Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIF17	57576	broad.mit.edu	37	1	21009246	21009246	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21009246G>A	uc001bdr.3	-	11	2481	c.2363C>T	c.(2362-2364)TCG>TTG	p.S788L	KIF17_uc001bdp.3_Missense_Mutation_p.S66L|KIF17_uc001bdq.3_Missense_Mutation_p.S66L|KIF17_uc009vpx.2_Missense_Mutation_p.S158L|KIF17_uc001bds.3_Missense_Mutation_p.S788L	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	788	Potential.				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GTCCTCATCCGAGTTCTGCAG	0.607													15	37	---	---	---	---	capture	Missense_Mutation	SNP	21009246	21009246	KIF17	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8201	171
DNALI1	7802	broad.mit.edu	37	1	38025070	38025070	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38025070C>T	uc001cbj.2	+	3	446	c.436C>T	c.(436-438)CGC>TGC	p.R146C	DNALI1_uc010oie.1_Intron	NM_003462	NP_003453	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	124					cellular component movement|single fertilization	axonemal dynein complex	microtubule motor activity			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGCCCTGTCCGCAGGGAACT	0.587													17	27	---	---	---	---	capture	Missense_Mutation	SNP	38025070	38025070	DNALI1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4615	171
TIE1	7075	broad.mit.edu	37	1	43784978	43784978	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43784978G>T	uc001ciu.2	+	18	3074	c.2995G>T	c.(2995-2997)GGC>TGC	p.G999C	TIE1_uc010oke.1_Missense_Mutation_p.G954C|TIE1_uc009vwq.2_Missense_Mutation_p.G955C|TIE1_uc010okg.1_Missense_Mutation_p.G644C	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	999	Cytoplasmic (Potential).|Protein kinase.				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGCAGACTTCGGCCTTTCTCG	0.577													28	56	---	---	---	---	capture	Missense_Mutation	SNP	43784978	43784978	TIE1	1	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	15778	171
FLG	2312	broad.mit.edu	37	1	152284263	152284263	+	Silent	SNP	G	A	A	rs146128865	byFrequency	TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152284263G>A	uc001ezu.1	-	3	3135	c.3099C>T	c.(3097-3099)CAC>CAT	p.H1033H	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1033	Filaggrin 6.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCGGGATCCGTGTCTTTCTC	0.567									Ichthyosis				16	576	---	---	---	---	capture	Silent	SNP	152284263	152284263	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5867	171
LCE3A	353142	broad.mit.edu	37	1	152595450	152595450	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152595450C>T	uc010pdt.1	-	1	130	c.130G>A	c.(130-132)GAG>AAG	p.E44K		NM_178431	NP_848518	Q5TA76	LCE3A_HUMAN	late cornified envelope 3A	44					keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGCTGCGCTCGGAGCTGGGC	0.657													28	31	---	---	---	---	capture	Missense_Mutation	SNP	152595450	152595450	LCE3A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8589	171
HMCN1	83872	broad.mit.edu	37	1	186045741	186045741	+	Silent	SNP	A	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186045741A>G	uc001grq.1	+	54	8701	c.8472A>G	c.(8470-8472)GTA>GTG	p.V2824V		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2824	Ig-like C2-type 26.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GTGATAAAGTATTGATTTTGC	0.428													21	43	---	---	---	---	capture	Silent	SNP	186045741	186045741	HMCN1	1	A	G	G	G	1	0	0	0	0	0	0	0	1	197	16	3	3	7145	171
LEFTY2	7044	broad.mit.edu	37	1	226127598	226127598	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226127598G>A	uc001hpt.1	-	2	435	c.355C>T	c.(355-357)CGG>TGG	p.R119W	LEFTY2_uc010pvk.1_Intron|LEFTY2_uc009xek.1_Intron	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	119					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					TGGAAGAGCCGCAGCACGGCC	0.741													7	6	---	---	---	---	capture	Missense_Mutation	SNP	226127598	226127598	LEFTY2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	8636	171
OR2T1	26696	broad.mit.edu	37	1	248569915	248569915	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248569915T>C	uc010pzm.1	+	1	620	c.620T>C	c.(619-621)TTC>TCC	p.F207S		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	207	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTGGATGGCTTCCTCCTAACC	0.537													30	40	---	---	---	---	capture	Missense_Mutation	SNP	248569915	248569915	OR2T1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	10920	171
OR51A7	119687	broad.mit.edu	37	11	4929295	4929295	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4929295G>T	uc010qyq.1	+	1	696	c.696G>T	c.(694-696)GAG>GAT	p.E232D		NM_001004749	NP_001004749	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTTGGCAGAGAGGCTTAAGG	0.478													64	76	---	---	---	---	capture	Missense_Mutation	SNP	4929295	4929295	OR51A7	11	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	10992	171
OR52B6	340980	broad.mit.edu	37	11	5602633	5602633	+	Missense_Mutation	SNP	T	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5602633T>A	uc010qzi.1	+	1	527	c.527T>A	c.(526-528)TTT>TAT	p.F176Y	HBG2_uc001mak.1_Intron	NM_001005162	NP_001005162	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B,	176	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCATTATGTTTCCATCCATC	0.498													102	125	---	---	---	---	capture	Missense_Mutation	SNP	5602633	5602633	OR52B6	11	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	11017	171
PIK3C2A	5286	broad.mit.edu	37	11	17111388	17111388	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:17111388C>T	uc001mmq.3	-	32	5024	c.4958G>A	c.(4957-4959)CGG>CAG	p.R1653Q	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Missense_Mutation_p.R1273Q|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	1653	C2.				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	AAAATTCTCCCGCAGAGATTC	0.413													138	157	---	---	---	---	capture	Missense_Mutation	SNP	17111388	17111388	PIK3C2A	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11812	171
MS4A14	84689	broad.mit.edu	37	11	60184370	60184370	+	Silent	SNP	T	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60184370T>C	uc001npj.2	+	5	2494	c.1929T>C	c.(1927-1929)GAT>GAC	p.D643D	MS4A14_uc001npi.2_Silent_p.D531D|MS4A14_uc001npn.2_Silent_p.D381D|MS4A14_uc001npk.2_Silent_p.D626D|MS4A14_uc001npl.2_Silent_p.D381D|MS4A14_uc001npm.2_Silent_p.D381D	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	643	Gln-rich.					integral to membrane	receptor activity			breast(1)	1						TATGCCAAGATTCAGAATCCC	0.473													3	61	---	---	---	---	capture	Silent	SNP	60184370	60184370	MS4A14	11	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	9768	171
RBM4	5936	broad.mit.edu	37	11	66411465	66411465	+	Silent	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66411465C>T	uc009yrj.2	+	3	1445	c.957C>T	c.(955-957)CCC>CCT	p.P319P	RBM4_uc009yrk.2_Silent_p.P294P|RBM4_uc001oiw.1_Silent_p.P319P|RBM4_uc001oix.1_Intron|RBM4_uc010rpj.1_Intron|RBM4_uc001oiy.1_Silent_p.P319P|RBM4_uc001oiz.1_Silent_p.P319P	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	319	Interaction with TNPO3.				circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		CCCCAGTCCCCACTGTTGGAG	0.493													44	57	---	---	---	---	capture	Silent	SNP	66411465	66411465	RBM4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	13029	171
POU2AF1	5450	broad.mit.edu	37	11	111229596	111229596	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111229596C>T	uc001plg.3	-	2	319	c.64G>A	c.(64-66)GTC>ATC	p.V22I		NM_006235	NP_006226	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	22					humoral immune response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			kidney(1)	1		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		TTCACACGGACGCCCTGGTAT	0.627			T	BCL6	NHL								19	25	---	---	---	---	capture	Missense_Mutation	SNP	111229596	111229596	POU2AF1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12171	171
CD3E	916	broad.mit.edu	37	11	118183512	118183512	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118183512T>C	uc001psq.3	+	6	539	c.283T>C	c.(283-285)TAT>CAT	p.Y95H	CD3E_uc010rya.1_Missense_Mutation_p.Y95H	NM_000733	NP_000724	P07766	CD3E_HUMAN	CD3E antigen, epsilon polypeptide precursor	95	Extracellular (Potential).|Ig-like.				G-protein coupled receptor protein signaling pathway|signal complex assembly|T cell costimulation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	external side of plasma membrane|integral to plasma membrane	protein heterodimerization activity|protein kinase binding|receptor signaling complex scaffold activity|receptor signaling protein activity|SH3 domain binding|T cell receptor binding|transmembrane receptor activity			ovary(2)	2	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.09e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0251)	Muromonab(DB00075)	GCAAAGTGGTTATTATGTCTG	0.443													47	60	---	---	---	---	capture	Missense_Mutation	SNP	118183512	118183512	CD3E	11	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	2982	171
MFRP	83552	broad.mit.edu	37	11	119215663	119215663	+	Silent	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119215663G>A	uc001pwj.2	-	6	853	c.693C>T	c.(691-693)CTC>CTT	p.L231L	MFRP_uc010rzf.1_RNA|MFRP_uc010rzg.1_Silent_p.L231L	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein	Error:Variant_position_missing_in_Q9BXJ0_after_alignment						collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		AGACCACCAGGAGGTGGCTGG	0.617													8	9	---	---	---	---	capture	Silent	SNP	119215663	119215663	MFRP	11	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	9438	171
OR10G7	390265	broad.mit.edu	37	11	123909127	123909127	+	Silent	SNP	G	A	A	rs147011748	byFrequency	TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123909127G>A	uc001pzq.1	-	1	582	c.582C>T	c.(580-582)AAC>AAT	p.N194N		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TGACCATCTCGTTGGCTGAGG	0.537													95	151	---	---	---	---	capture	Silent	SNP	123909127	123909127	OR10G7	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10806	171
ACSM4	341392	broad.mit.edu	37	12	7456944	7456944	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7456944G>A	uc001qsx.1	+	1	17	c.17G>A	c.(16-18)CGC>CAC	p.R6H		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	6					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						ATTTTTTTCCGCTACCAGACA	0.468													73	99	---	---	---	---	capture	Missense_Mutation	SNP	7456944	7456944	ACSM4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	186	171
SLCO1B3	28234	broad.mit.edu	37	12	21036410	21036410	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21036410C>T	uc001rek.2	+	12	1682	c.1556C>T	c.(1555-1557)GCA>GTA	p.A519V	SLCO1B3_uc001rel.2_Missense_Mutation_p.A519V|SLCO1B3_uc010sil.1_Missense_Mutation_p.A519V|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.A344V	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	519	Extracellular (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					AATTACTCAGCACACTTGGGT	0.338													16	51	---	---	---	---	capture	Missense_Mutation	SNP	21036410	21036410	SLCO1B3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	14616	171
ABCC9	10060	broad.mit.edu	37	12	21997448	21997448	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21997448C>T	uc001rfi.1	-	26	3304	c.3284G>A	c.(3283-3285)CGC>CAC	p.R1095H	ABCC9_uc001rfh.2_Missense_Mutation_p.R1095H|ABCC9_uc001rfj.1_Missense_Mutation_p.R1059H	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1095	ABC transmembrane type-1 2.|Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGCTGAAAAGCGATTGAGAAT	0.353													32	72	---	---	---	---	capture	Missense_Mutation	SNP	21997448	21997448	ABCC9	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	59	171
STK38L	23012	broad.mit.edu	37	12	27467499	27467499	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27467499A>G	uc001rhr.2	+	7	779	c.580A>G	c.(580-582)ATT>GTT	p.I194V	STK38L_uc001rhs.2_RNA|STK38L_uc010sjm.1_Missense_Mutation_p.I101V|STK38L_uc010sjn.1_5'UTR	NM_015000	NP_055815	Q9Y2H1	ST38L_HUMAN	serine/threonine kinase 38 like	194	Protein kinase.				intracellular protein kinase cascade|regulation of cellular component organization	actin cytoskeleton|cytoplasm	actin binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|kidney(1)	5	Colorectal(261;0.0847)					ACAGTTCTACATTTCAGAGAC	0.378													53	47	---	---	---	---	capture	Missense_Mutation	SNP	27467499	27467499	STK38L	12	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	15194	171
CACNB3	784	broad.mit.edu	37	12	49218455	49218455	+	Silent	SNP	A	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49218455A>G	uc001rsl.1	+	5	612	c.411A>G	c.(409-411)AGA>AGG	p.R137R	CACNB3_uc010slx.1_Silent_p.R124R|CACNB3_uc010sly.1_Silent_p.R124R|CACNB3_uc010slz.1_Silent_p.R136R|CACNB3_uc001rsk.1_5'UTR	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3	137					axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	TTCTCAGGAGATCTGGGAACC	0.483													25	29	---	---	---	---	capture	Silent	SNP	49218455	49218455	CACNB3	12	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	2530	171
RNF17	56163	broad.mit.edu	37	13	25444863	25444863	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25444863C>T	uc001upr.2	+	32	4474	c.4433C>T	c.(4432-4434)ACG>ATG	p.T1478M	RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.T1474M|RNF17_uc001ups.2_Missense_Mutation_p.T1417M|RNF17_uc010aac.2_Missense_Mutation_p.T670M|RNF17_uc010aad.2_Missense_Mutation_p.T488M	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1478					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CCTCCTCTGACGGATTTTAGA	0.423													34	34	---	---	---	---	capture	Missense_Mutation	SNP	25444863	25444863	RNF17	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13353	171
PCDH20	64881	broad.mit.edu	37	13	61985634	61985634	+	Silent	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:61985634C>T	uc001vid.3	-	2	2962	c.2598G>A	c.(2596-2598)GAG>GAA	p.E866E	PCDH20_uc010thj.1_Silent_p.E866E	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	839	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GTTCTTTCTCCTCTATATTAA	0.393													28	29	---	---	---	---	capture	Silent	SNP	61985634	61985634	PCDH20	13	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	11418	171
OR4K17	390436	broad.mit.edu	37	14	20586156	20586156	+	Silent	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20586156G>A	uc001vwo.1	+	1	591	c.591G>A	c.(589-591)TTG>TTA	p.L197L		NM_001004715	NP_001004715	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CTGTGAACTTGCCCTTTTGTG	0.428													91	114	---	---	---	---	capture	Silent	SNP	20586156	20586156	OR4K17	14	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	10975	171
CLEC14A	161198	broad.mit.edu	37	14	38724256	38724256	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38724256G>T	uc001wum.1	-	1	1319	c.972C>A	c.(970-972)GAC>GAA	p.D324E		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	324	Extracellular (Potential).					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		CCAGCTTCTCGTCGACCCTGA	0.602													75	82	---	---	---	---	capture	Missense_Mutation	SNP	38724256	38724256	CLEC14A	14	G	T	T	T	1	0	0	0	0	1	0	0	0	516	40	4	4	3464	171
PLEKHG3	26030	broad.mit.edu	37	14	65208951	65208951	+	Missense_Mutation	SNP	C	G	G	rs150120531	byFrequency	TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:65208951C>G	uc001xho.1	+	16	2985	c.2716C>G	c.(2716-2718)CGC>GGC	p.R906G	PLEKHG3_uc001xhn.1_Missense_Mutation_p.R850G|PLEKHG3_uc001xhp.2_Missense_Mutation_p.R1027G|PLEKHG3_uc010aqh.1_Missense_Mutation_p.R448G|PLEKHG3_uc001xhq.1_Missense_Mutation_p.R411G	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	906					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		ACTGCACCCCCGCATCGTGCA	0.662													27	40	---	---	---	---	capture	Missense_Mutation	SNP	65208951	65208951	PLEKHG3	14	C	G	G	G	1	0	0	0	0	1	0	0	0	299	23	4	4	11973	171
AK7	122481	broad.mit.edu	37	14	96864516	96864516	+	Missense_Mutation	SNP	A	T	T	rs17853407		TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96864516A>T	uc001yfn.2	+	2	254	c.210A>T	c.(208-210)AAA>AAT	p.K70N	AK7_uc001yfm.1_Missense_Mutation_p.K70N	NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	70	Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		CCTCAACCAAAGTGAAGGAAG	0.507													57	77	---	---	---	---	capture	Missense_Mutation	SNP	96864516	96864516	AK7	14	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	444	171
JAG2	3714	broad.mit.edu	37	14	105609273	105609273	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105609273C>T	uc001yqg.2	-	26	3880	c.3476G>A	c.(3475-3477)CGC>CAC	p.R1159H	JAG2_uc010axf.2_5'UTR|JAG2_uc001yqf.2_Missense_Mutation_p.R563H|JAG2_uc001yqh.2_Missense_Mutation_p.R1121H	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	1159	Cytoplasmic (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		gtccgccctgcgcggcggcgg	0.463													23	13	---	---	---	---	capture	Missense_Mutation	SNP	105609273	105609273	JAG2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7858	171
LRRK1	79705	broad.mit.edu	37	15	101595366	101595366	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101595366G>A	uc002bwr.2	+	27	4589	c.4270G>A	c.(4270-4272)GTG>ATG	p.V1424M	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1424	Protein kinase.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CGCCCTAGGCGTGGAGGGCAC	0.567													34	37	---	---	---	---	capture	Missense_Mutation	SNP	101595366	101595366	LRRK1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8947	171
APOB48R	55911	broad.mit.edu	37	16	28507939	28507939	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28507939C>T	uc002dqb.1	+	3	1560	c.1550C>T	c.(1549-1551)GCC>GTC	p.A517V	uc010vct.1_Intron|APOB48R_uc010byg.1_Missense_Mutation_p.A55V	NM_018690	NP_061160	Q0VD83	APOBR_HUMAN	apolipoprotein B48 receptor	517	Glu-rich.				cholesterol metabolic process|lipid transport	chylomicron|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle					0						ACTCCAGAGGCCAGGCCTGAG	0.652													3	6	---	---	---	---	capture	Missense_Mutation	SNP	28507939	28507939	APOB48R	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	779	171
SLC5A2	6524	broad.mit.edu	37	16	31500623	31500623	+	Silent	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31500623G>A	uc002ecf.3	+	12	1648	c.1629G>A	c.(1627-1629)ACG>ACA	p.T543T	SLC5A2_uc010car.2_RNA|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	543	Helical; (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						TCACCCTCACGGTCTCCCTGT	0.637													8	42	---	---	---	---	capture	Silent	SNP	31500623	31500623	SLC5A2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14557	171
NOL3	8996	broad.mit.edu	37	16	67208819	67208819	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67208819C>T	uc010vjd.1	+	3	774	c.767C>T	c.(766-768)CCG>CTG	p.P256L	NOL3_uc010vjc.1_Silent_p.P259P|NOL3_uc002erp.2_Silent_p.P197P			O60936	NOL3_HUMAN	RecName: Full=Nucleolar protein 3; AltName: Full=Apoptosis repressor with CARD; AltName: Full=Muscle-enriched cytoplasmic protein;          Short=Myp; AltName: Full=Nucleolar protein of 30 kDa;          Short=Nop30;	194					anti-apoptosis|apoptosis|mRNA processing|RNA splicing	cytosol|nucleolus	identical protein binding|RNA binding				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		agcccgagcccgacttcgaGG	0.323													3	47	---	---	---	---	capture	Missense_Mutation	SNP	67208819	67208819	NOL3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10430	171
FOXL1	2300	broad.mit.edu	37	16	86613224	86613224	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:86613224G>A	uc002fjr.2	+	1	1110	c.895G>A	c.(895-897)GCC>ACC	p.A299T		NM_005250	NP_005241	Q12952	FOXL1_HUMAN	forkhead box L1	299					brain development|camera-type eye development|cartilage development|embryo development|forelimb morphogenesis|heart development|organ morphogenesis|pattern specification process|proteoglycan biosynthetic process|regulation of sequence-specific DNA binding transcription factor activity|regulation of Wnt receptor signaling pathway|visceral mesoderm-endoderm interaction involved in midgut development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1						CTCGCTCCTGGCCGCCTCCTC	0.672													16	20	---	---	---	---	capture	Missense_Mutation	SNP	86613224	86613224	FOXL1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5960	171
TRPV1	7442	broad.mit.edu	37	17	3493599	3493599	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3493599G>A	uc010vrr.1	-	4	1219	c.692C>T	c.(691-693)GCG>GTG	p.A231V	TRPV1_uc010vro.1_Missense_Mutation_p.A231V|TRPV1_uc010vrp.1_Missense_Mutation_p.A231V|TRPV1_uc010vrq.1_Missense_Mutation_p.A229V|TRPV1_uc010vrs.1_Missense_Mutation_p.A231V|TRPV1_uc010vrt.1_Missense_Mutation_p.A231V|TRPV1_uc010vru.1_Missense_Mutation_p.A231V	NM_080706	NP_542437	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel,	231	ANK 3.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|chemosensory behavior|thermoception	cell junction|dendritic spine membrane|integral to plasma membrane|postsynaptic membrane	ATP binding|calcium channel activity|calmodulin binding			ovary(1)	1				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	CCCATGGGCCGCAGCCTGGAC	0.572													4	72	---	---	---	---	capture	Missense_Mutation	SNP	3493599	3493599	TRPV1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16478	171
KRTAP4-11	653240	broad.mit.edu	37	17	39274424	39274424	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274424G>C	uc002hvz.2	-	1	183	c.144C>G	c.(142-144)AGC>AGG	p.S48R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	48	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].|5.		Missing (in allele KAP4.14).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCCTGCAGCAGCTGGACACAC	0.672													4	66	---	---	---	---	capture	Missense_Mutation	SNP	39274424	39274424	KRTAP4-11	17	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	8469	171
POTEC	388468	broad.mit.edu	37	18	14542809	14542809	+	Missense_Mutation	SNP	C	T	T	rs113041483		TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14542809C>T	uc010dln.2	-	1	791	c.337G>A	c.(337-339)GGC>AGC	p.G113S	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	113										skin(3)	3						TTGCTCTTGCCGCTCCCCCTG	0.597													9	181	---	---	---	---	capture	Missense_Mutation	SNP	14542809	14542809	POTEC	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12164	171
ABCA7	10347	broad.mit.edu	37	19	1056425	1056425	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1056425C>T	uc002lqw.3	+	33	4744	c.4513C>T	c.(4513-4515)CGC>TGC	p.R1505C	ABCA7_uc002lqy.2_5'Flank|ABCA7_uc010dsc.2_5'Flank	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	1505	Extracellular (By similarity).				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGCCCGGCCCGCCACGCCCA	0.612													21	26	---	---	---	---	capture	Missense_Mutation	SNP	1056425	1056425	ABCA7	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	37	171
EMR1	2015	broad.mit.edu	37	19	6906478	6906478	+	Silent	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6906478C>T	uc002mfw.2	+	9	1022	c.984C>T	c.(982-984)CCC>CCT	p.P328P	EMR1_uc010dvc.2_Silent_p.P328P|EMR1_uc010dvb.2_Silent_p.P276P|EMR1_uc010xji.1_Silent_p.P187P|EMR1_uc010xjj.1_Silent_p.P151P	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	328	Ser/Thr-rich.|Extracellular (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					ATGTGATACCCGATAATAAGC	0.388													28	73	---	---	---	---	capture	Silent	SNP	6906478	6906478	EMR1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5059	171
RAVER1	125950	broad.mit.edu	37	19	10434234	10434234	+	Silent	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10434234G>A	uc002moa.2	-	4	896	c.816C>T	c.(814-816)TGC>TGT	p.C272C		NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1	255	RRM 3.					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			CATCCTGGCCGCACGCCAGCT	0.667													38	25	---	---	---	---	capture	Silent	SNP	10434234	10434234	RAVER1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	12989	171
ZNF676	163223	broad.mit.edu	37	19	22364159	22364159	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22364159G>C	uc002nqs.1	-	3	678	c.360C>G	c.(358-360)AAC>AAG	p.N120K		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	120					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TATGAAAGACGTTTGCATATT	0.328													59	135	---	---	---	---	capture	Missense_Mutation	SNP	22364159	22364159	ZNF676	19	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	17961	171
PSG7	5676	broad.mit.edu	37	19	43441294	43441294	+	Translation_Start_Site	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43441294C>T	uc002ovl.3	-	1	37	c.-65G>A	c.(-67--63)CCGTG>CCATG		PSG3_uc002ouf.2_5'Flank|PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Translation_Start_Site	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7						female pregnancy	extracellular region					0		Prostate(69;0.00682)				TTCCTGAGCACGGCTGTCAGC	0.617													13	25	---	---	---	---	capture	Translation_Start_Site	SNP	43441294	43441294	PSG7	19	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	12555	171
C5AR1	728	broad.mit.edu	37	19	47823567	47823567	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47823567G>A	uc002pgj.1	+	2	582	c.533G>A	c.(532-534)CGG>CAG	p.R178Q		NM_001736	NP_001727	P21730	C5AR_HUMAN	complement component 5 receptor 1	178	Extracellular (Potential).				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		CGGGTGGTCCGGGAGGAGTAC	0.637													92	109	---	---	---	---	capture	Missense_Mutation	SNP	47823567	47823567	C5AR1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2259	171
SPHK2	56848	broad.mit.edu	37	19	49132307	49132307	+	Silent	SNP	A	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49132307A>C	uc002pjr.2	+	7	1608	c.1242A>C	c.(1240-1242)TCA>TCC	p.S414S	SPHK2_uc010xzt.1_Silent_p.S355S|SPHK2_uc002pjs.2_Silent_p.S414S|SPHK2_uc002pjt.2_Silent_p.S208S|SPHK2_uc002pju.2_Intron|SPHK2_uc002pjv.2_Silent_p.S378S|SPHK2_uc002pjw.2_Silent_p.S476S	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	414					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		tggcccactcacccctgcatc	0.338													4	19	---	---	---	---	capture	Silent	SNP	49132307	49132307	SPHK2	19	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	14939	171
POLD1	5424	broad.mit.edu	37	19	50918754	50918754	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50918754G>A	uc002psb.3	+	21	2680	c.2624G>A	c.(2623-2625)CGC>CAC	p.R875H	POLD1_uc002psc.3_Missense_Mutation_p.R875H|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Missense_Mutation_p.R901H	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	875					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		CTGTGCAACCGCATCGATATC	0.657								DNA_polymerases_(catalytic_subunits)					3	42	---	---	---	---	capture	Missense_Mutation	SNP	50918754	50918754	POLD1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12093	171
ITGB6	3694	broad.mit.edu	37	2	160993973	160993973	+	Silent	SNP	G	A	A	rs61737765	byFrequency;by1000genomes	TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160993973G>A	uc002ubh.2	-	10	1648	c.1632C>T	c.(1630-1632)TGC>TGT	p.C544C	ITGB6_uc010fou.2_Silent_p.C544C|ITGB6_uc010zcq.1_Silent_p.C502C|ITGB6_uc010fov.1_Silent_p.C544C	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor	544	Extracellular (Potential).|III.|Cysteine-rich tandem repeats.				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						TGTGTCTCACGCAGGAGAAAT	0.488													38	55	---	---	---	---	capture	Silent	SNP	160993973	160993973	ITGB6	2	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	7822	171
COL6A3	1293	broad.mit.edu	37	2	238275681	238275681	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238275681C>T	uc002vwl.2	-	11	5434	c.5149G>A	c.(5149-5151)GCC>ACC	p.A1717T	COL6A3_uc002vwo.2_Missense_Mutation_p.A1511T|COL6A3_uc010znj.1_Missense_Mutation_p.A1110T	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1717	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTAGTGTTGGCGTGTCTTCCC	0.542													19	29	---	---	---	---	capture	Missense_Mutation	SNP	238275681	238275681	COL6A3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3666	171
SNX5	27131	broad.mit.edu	37	20	17929612	17929612	+	Silent	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:17929612C>T	uc002wqc.2	-	10	926	c.840G>A	c.(838-840)GAG>GAA	p.E280E	SNX5_uc002wqb.2_RNA|SNX5_uc002wqd.2_Silent_p.E280E|SNX5_uc002wqe.2_Silent_p.E175E|SNX5_uc010zrt.1_Silent_p.E280E	NM_014426	NP_055241	Q9Y5X3	SNX5_HUMAN	sorting nexin 5	280	BAR.				cell communication|pinocytosis|protein transport	cytoplasmic vesicle membrane|early endosome membrane|extrinsic to endosome membrane|extrinsic to internal side of plasma membrane|macropinocytic cup|phagocytic cup|ruffle	phosphatidylinositol binding			large_intestine(1)	1						AAACTCGACCCTCTACTTTCT	0.383													38	100	---	---	---	---	capture	Silent	SNP	17929612	17929612	SNX5	20	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	14797	171
NCOA3	8202	broad.mit.edu	37	20	46264906	46264906	+	Silent	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:46264906C>T	uc002xtk.2	+	12	1981	c.1776C>T	c.(1774-1776)CAC>CAT	p.H592H	NCOA3_uc010ght.1_Silent_p.H602H|NCOA3_uc002xtl.2_Silent_p.H592H|NCOA3_uc002xtm.2_Silent_p.H592H|NCOA3_uc002xtn.2_Silent_p.H592H|NCOA3_uc010zyc.1_Silent_p.H387H	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	592	Ser-rich.				androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						GCAGAGATCACCTCAGTGACA	0.423													39	59	---	---	---	---	capture	Silent	SNP	46264906	46264906	NCOA3	20	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	10137	171
DSCAM	1826	broad.mit.edu	37	21	41455893	41455893	+	Silent	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:41455893C>T	uc002yyq.1	-	24	4625	c.4173G>A	c.(4171-4173)ACG>ACA	p.T1391T	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1391	Fibronectin type-III 5.|Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGGAGGAAGACGTGGTCTTGG	0.433													14	23	---	---	---	---	capture	Silent	SNP	41455893	41455893	DSCAM	21	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4723	171
CDC45	8318	broad.mit.edu	37	22	19504408	19504408	+	Missense_Mutation	SNP	A	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19504408A>C	uc002zpr.2	+	17	1704	c.1628A>C	c.(1627-1629)GAC>GCC	p.D543A	CDC45_uc011aha.1_Missense_Mutation_p.D575A|CDC45_uc002zps.2_Missense_Mutation_p.D544A|CDC45_uc002zpt.2_Missense_Mutation_p.D497A	NM_003504	NP_003495	O75419	CDC45_HUMAN	CDC45-like	543					DNA replication checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	centrosome|nucleoplasm	protein binding			lung(1)	1						AACCATTTTGACCTCTCAGGT	0.572													7	32	---	---	---	---	capture	Missense_Mutation	SNP	19504408	19504408	CDC45	22	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	3052	171
BSN	8927	broad.mit.edu	37	3	49689184	49689184	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49689184G>A	uc003cxe.3	+	5	2309	c.2195G>A	c.(2194-2196)CGG>CAG	p.R732Q		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	732					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		AGCAGCATGCGGCCTTTGCTG	0.667													26	35	---	---	---	---	capture	Missense_Mutation	SNP	49689184	49689184	BSN	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1518	171
SEMA3G	56920	broad.mit.edu	37	3	52475289	52475289	+	Silent	SNP	G	A	A	rs138050174		TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52475289G>A	uc003dea.1	-	7	804	c.804C>T	c.(802-804)CGC>CGT	p.R268R		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	268	Sema.				multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		CCACGCAGACGCGGCCCACGC	0.612													23	33	---	---	---	---	capture	Silent	SNP	52475289	52475289	SEMA3G	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13923	171
PLXNA1	5361	broad.mit.edu	37	3	126733439	126733439	+	Missense_Mutation	SNP	G	A	A	rs138171477		TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126733439G>A	uc003ejg.2	+	12	2658	c.2654G>A	c.(2653-2655)AGC>AAC	p.S885N		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	908	IPT/TIG 1.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		GTGCTGTGCAGCCCTGTGGAG	0.577													47	66	---	---	---	---	capture	Missense_Mutation	SNP	126733439	126733439	PLXNA1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	12022	171
D4S234E	27065	broad.mit.edu	37	4	4411320	4411320	+	Silent	SNP	C	T	T	rs143847165		TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:4411320C>T	uc011bvz.1	+	7	1548	c.267C>T	c.(265-267)TTC>TTT	p.F89F	D4S234E_uc011bwa.1_Silent_p.F50F|D4S234E_uc003ghz.2_Silent_p.F89F|D4S234E_uc003gia.2_Silent_p.F89F|D4S234E_uc003gib.2_Silent_p.F89F	NM_014392	NP_055207	P42857	NSG1_HUMAN	brain neuron cytoplasmic protein 1	89	Helical; Signal-anchor for type II membrane protein; (Potential).				dopamine receptor signaling pathway	Golgi membrane|integral to membrane|nucleus	dopamine receptor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		TGGTCCTCTTCGCCCTGGCCT	0.617													33	40	---	---	---	---	capture	Silent	SNP	4411320	4411320	D4S234E	4	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	4174	171
UGT2A3	79799	broad.mit.edu	37	4	69795715	69795715	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69795715C>T	uc003hef.2	-	6	1431	c.1400G>A	c.(1399-1401)CGC>CAC	p.R467H	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	467	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						TCCTTTGTGGCGCATGACAAA	0.488													55	63	---	---	---	---	capture	Missense_Mutation	SNP	69795715	69795715	UGT2A3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16837	171
EGF	1950	broad.mit.edu	37	4	110864421	110864421	+	Silent	SNP	T	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110864421T>C	uc003hzy.3	+	3	791	c.339T>C	c.(337-339)AAT>AAC	p.N113N	EGF_uc011cfu.1_Silent_p.N113N|EGF_uc011cfv.1_Silent_p.N113N	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	113	LDL-receptor class B 1.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	GAGTATGTAATATAGAGAAAA	0.249													34	34	---	---	---	---	capture	Silent	SNP	110864421	110864421	EGF	4	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	4917	171
FAT4	79633	broad.mit.edu	37	4	126241369	126241369	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:126241369C>T	uc003ifj.3	+	1	3803	c.3803C>T	c.(3802-3804)ACA>ATA	p.T1268I		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1268	Cadherin 12.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GGTCAGGTAACACTAATTGGC	0.373													23	81	---	---	---	---	capture	Missense_Mutation	SNP	126241369	126241369	FAT4	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	5638	171
INPP4B	8821	broad.mit.edu	37	4	143159105	143159105	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:143159105G>A	uc003iix.3	-	13	1343	c.748C>T	c.(748-750)CGA>TGA	p.R250*	INPP4B_uc003iiw.3_Nonsense_Mutation_p.R250*|INPP4B_uc011chm.1_RNA|INPP4B_uc011chn.1_Nonsense_Mutation_p.R65*|INPP4B_uc011cho.1_RNA|INPP4B_uc011chp.1_Nonsense_Mutation_p.R121*	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,	250					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					TCTCGAATTCGCATCCACTTA	0.318													16	20	---	---	---	---	capture	Nonsense_Mutation	SNP	143159105	143159105	INPP4B	4	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	7676	171
SH3RF1	57630	broad.mit.edu	37	4	170043337	170043337	+	Silent	SNP	A	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:170043337A>G	uc003isa.1	-	7	1595	c.1260T>C	c.(1258-1260)GCT>GCC	p.A420A	SH3RF1_uc010irc.1_Silent_p.A120A	NM_020870	NP_065921	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	420	Poly-Ala.					Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding			breast(2)|lung(1)	3		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		CAGCAGCAGCAGCGGCGGTGG	0.582													3	26	---	---	---	---	capture	Silent	SNP	170043337	170043337	SH3RF1	4	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	14151	171
DNAH5	1767	broad.mit.edu	37	5	13719110	13719110	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13719110C>T	uc003jfd.2	-	72	12422	c.12380G>A	c.(12379-12381)CGC>CAC	p.R4127H	DNAH5_uc003jfc.2_Missense_Mutation_p.R295H	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4127	AAA 6 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CATCCAGAGGCGGAACGCATC	0.493									Kartagener_syndrome				34	40	---	---	---	---	capture	Missense_Mutation	SNP	13719110	13719110	DNAH5	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4561	171
TRIO	7204	broad.mit.edu	37	5	14462975	14462975	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:14462975C>G	uc003jff.2	+	36	5614	c.5608C>G	c.(5608-5610)CCG>GCG	p.P1870A	TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Missense_Mutation_p.P1519A|TRIO_uc003jfi.1_Missense_Mutation_p.P173A	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	1870					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					CGTGCCCCTGCCGCCACCCAT	0.652													46	36	---	---	---	---	capture	Missense_Mutation	SNP	14462975	14462975	TRIO	5	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	16435	171
GDNF	2668	broad.mit.edu	37	5	37816010	37816010	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:37816010C>T	uc011cpi.1	-	3	579	c.379G>A	c.(379-381)GTC>ATC	p.V127I	GDNF_uc011cpc.1_Missense_Mutation_p.V49I|GDNF_uc011cpd.1_Missense_Mutation_p.V75I|GDNF_uc011cpe.1_Missense_Mutation_p.V101I|GDNF_uc011cpf.1_Missense_Mutation_p.V101I|GDNF_uc011cpg.1_Missense_Mutation_p.V144I|GDNF_uc011cph.1_Missense_Mutation_p.V118I	NM_000514	NP_000505	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor isoform 1	127					adult locomotory behavior|anti-apoptosis|axon guidance|branching involved in ureteric bud morphogenesis|enteric nervous system development|mRNA stabilization|negative regulation of neuron apoptosis|neural crest cell migration|peristalsis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of dopamine secretion|positive regulation of monooxygenase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|postganglionic parasympathetic nervous system development|regulation of dopamine uptake|signal transduction|sympathetic nervous system development	extracellular region	growth factor activity|protein homodimerization activity				0	all_lung(31;0.00118)					AAGTCAGTGACATTTAAATGT	0.493													33	64	---	---	---	---	capture	Missense_Mutation	SNP	37816010	37816010	GDNF	5	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	6262	171
PCDHA6	56142	broad.mit.edu	37	5	140208958	140208958	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140208958C>T	uc003lho.2	+	1	1309	c.1282C>T	c.(1282-1284)CGG>TGG	p.R428W	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.R428W|PCDHA6_uc011dab.1_Missense_Mutation_p.R428W	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	428	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTAACCGCGCGGGACGGGGG	0.617													65	114	---	---	---	---	capture	Missense_Mutation	SNP	140208958	140208958	PCDHA6	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11431	171
PCDHGA4	56111	broad.mit.edu	37	5	140735359	140735359	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140735359C>T	uc003ljq.1	+	1	592	c.592C>T	c.(592-594)CGC>TGC	p.R198C	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Missense_Mutation_p.R198C	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	198	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGCTGGAACGCGCTCTAGA	0.562													9	10	---	---	---	---	capture	Missense_Mutation	SNP	140735359	140735359	PCDHGA4	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11459	171
PPARGC1B	133522	broad.mit.edu	37	5	149219665	149219665	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149219665C>T	uc003lrc.2	+	9	2722	c.2680C>T	c.(2680-2682)CGG>TGG	p.R894W	PPARGC1B_uc003lrb.1_Missense_Mutation_p.R894W|PPARGC1B_uc003lrd.2_Missense_Mutation_p.R855W|PPARGC1B_uc003lrf.2_Missense_Mutation_p.R873W|PPARGC1B_uc003lre.1_Missense_Mutation_p.R873W	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	894					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CAGGAAGCGGCGGGAAAAGGC	0.577													13	34	---	---	---	---	capture	Missense_Mutation	SNP	149219665	149219665	PPARGC1B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	12202	171
NRN1	51299	broad.mit.edu	37	6	5999377	5999377	+	Silent	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:5999377C>T	uc003mwu.2	-	3	912	c.261G>A	c.(259-261)GCG>GCA	p.A87A	NRN1_uc003mwt.2_Silent_p.A113A	NM_016588	NP_057672	Q9NPD7	NRN1_HUMAN	neuritin precursor	87						anchored to membrane|plasma membrane					0	Ovarian(93;0.0816)	all_hematologic(90;0.151)		OV - Ovarian serous cystadenocarcinoma(45;0.00415)		ACATATCTTTCGCCCCTTCCT	0.527													31	33	---	---	---	---	capture	Silent	SNP	5999377	5999377	NRN1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	10565	171
DSP	1832	broad.mit.edu	37	6	7584664	7584664	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7584664T>C	uc003mxp.1	+	24	7448	c.7169T>C	c.(7168-7170)ATA>ACA	p.I2390T	DSP_uc003mxq.1_Missense_Mutation_p.I1791T	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2390	Plectin 10.|Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CCAGTTGACATAGCATATAAG	0.443													37	63	---	---	---	---	capture	Missense_Mutation	SNP	7584664	7584664	DSP	6	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	4736	171
PDE1C	5137	broad.mit.edu	37	7	31855673	31855673	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31855673C>T	uc003tcm.1	-	15	2147	c.1678G>A	c.(1678-1680)GCA>ACA	p.A560T	PDE1C_uc003tcn.1_Missense_Mutation_p.A560T|PDE1C_uc003tco.1_Missense_Mutation_p.A620T|PDE1C_uc003tcr.2_Missense_Mutation_p.A560T|PDE1C_uc003tcs.2_Missense_Mutation_p.A560T	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	560					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TTGCCAGATGCGCCTTCTTCA	0.502													93	130	---	---	---	---	capture	Missense_Mutation	SNP	31855673	31855673	PDE1C	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11538	171
CD36	948	broad.mit.edu	37	7	80295787	80295787	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80295787G>A	uc003uhc.2	+	11	1414	c.730G>A	c.(730-732)GAC>AAC	p.D244N	CD36_uc003uhd.3_Missense_Mutation_p.D244N|CD36_uc011kgv.1_Missense_Mutation_p.D168N|CD36_uc003uhe.3_Missense_Mutation_p.D244N|CD36_uc003uhf.3_Missense_Mutation_p.D244N|CD36_uc003uhg.3_Missense_Mutation_p.D244N|CD36_uc003uhh.3_Missense_Mutation_p.D244N	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen	244	Extracellular (Potential).				cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						AAGTCACTGCGACATGATTAA	0.348													43	42	---	---	---	---	capture	Missense_Mutation	SNP	80295787	80295787	CD36	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2978	171
SLC26A4	5172	broad.mit.edu	37	7	107303838	107303838	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107303838G>A	uc003vep.2	+	3	486	c.262G>A	c.(262-264)GTC>ATC	p.V88I	LOC286002_uc003veo.3_5'Flank	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin	88	Helical; (Potential).				regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						GCTTAGTGACGTCATTTCGGG	0.502									Pendred_syndrome				54	67	---	---	---	---	capture	Missense_Mutation	SNP	107303838	107303838	SLC26A4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14411	171
WDR91	29062	broad.mit.edu	37	7	134874110	134874110	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134874110A>G	uc003vsp.2	-	12	1816	c.1754T>C	c.(1753-1755)GTC>GCC	p.V585A	WDR91_uc010lmq.2_Missense_Mutation_p.V174A|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	585	WD 4.									breast(2)|ovary(1)|skin(1)	4						CAGCCGGATGACGCCATCAGC	0.488													3	53	---	---	---	---	capture	Missense_Mutation	SNP	134874110	134874110	WDR91	7	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	17219	171
OR2F2	135948	broad.mit.edu	37	7	143632553	143632553	+	Silent	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143632553C>T	uc011ktv.1	+	1	228	c.228C>T	c.(226-228)AGC>AGT	p.S76S		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	76	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					ATGCCACAAGCGTAGTCCCCC	0.517													96	127	---	---	---	---	capture	Silent	SNP	143632553	143632553	OR2F2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	10901	171
NOBOX	135935	broad.mit.edu	37	7	144098293	144098293	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144098293G>T	uc011kue.1	-	4	690	c.690C>A	c.(688-690)CAC>CAA	p.H230Q		NM_001080413	NP_001073882	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	230					cell differentiation|oogenesis	nucleus	sequence-specific DNA binding			ovary(1)	1	Melanoma(164;0.14)					GCACTGGGTTGTGTGTGGCAC	0.617													12	22	---	---	---	---	capture	Missense_Mutation	SNP	144098293	144098293	NOBOX	7	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	10419	171
DOCK5	80005	broad.mit.edu	37	8	25246735	25246735	+	Silent	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25246735G>A	uc003xeg.2	+	41	4397	c.4260G>A	c.(4258-4260)TCG>TCA	p.S1420S	PPP2R2A_uc003xek.2_Silent_p.S209S|DOCK5_uc003xei.2_Silent_p.S990S|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1420	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		ACATCAAGTCGTCCCCCAAGC	0.567													63	58	---	---	---	---	capture	Silent	SNP	25246735	25246735	DOCK5	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4646	171
BRF2	55290	broad.mit.edu	37	8	37704528	37704528	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:37704528C>T	uc003xkk.2	-	3	490	c.380G>A	c.(379-381)CGA>CAA	p.R127Q		NM_018310	NP_060780	Q9HAW0	BRF2_HUMAN	RNA polymerase III transcription initiation	127	1.				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter|transcription initiation, DNA-dependent	nucleoplasm	protein binding|zinc ion binding				0		Lung NSC(58;0.118)|all_lung(54;0.195)	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;1.81e-10)			GTTATGCTGTCGGCAGGTGAT	0.527													35	230	---	---	---	---	capture	Missense_Mutation	SNP	37704528	37704528	BRF2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1499	171
SOX17	64321	broad.mit.edu	37	8	55371633	55371633	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:55371633C>T	uc003xsb.3	+	2	527	c.323C>T	c.(322-324)GCG>GTG	p.A108V		NM_022454	NP_071899	Q9H6I2	SOX17_HUMAN	SRY-box 17	108	HMG box.				angiogenesis|cardiac cell fate determination|endocardial cell differentiation|endocardium formation|endoderm formation|heart formation|heart looping|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|outflow tract morphogenesis|positive regulation of transcription, DNA-dependent|protein destabilization|protein stabilization|regulation of embryonic development|renal system development|vasculogenesis|Wnt receptor signaling pathway	transcription factor complex	beta-catenin binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			lung(1)	1		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			TCGTGGAAGGCGCTGACGCTG	0.701													4	9	---	---	---	---	capture	Missense_Mutation	SNP	55371633	55371633	SOX17	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14839	171
WDR67	93594	broad.mit.edu	37	8	124113069	124113069	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124113069A>G	uc003ypp.1	+	7	944	c.854A>G	c.(853-855)GAT>GGT	p.D285G	WDR67_uc011lig.1_Missense_Mutation_p.D285G|WDR67_uc011lih.1_Missense_Mutation_p.D175G|WDR67_uc003ypq.1_RNA|WDR67_uc003yps.1_5'UTR|WDR67_uc003ypo.1_Missense_Mutation_p.D285G|WDR67_uc003ypr.2_RNA	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1	285						centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			CTAAGTCAAGATGGTATTATG	0.353													24	48	---	---	---	---	capture	Missense_Mutation	SNP	124113069	124113069	WDR67	8	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	17199	171
ADCY8	114	broad.mit.edu	37	8	131896832	131896832	+	Missense_Mutation	SNP	T	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:131896832T>G	uc003ytd.3	-	8	2343	c.2087A>C	c.(2086-2088)AAA>ACA	p.K696T	ADCY8_uc010mds.2_Missense_Mutation_p.K696T	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	696	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCTGGAGTCTTTAAACATCAG	0.468										HNSCC(32;0.087)			81	97	---	---	---	---	capture	Missense_Mutation	SNP	131896832	131896832	ADCY8	8	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	300	171
KIF24	347240	broad.mit.edu	37	9	34257897	34257897	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34257897G>A	uc003zua.3	-	11	1828	c.1708C>T	c.(1708-1710)CGA>TGA	p.R570*	KIF24_uc010mkb.2_Intron	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24	570					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)			CTCTGAATTCGTTTTGGAGAG	0.448													159	13	---	---	---	---	capture	Nonsense_Mutation	SNP	34257897	34257897	KIF24	9	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	8214	171
COL15A1	1306	broad.mit.edu	37	9	101810265	101810265	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101810265C>A	uc004azb.1	+	28	2982	c.2776C>A	c.(2776-2778)CCA>ACA	p.P926T		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	926	Triple-helical region 5 (COL5).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				CAAAGGAGATCCAGGGGTCAT	0.617													7	5	---	---	---	---	capture	Missense_Mutation	SNP	101810265	101810265	COL15A1	9	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	3637	171
C9orf86	55684	broad.mit.edu	37	9	139726289	139726289	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139726289G>A	uc004cji.1	+	6	843	c.575G>A	c.(574-576)CGT>CAT	p.R192H	C9orf86_uc004cjm.2_Missense_Mutation_p.R192H|C9orf86_uc004cjh.2_Missense_Mutation_p.R192H|C9orf86_uc004cjj.1_Missense_Mutation_p.R192H|C9orf86_uc004cjk.1_RNA|C9orf86_uc010nbr.1_Missense_Mutation_p.R192H|C9orf86_uc004cjl.1_RNA|C9orf86_uc010nbs.1_Missense_Mutation_p.R77H	NM_024718	NP_078994	Q3YEC7	PARF_HUMAN	Rab-like GTP-binding protein 1 isoform 1	192	Small GTPase-like.				small GTPase mediated signal transduction	cytoplasm|nucleus	GTP binding|protein binding				0	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.61e-05)|Epithelial(140;0.000183)		GACGACGTGCGTGACTTCATC	0.677													10	17	---	---	---	---	capture	Missense_Mutation	SNP	139726289	139726289	C9orf86	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2478	171
ARSH	347527	broad.mit.edu	37	X	2931164	2931164	+	Silent	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2931164G>A	uc011mhj.1	+	3	291	c.291G>A	c.(289-291)ACG>ACA	p.T97T		NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	97						integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CCAATGAAACGACTTTTGCCA	0.552													59	96	---	---	---	---	capture	Silent	SNP	2931164	2931164	ARSH	23	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	986	171
ELK1	2002	broad.mit.edu	37	X	47496310	47496310	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47496310C>T	uc004dik.3	-	7	1527	c.1205G>A	c.(1204-1206)AGC>AAC	p.S402N	ELK1_uc010nhv.2_Missense_Mutation_p.S402N|ELK1_uc010nhw.2_Missense_Mutation_p.S292N|ELK1_uc004dil.3_RNA	NM_001114123	NP_001107595	P19419	ELK1_HUMAN	ELK1 protein	402					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						CACCTGGGCGCTGCCACTGGA	0.597													5	4	---	---	---	---	capture	Missense_Mutation	SNP	47496310	47496310	ELK1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	5014	171
ZNF182	7569	broad.mit.edu	37	X	47842806	47842806	+	Silent	SNP	T	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47842806T>C	uc004dir.2	-	5	424	c.78A>G	c.(76-78)CTA>CTG	p.L26L	ZNF182_uc004dis.2_Silent_p.L7L|ZNF182_uc004dit.2_Silent_p.L26L|ZNF182_uc011mlu.1_Silent_p.L7L|ZNF630_uc010nhz.1_RNA	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1	26					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						CAAATGTCACTAGCCCCTGTA	0.463													65	72	---	---	---	---	capture	Silent	SNP	47842806	47842806	ZNF182	23	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	17630	171
WAS	7454	broad.mit.edu	37	X	48545194	48545194	+	Missense_Mutation	SNP	T	G	G			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48545194T>G	uc004dkm.3	+	7	641	c.584T>G	c.(583-585)CTG>CGG	p.L195R		NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein	195					blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				CCGCTCTCCCTGGGGCTGGCG	0.582			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				40	60	---	---	---	---	capture	Missense_Mutation	SNP	48545194	48545194	WAS	23	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	17133	171
SHROOM4	57477	broad.mit.edu	37	X	50377938	50377938	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50377938C>T	uc004dpe.2	-	4	1161	c.1135G>A	c.(1135-1137)GTG>ATG	p.V379M	SHROOM4_uc004dpd.3_RNA|SHROOM4_uc004dpf.1_Missense_Mutation_p.V263M	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	379					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					TTGGAATCCACGCTGGAAGCT	0.542													15	19	---	---	---	---	capture	Missense_Mutation	SNP	50377938	50377938	SHROOM4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14189	171
ERCC6L	54821	broad.mit.edu	37	X	71425657	71425657	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:71425657T>C	uc004eaq.1	-	2	3057	c.2960A>G	c.(2959-2961)AAT>AGT	p.N987S	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Missense_Mutation_p.N864S	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	987					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)					TGCTCTGGAATTAGGTGCAGA	0.393													56	74	---	---	---	---	capture	Missense_Mutation	SNP	71425657	71425657	ERCC6L	23	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	5173	171
AMOT	154796	broad.mit.edu	37	X	112025789	112025789	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:112025789C>A	uc004epr.2	-	8	2219	c.2219G>T	c.(2218-2220)CGT>CTT	p.R740L	AMOT_uc004eps.2_Missense_Mutation_p.R331L|AMOT_uc011mtc.1_5'Flank|hsa-mir-4329|MI0015901_5'Flank	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1	740	Potential.				actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1						GTCAAGGCAACGCTTATTGGC	0.453													43	51	---	---	---	---	capture	Missense_Mutation	SNP	112025789	112025789	AMOT	23	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	582	171
FAM70A	55026	broad.mit.edu	37	X	119410875	119410875	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119410875G>T	uc004eso.3	-	8	839	c.612C>A	c.(610-612)TAC>TAA	p.Y204*	FAM70A_uc004esp.3_Nonsense_Mutation_p.Y180*|FAM70A_uc010nqo.2_Intron	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN	hypothetical protein LOC55026 isoform 1	204						integral to membrane				lung(1)|breast(1)	2						CGATGTATTCGTAGTACCCAC	0.582													78	86	---	---	---	---	capture	Nonsense_Mutation	SNP	119410875	119410875	FAM70A	23	G	T	T	T	1	0	0	0	0	0	1	0	0	516	40	5	4	5553	171
GDI1	2664	broad.mit.edu	37	X	153666947	153666947	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153666947G>A	uc004fli.3	+	2	466	c.124G>A	c.(124-126)GAG>AAG	p.E42K	GDI1_uc011mzo.1_Missense_Mutation_p.E42K	NM_001493	NP_001484	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	42					protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding				0	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTACGGGGGCGAGAGCTCCTC	0.617													51	51	---	---	---	---	capture	Missense_Mutation	SNP	153666947	153666947	GDI1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6260	171
PIF1	80119	broad.mit.edu	37	15	65110455	65110455	+	Splice_Site	DEL	C	-	-			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65110455delC	uc002ant.2	-	10	1594	c.1528_splice	c.e10+1	p.G510_splice	PIF1_uc002anr.2_Splice_Site_p.G58_splice|PIF1_uc002ans.2_Splice_Site_p.G201_splice|PIF1_uc010uiq.1_Splice_Site_p.G510_splice	NM_025049	NP_079325	Q9H611	PIF1_HUMAN	DNA helicase homolog PIF1						negative regulation of telomerase activity|regulation of telomere maintenance|viral genome replication	nuclear chromosome, telomeric region	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' DNA/RNA helicase activity|magnesium ion binding|single-stranded DNA-dependent ATP-dependent DNA helicase activity|telomeric DNA binding				0						CCAACACTTACCTCTCCCTTC	0.582													25	52	---	---	---	---	capture_indel	Splice_Site	DEL	65110455	65110455	PIF1	15	C	-	-	-	1	0	1	0	1	0	0	1	0	234	18	5	5	11786	171
CCDC148	130940	broad.mit.edu	37	2	159215014	159215015	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:159215014_159215015insT	uc002tzq.2	-	2	356_357	c.93_94insA	c.(91-96)CAATTGfs	p.Q31fs	CCDC148_uc002tzr.2_5'UTR|CCDC148_uc010foh.2_5'UTR|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_5'UTR|CCDC148_uc010fok.1_Intron|CCDC148_uc002tzs.1_Frame_Shift_Ins_p.Q31fs	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	31_32										ovary(2)	2						AATGCACGCAATTGTTGATAGT	0.322													34	48	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	159215014	159215015	CCDC148	2	-	T	T	T	1	0	1	1	0	0	0	0	0	50	4	5	5	2756	171
MED15	51586	broad.mit.edu	37	22	20920814	20920816	+	In_Frame_Del	DEL	CAG	-	-			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20920814_20920816delCAG	uc002zsp.2	+	7	831_833	c.751_753delCAG	c.(751-753)CAGdel	p.Q262del	MED15_uc002zso.2_In_Frame_Del_p.Q191del|MED15_uc002zsq.2_In_Frame_Del_p.Q262del|MED15_uc010gso.2_In_Frame_Del_p.Q262del|MED15_uc002zsr.2_In_Frame_Del_p.Q236del|MED15_uc011ahs.1_In_Frame_Del_p.Q236del|MED15_uc002zss.2_In_Frame_Del_p.Q181del|MED15_uc011ahu.1_5'UTR	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	262	Poly-Gln.		Missing.	Missing (in Ref. 3; BAB85034).	regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			acaacagcaacagcagcagcagc	0.315													11	60	---	---	---	---	capture_indel	In_Frame_Del	DEL	20920814	20920816	MED15	22	CAG	-	-	-	1	0	1	0	1	0	0	0	0	221	17	5	5	9346	171
PIK3R1	5295	broad.mit.edu	37	5	67589199	67589213	+	In_Frame_Del	DEL	TAACCTTCAGTTCTG	-	-			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589199_67589213delTAACCTTCAGTTCTG	uc003jva.2	+	10	1747_1761	c.1187_1201delTAACCTTCAGTTCTG	c.(1186-1203)TTAACCTTCAGTTCTGTG>TTG	p.TFSSV397del	PIK3R1_uc003jvb.2_In_Frame_Del_p.TFSSV397del|PIK3R1_uc003jvc.2_In_Frame_Del_p.TFSSV97del|PIK3R1_uc003jvd.2_In_Frame_Del_p.TFSSV127del|PIK3R1_uc003jve.2_In_Frame_Del_p.TFSSV76del|PIK3R1_uc011crb.1_In_Frame_Del_p.TFSSV67del	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	397_401	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TCTGACCCATTAACCTTCAGTTCTGTGGTTGAATT	0.326			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			14	75	---	---	---	---	capture_indel	In_Frame_Del	DEL	67589199	67589213	PIK3R1	5	TAACCTTCAGTTCTG	-	-	-	1	0	1	0	1	0	0	0	0	793	61	5	5	11821	171
GPR146	115330	broad.mit.edu	37	7	1098107	1098107	+	Frame_Shift_Del	DEL	G	-	-	rs147446123		TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:1098107delG	uc003sjw.2	+	2	1032	c.956delG	c.(955-957)CGGfs	p.R319fs	C7orf50_uc003sju.2_Intron|C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron|GPR146_uc003sjx.3_Frame_Shift_Del_p.R319fs|GPR146_uc003sjy.1_Frame_Shift_Del_p.R319fs	NM_138445	NP_612454	Q96CH1	GP146_HUMAN	G protein-coupled receptor 146	319	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		TGCGGGGACCGGCACTGCTCC	0.617													19	32	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	1098107	1098107	GPR146	7	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	6586	171
ADAM28	10863	broad.mit.edu	37	8	24167473	24167473	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-5951-01	TCGA-19-5951-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24167473delA	uc003xdy.2	+	3	300	c.217delA	c.(217-219)AAAfs	p.K73fs	ADAM28_uc003xdx.2_Frame_Shift_Del_p.K73fs|ADAM28_uc011kzz.1_5'UTR|ADAM28_uc011laa.1_RNA	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	73					proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		GCTTTATTTGAAAAAAAACAA	0.333													39	72	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	24167473	24167473	ADAM28	8	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	246	171
