954)CGC>CAC	p.R318H	P2RY10_uc004edf.2_Missense_Mutation_p.R318H	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	318	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						CAACTATCCCGCCATGGCAGT	0.438													75	95	---	---	---	---	capture	Missense_Mutation	SNP	78216970	78216970	P2RY10	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11251	170
RPA4	29935	broad.mit.edu	37	X	96139918	96139918	+	Silent	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:96139918C>T	uc004efv.3	+	1	907	c.609C>T	c.(607-609)GAC>GAT	p.D203D	DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	NM_013347	NP_037479	Q13156	RFA4_HUMAN	replication protein A4, 34kDa	203					DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding				0						TCATCCAGGACGAAGTGCTGC	0.522								Other_identified_genes_with_known_or_suspected_DNA_repair_function					36	62	---	---	---	---	capture	Silent	SNP	96139918	96139918	RPA4	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13431	170
RAB9B	51209	broad.mit.edu	37	X	103080537	103080537	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:103080537T>C	uc004ell.1	-	3	463	c.178A>G	c.(178-180)ATC>GTC	p.I60V	RAB9B_uc004eli.1_Intron	NM_016370	NP_057454	Q9NP90	RAB9B_HUMAN	RAB9B, member RAS oncogene family	60					Golgi to endosome transport|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			lung(3)	3						GTGTCCCAGATCTGGAGGGTT	0.507													33	65	---	---	---	---	capture	Missense_Mutation	SNP	103080537	103080537	RAB9B	23	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	12854	170
KLHL13	90293	broad.mit.edu	37	X	117043525	117043525	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117043525A>T	uc004eql.2	-	5	1167	c.1105T>A	c.(1105-1107)TGG>AGG	p.W369R	KLHL13_uc004eqk.2_Missense_Mutation_p.W318R|KLHL13_uc011mtn.1_Missense_Mutation_p.W209R|KLHL13_uc011mto.1_Missense_Mutation_p.W363R|KLHL13_uc011mtp.1_Missense_Mutation_p.W371R|KLHL13_uc004eqm.2_Missense_Mutation_p.W318R|KLHL13_uc011mtq.1_Missense_Mutation_p.W353R	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	369	Kelch 1.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						AACGATTTCCACTCATGGGCC	0.493													23	102	---	---	---	---	capture	Missense_Mutation	SNP	117043525	117043525	KLHL13	23	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	8289	170
MAGEA8	4107	broad.mit.edu	37	X	149013837	149013837	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149013837C>T	uc004fdw.1	+	3	1006	c.791C>T	c.(790-792)GCG>GTG	p.A264V		NM_005364	NP_005355	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	264	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					TACCGCCAGGCGCCCGGCAGT	0.577													89	116	---	---	---	---	capture	Missense_Mutation	SNP	149013837	149013837	MAGEA8	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9085	170
PNCK	139728	broad.mit.edu	37	X	152937465	152937465	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152937465C>T	uc011myu.1	-	5	719	c.533G>A	c.(532-534)GGT>GAT	p.G178D	PNCK_uc011myt.1_Missense_Mutation_p.G112D|PNCK_uc004fia.2_Missense_Mutation_p.G107D|PNCK_uc004fhz.3_Translation_Start_Site|PNCK_uc010nuh.2_3'UTR|PNCK_uc011myv.1_Missense_Mutation_p.G122D|PNCK_uc011myw.1_Missense_Mutation_p.G122D	NM_001039582	NP_001034671	Q6P2M8	KCC1B_HUMAN	pregnancy upregulated non-ubiquitously expressed	95	Protein kinase.					cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGCTCGCCACCCGTCACCCT	0.662													9	35	---	---	---	---	capture	Missense_Mutation	SNP	152937465	152937465	PNCK	23	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	12048	170
RAB39B	116442	broad.mit.edu	37	X	154490194	154490194	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154490194T>C	uc004fne.2	-	2	815	c.536A>G	c.(535-537)GAG>GGG	p.E179G		NM_171998	NP_741995	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	179					protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GATTGTAATCTCCCCCCTTTT	0.463													20	100	---	---	---	---	capture	Missense_Mutation	SNP	154490194	154490194	RAB39B	23	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	12825	170
HOMER3	9454	broad.mit.edu	37	19	19043763	19043784	+	Frame_Shift_Del	DEL	CGCTCTGTGGGGCCGGGGGCAT	-	-	rs147820524	byFrequency	TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19043763_19043784delCGCTCTGTGGGGCCGGGGGCAT	uc002nku.2	-	5	1135_1156	c.482_503delATGCCCCCGGCCCCACAGAGCG	c.(481-504)GATGCCCCCGGCCCCACAGAGCGCfs	p.D161fs	HOMER3_uc002nko.1_RNA|HOMER3_uc002nkp.1_RNA|HOMER3_uc010eby.2_Frame_Shift_Del_p.D125fs|HOMER3_uc010ebz.2_Frame_Shift_Del_p.D161fs|HOMER3_uc002nkw.2_Frame_Shift_Del_p.D161fs|HOMER3_uc002nkv.2_Frame_Shift_Del_p.D161fs	NM_004838	NP_004829	Q9NSC5	HOME3_HUMAN	Homer, neuronal immediate early gene, 3 isoform	161_168					metabotropic glutamate receptor signaling pathway|protein targeting	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	protein binding				0			Epithelial(12;0.0107)			TAGCCGCTCGCGCTCTGTGGGGCCGGGGGCATCAGCGCTCTG	0.437													9	69	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	19043763	19043784	HOMER3	19	CGCTCTGTGGGGCCGGGGGCAT	-	-	-	1	0	1	0	1	0	0	0	0	351	27	5	5	7205	170
DGAT1	8694	broad.mit.edu	37	8	145541816	145541818	+	In_Frame_Del	DEL	CTT	-	-			TCGA-19-5950-01	TCGA-19-5950-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145541816_145541818delCTT	uc003zbv.3	-	8	959_961	c.691_693delAAG	c.(691-693)AAGdel	p.K231del	DGAT1_uc010mfv.2_Intron	NM_012079	NP_036211	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	231	Helical; (Potential).				triglyceride biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane	diacylglycerol O-acyltransferase activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			CACTGCTGGCCTTCTTCCCTGCA	0.709													16	58	---	---	---	---	capture_indel	In_Frame_Del	DEL	145541816	145541818	DGAT1	8	CTT	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	4415	170
