Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NBPF1	55672	broad.mit.edu	37	1	16893838	16893838	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16893838C>T	uc009vos.1	-	26	3788	c.2900G>A	c.(2899-2901)AGG>AAG	p.R967K	NBPF1_uc009vot.1_Missense_Mutation_p.R350K|NBPF1_uc001ayz.1_Missense_Mutation_p.R350K|NBPF1_uc010oce.1_Missense_Mutation_p.R621K	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	967	NBPF 6.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CAGCAGCTCCCTGCTGAGCCT	0.473													15	683	---	---	---	---	capture	Missense_Mutation	SNP	16893838	16893838	NBPF1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	10099	172
PLK3	1263	broad.mit.edu	37	1	45271002	45271002	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45271002T>C	uc001cmn.2	+	14	1800	c.1700T>C	c.(1699-1701)GTC>GCC	p.V567A	PLK3_uc001cmo.2_RNA	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	567	POLO box 2.					membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					CTGCAGTGGGTCAAGACGGAT	0.602													3	121	---	---	---	---	capture	Missense_Mutation	SNP	45271002	45271002	PLK3	1	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	12000	172
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	G	G	rs146714035	by1000genomes	TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367739A>G	uc001end.3	+	85	10595	c.10560A>G	c.(10558-10560)AAA>AAG	p.K3520K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3445											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.244													3	95	---	---	---	---	capture	Silent	SNP	145367739	145367739	NBPF10	1	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	10100	172
LGALS8	3964	broad.mit.edu	37	1	236700824	236700824	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:236700824G>A	uc001hxz.1	+	4	454	c.73G>A	c.(73-75)GAT>AAT	p.D25N	LGALS8_uc001hxw.1_Missense_Mutation_p.D25N|LGALS8_uc001hxy.1_Missense_Mutation_p.D25N|LGALS8_uc009xgg.1_RNA|LGALS8_uc001hya.1_Missense_Mutation_p.D25N|LGALS8_uc001hyb.1_Missense_Mutation_p.D25N|LGALS8_uc001hyc.1_Missense_Mutation_p.D25N	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b	25	Galectin 1.					cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CACCATTCCTGATCAGCTGGA	0.393													3	29	---	---	---	---	capture	Missense_Mutation	SNP	236700824	236700824	LGALS8	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	8667	172
SYT15	83849	broad.mit.edu	37	10	46965845	46965845	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:46965845G>T	uc001jea.2	-	5	845	c.692C>A	c.(691-693)TCC>TAC	p.S231Y	SYT15_uc001jdz.2_Missense_Mutation_p.S231Y|SYT15_uc001jeb.2_Missense_Mutation_p.S109Y|SYT15_uc010qfp.1_RNA	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a	231	Cytoplasmic (Potential).|C2 1.					integral to membrane|plasma membrane					0						GTGGTAGACGGAGAACTTCAG	0.622													12	87	---	---	---	---	capture	Missense_Mutation	SNP	46965845	46965845	SYT15	10	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	15359	172
PTEN	5728	broad.mit.edu	37	10	89692911	89692911	+	Missense_Mutation	SNP	G	A	A	rs121909241		TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692911G>A	uc001kfb.2	+	6	1426	c.395G>A	c.(394-396)GGT>GAT	p.G132D		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	132	Phosphatase tensin-type.		G -> V (in one patient with clinical findings suggesting hamartoma tumor syndrome).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.G132D(5)|p.R55fs*1(4)|p.?(2)|p.G132S(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G132V(1)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.G132fs*2(1)|p.G132R(1)|p.T131fs*42(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGACGAACTGGTGTAATGATA	0.398		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			60	58	---	---	---	---	capture	Missense_Mutation	SNP	89692911	89692911	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	12633	172
PSD	5662	broad.mit.edu	37	10	104171572	104171572	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104171572A>G	uc001kvg.1	-	8	2361	c.1834T>C	c.(1834-1836)TTT>CTT	p.F612L	PSD_uc001kvf.1_5'Flank|PSD_uc001kvh.1_Missense_Mutation_p.F233L|PSD_uc009xxd.1_Missense_Mutation_p.F612L	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	612	SEC7.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TCCTTCAGAAACACCCTGGAG	0.582													9	9	---	---	---	---	capture	Missense_Mutation	SNP	104171572	104171572	PSD	10	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	12541	172
OR8K3	219473	broad.mit.edu	37	11	56086192	56086192	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56086192C>T	uc010rjf.1	+	1	410	c.410C>T	c.(409-411)TCA>TTA	p.S137L		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					GTAATCATGTCACGAAGGGTA	0.413													51	82	---	---	---	---	capture	Missense_Mutation	SNP	56086192	56086192	OR8K3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	11148	172
OR5B3	441608	broad.mit.edu	37	11	58170525	58170525	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58170525G>A	uc010rkf.1	-	1	358	c.358C>T	c.(358-360)CGC>TGC	p.R120C		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	120	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GCTGCATAGCGGTCATAGGCC	0.468													53	83	---	---	---	---	capture	Missense_Mutation	SNP	58170525	58170525	OR5B3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11056	172
CLPB	81570	broad.mit.edu	37	11	72114088	72114088	+	Nonsense_Mutation	SNP	G	C	C			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:72114088G>C	uc001osj.2	-	3	514	c.464C>G	c.(463-465)TCA>TGA	p.S155*	CLPB_uc010rqx.1_Nonsense_Mutation_p.S110*|CLPB_uc010rqy.1_Intron|CLPB_uc001osk.2_Nonsense_Mutation_p.S155*|CLPB_uc009ytg.2_RNA|CLPB_uc010rqz.1_Intron	NM_030813	NP_110440	Q9H078	CLPB_HUMAN	caseinolytic peptidase B	155	ANK 1.				cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding			pancreas(1)	1						TGCACCTTCTGACAACAGCCT	0.458													27	66	---	---	---	---	capture	Nonsense_Mutation	SNP	72114088	72114088	CLPB	11	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	3516	172
MMP1	4312	broad.mit.edu	37	11	102665949	102665949	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102665949A>T	uc001phi.2	-	6	998	c.855T>A	c.(853-855)GAT>GAA	p.D285E	uc001phh.1_RNA|MMP1_uc010ruv.1_Missense_Mutation_p.D219E	NM_002421	NP_002412	P03956	MMP1_HUMAN	matrix metalloproteinase 1 isoform 1	285	Hemopexin-like 1.	Calcium 4; via carbonyl oxygen (By similarity).			blood coagulation|collagen catabolic process|interspecies interaction between organisms|leukocyte migration|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)|lung(1)	4	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)		TAGTTATAGCATCAAAGGTTA	0.403													61	117	---	---	---	---	capture	Missense_Mutation	SNP	102665949	102665949	MMP1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	102	8	4	4	9560	172
DSCAML1	57453	broad.mit.edu	37	11	117329509	117329509	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117329509C>T	uc001prh.1	-	19	3711	c.3709G>A	c.(3709-3711)GTA>ATA	p.V1237I		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1177	Fibronectin type-III 3.|Extracellular (Potential).				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTGCTGCGTACGCCGTCCCCA	0.652													7	36	---	---	---	---	capture	Missense_Mutation	SNP	117329509	117329509	DSCAML1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4724	172
KIAA1467	57613	broad.mit.edu	37	12	13215874	13215874	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:13215874C>G	uc001rbi.2	+	5	840	c.817C>G	c.(817-819)CGA>GGA	p.R273G	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	273						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		AGACGGTGTTCGAGACCTTGT	0.448													15	353	---	---	---	---	capture	Missense_Mutation	SNP	13215874	13215874	KIAA1467	12	C	G	G	G	1	0	0	0	0	1	0	0	0	399	31	4	4	8157	172
PIK3C2G	5288	broad.mit.edu	37	12	18435551	18435551	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18435551A>G	uc001rdt.2	+	2	652	c.536A>G	c.(535-537)AAT>AGT	p.N179S	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.N179S|PIK3C2G_uc010sic.1_5'UTR	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	179					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				CCTCCAACAAATTCATCCTTC	0.343													70	100	---	---	---	---	capture	Missense_Mutation	SNP	18435551	18435551	PIK3C2G	12	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11814	172
TMEM132D	121256	broad.mit.edu	37	12	129559351	129559351	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129559351G>A	uc009zyl.1	-	9	2697	c.2369C>T	c.(2368-2370)ACG>ATG	p.T790M	TMEM132D_uc001uia.2_Missense_Mutation_p.T328M	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	790	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GATGTTTGCCGTTCCAACAGC	0.483													55	109	---	---	---	---	capture	Missense_Mutation	SNP	129559351	129559351	TMEM132D	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15931	172
ADCY4	196883	broad.mit.edu	37	14	24787905	24787905	+	Silent	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24787905G>A	uc001wov.2	-	24	3042	c.3036C>T	c.(3034-3036)AAC>AAT	p.N1012N	ADCY4_uc001wow.2_Silent_p.N1012N|ADCY4_uc010toh.1_Silent_p.N698N|ADCY4_uc001wox.2_Silent_p.N1012N|ADCY4_uc001woy.2_Silent_p.N1012N	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	1012	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		GGCTGGCCACGTTCACTGTGT	0.537													38	76	---	---	---	---	capture	Silent	SNP	24787905	24787905	ADCY4	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	296	172
SERPINA1	5265	broad.mit.edu	37	14	94849557	94849557	+	Silent	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94849557C>T	uc001ycx.3	-	2	279	c.18G>A	c.(16-18)TCG>TCA	p.S6S	SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Silent_p.S6S|SERPINA1_uc010aux.2_Silent_p.S6S|SERPINA1_uc001ycy.3_Silent_p.S6S|SERPINA1_uc010auy.2_Silent_p.S6S|SERPINA1_uc001ycz.3_Silent_p.S6S|SERPINA1_uc010auz.2_Silent_p.S6S|SERPINA1_uc010ava.2_Silent_p.S6S|SERPINA1_uc001ydb.3_Silent_p.S6S|SERPINA1_uc010avb.2_Silent_p.S6S|SERPINA1_uc001ydc.3_Silent_p.S6S|SERPINA1_uc001yda.1_Silent_p.S6S	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	6					acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)	GGATGCCCCACGAGACAGAAG	0.612									Alpha-1-Antitrypsin_Deficiency				13	31	---	---	---	---	capture	Silent	SNP	94849557	94849557	SERPINA1	14	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	13979	172
RYR3	6263	broad.mit.edu	37	15	34064164	34064164	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34064164C>T	uc001zhi.2	+	63	8930	c.8860C>T	c.(8860-8862)CGA>TGA	p.R2954*	RYR3_uc010bar.2_Nonsense_Mutation_p.R2954*	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2954	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGCTGGGTTACGAGCATTCTT	0.448													14	24	---	---	---	---	capture	Nonsense_Mutation	SNP	34064164	34064164	RYR3	15	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	13662	172
ODF4	146852	broad.mit.edu	37	17	8243551	8243551	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8243551G>A	uc002gle.1	+	1	364	c.182G>A	c.(181-183)CGC>CAC	p.R61H		NM_153007	NP_694552	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	61					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)	1						TTGGGCCAGCGCCAGAACTCT	0.587													22	34	---	---	---	---	capture	Missense_Mutation	SNP	8243551	8243551	ODF4	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10738	172
PPP1R1B	84152	broad.mit.edu	37	17	37791907	37791907	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37791907C>T	uc002hrz.2	+	6	960	c.493C>T	c.(493-495)CGC>TGC	p.R165C	PPP1R1B_uc002hsa.2_Missense_Mutation_p.R176C|PPP1R1B_uc010cvx.2_Missense_Mutation_p.R132C|PPP1R1B_uc002hsb.2_Missense_Mutation_p.R129C|PPP1R1B_uc002hsc.2_Missense_Mutation_p.R129C|STARD3_uc010weg.1_5'Flank|STARD3_uc002hsd.2_5'Flank|STARD3_uc010weh.1_5'Flank|STARD3_uc002hse.2_5'Flank|STARD3_uc010wei.1_5'Flank	NM_032192	NP_115568	Q9UD71	PPR1B_HUMAN	protein phosphatase 1, regulatory (inhibitor)	165					signal transduction	cytosol	protein kinase inhibitor activity|protein phosphatase inhibitor activity				0	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCCCTGGGAGCGCCCACCCCC	0.582													55	86	---	---	---	---	capture	Missense_Mutation	SNP	37791907	37791907	PPP1R1B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12269	172
INTS2	57508	broad.mit.edu	37	17	59952385	59952385	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:59952385G>A	uc002izn.2	-	19	2571	c.2495C>T	c.(2494-2496)ACG>ATG	p.T832M	INTS2_uc002izm.2_Missense_Mutation_p.T824M	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	832					snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						TGCATTAACCGTCATTACCCA	0.343													7	14	---	---	---	---	capture	Missense_Mutation	SNP	59952385	59952385	INTS2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7701	172
TANC2	26115	broad.mit.edu	37	17	61271350	61271350	+	Splice_Site	SNP	A	G	G			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61271350A>G	uc002jal.3	+	4	235	c.212_splice	c.e4-2	p.G71_splice	TANC2_uc010wpe.1_5'Flank	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2						TTCTTGTTACAGGTGATGCTG	0.423													3	26	---	---	---	---	capture	Splice_Site	SNP	61271350	61271350	TANC2	17	A	G	G	G	1	0	0	0	0	0	0	1	0	91	7	5	3	15433	172
PCYT2	5833	broad.mit.edu	37	17	79864762	79864762	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79864762G>A	uc002kcf.1	-	7	613	c.550C>T	c.(550-552)CGG>TGG	p.R184W	PCYT2_uc010wva.1_Missense_Mutation_p.R152W|PCYT2_uc010wvb.1_Missense_Mutation_p.R152W|PCYT2_uc002kce.1_Missense_Mutation_p.R106W|PCYT2_uc002kcg.1_Missense_Mutation_p.R213W|PCYT2_uc002kch.1_Missense_Mutation_p.R202W|PCYT2_uc002kci.1_Missense_Mutation_p.R143W|PCYT2_uc010dii.1_Missense_Mutation_p.R184W|PCYT2_uc010wvc.1_Missense_Mutation_p.R106W	NM_002861	NP_002852	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	184	Catalytic 1 (Potential).				phospholipid biosynthetic process		ethanolamine-phosphate cytidylyltransferase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CAGGGGTTCCGCCCACCAGGG	0.622													20	52	---	---	---	---	capture	Missense_Mutation	SNP	79864762	79864762	PCYT2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	11515	172
DSC3	1825	broad.mit.edu	37	18	28605880	28605880	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28605880A>G	uc002kwj.3	-	5	631	c.476T>C	c.(475-477)GTT>GCT	p.V159A	DSC3_uc002kwi.3_Missense_Mutation_p.V159A	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	159	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			ATCAGATTCAACCTAAAAGTA	0.264													17	36	---	---	---	---	capture	Missense_Mutation	SNP	28605880	28605880	DSC3	18	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	4722	172
DSG4	147409	broad.mit.edu	37	18	28991295	28991295	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28991295G>A	uc002kwq.2	+	15	2374	c.2239G>A	c.(2239-2241)GCA>ACA	p.A747T	DSG4_uc002kwr.2_Missense_Mutation_p.A766T	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	747	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CCTCATggccgcaggggccgc	0.473													33	61	---	---	---	---	capture	Missense_Mutation	SNP	28991295	28991295	DSG4	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4734	172
ZNF681	148213	broad.mit.edu	37	19	23927954	23927954	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:23927954C>T	uc002nrk.3	-	4	540	c.398G>A	c.(397-399)TGT>TAT	p.C133Y	ZNF681_uc002nrl.3_Missense_Mutation_p.C64Y|ZNF681_uc002nrj.3_Missense_Mutation_p.C64Y	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	133					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				AGTTGGCAAACATTGGTTAAG	0.313													24	48	---	---	---	---	capture	Missense_Mutation	SNP	23927954	23927954	ZNF681	19	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	17966	172
PRODH2	58510	broad.mit.edu	37	19	36293096	36293096	+	Silent	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36293096G>A	uc002obx.1	-	10	1441	c.1423C>T	c.(1423-1425)CTG>TTG	p.L475L		NM_021232	NP_067055	Q9UF12	PROD2_HUMAN	kidney and liver proline oxidase 1	475					glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CACATACCCAGTGCTAGAGAG	0.577													51	134	---	---	---	---	capture	Silent	SNP	36293096	36293096	PRODH2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	12445	172
PSG7	5676	broad.mit.edu	37	19	43439731	43439731	+	Silent	SNP	G	A	A	rs140238439	by1000genomes	TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43439731G>A	uc002ovl.3	-	2	357	c.255C>T	c.(253-255)GAC>GAT	p.D85D	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Intron	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	85	Ig-like V-type.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				TTATTTGACCGTCTACTATAT	0.418													75	283	---	---	---	---	capture	Silent	SNP	43439731	43439731	PSG7	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12555	172
PVR	5817	broad.mit.edu	37	19	45153193	45153193	+	Silent	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45153193C>T	uc002ozm.2	+	3	839	c.540C>T	c.(538-540)CAC>CAT	p.H180H	PVR_uc010ejs.2_Silent_p.H180H|PVR_uc010xxb.1_Silent_p.H180H|PVR_uc010xxc.1_Silent_p.H180H|PVR_uc002ozn.2_Silent_p.H125H	NM_006505	NP_006496	P15151	PVR_HUMAN	poliovirus receptor isoform alpha	180	Extracellular (Potential).|Ig-like C2-type 1.				adherens junction organization|cell adhesion|cell junction assembly|interspecies interaction between organisms|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity	cell junction|cell surface|cytoplasm|extracellular space|integral to membrane|nucleus	cell adhesion molecule binding|receptor activity				0	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		TCACCTGGCACTCAGACCTGG	0.632													43	69	---	---	---	---	capture	Silent	SNP	45153193	45153193	PVR	19	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	12732	172
VSTM1	284415	broad.mit.edu	37	19	54567025	54567025	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54567025C>T	uc002qcw.3	-	1	183	c.7G>A	c.(7-9)GCA>ACA	p.A3T	VSTM1_uc010erb.2_RNA|VSTM1_uc002qcx.3_Missense_Mutation_p.A3T	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	3						integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		AGGAATTCTGCGGTCATAGCG	0.627													86	163	---	---	---	---	capture	Missense_Mutation	SNP	54567025	54567025	VSTM1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17110	172
GPR17	2840	broad.mit.edu	37	2	128408657	128408657	+	Silent	SNP	C	T	T	rs61749508		TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128408657C>T	uc010yzn.1	+	4	1043	c.432C>T	c.(430-432)TAC>TAT	p.Y144Y	LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Silent_p.Y144Y|GPR17_uc010yzo.1_Silent_p.Y116Y|GPR17_uc002tpd.2_Silent_p.Y116Y	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a	144	Helical; Name=3; (Potential).					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		TCAACATGTACGCCAGCATCT	0.602													35	71	---	---	---	---	capture	Silent	SNP	128408657	128408657	GPR17	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6601	172
TTN	7273	broad.mit.edu	37	2	179548796	179548796	+	Silent	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179548796C>T	uc010zfg.1	-	130	29228	c.29004G>A	c.(29002-29004)CCG>CCA	p.P9668P	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.P6329P|TTN_uc010fre.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10595							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCTCTCTTCGGTTCCTCTG	0.368													18	46	---	---	---	---	capture	Silent	SNP	179548796	179548796	TTN	2	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	16617	172
ACCN4	55515	broad.mit.edu	37	2	220379838	220379838	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220379838C>T	uc002vma.2	+	1	787	c.773C>T	c.(772-774)GCC>GTC	p.A258V	ACCN4_uc010fwi.1_Missense_Mutation_p.A258V|ACCN4_uc010fwj.1_Missense_Mutation_p.A258V|ACCN4_uc002vly.1_Missense_Mutation_p.A258V|ACCN4_uc002vlz.2_Missense_Mutation_p.A258V|ACCN4_uc002vmb.2_5'Flank	NM_182847	NP_878267	Q96FT7	ACCN4_HUMAN	amiloride-sensitive cation channel 4 isoform 2	258	Extracellular (Potential).					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity			ovary(2)	2		Renal(207;0.0183)		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)		CTCAGCGATGCCGACATCTTC	0.657													23	32	---	---	---	---	capture	Missense_Mutation	SNP	220379838	220379838	ACCN4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	131	172
SLCO4A1	28231	broad.mit.edu	37	20	61297841	61297841	+	Silent	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61297841C>T	uc002ydb.1	+	7	1591	c.1386C>T	c.(1384-1386)ACC>ACT	p.T462T	SLCO4A1_uc002ydc.1_RNA|LOC100127888_uc002ydd.2_RNA|SLCO4A1_uc002yde.1_5'Flank	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family	462	Helical; Name=9; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)			TGTTCTGCACCGTTGTCAGCC	0.652													76	172	---	---	---	---	capture	Silent	SNP	61297841	61297841	SLCO4A1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14621	172
OSM	5008	broad.mit.edu	37	22	30660354	30660354	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30660354G>A	uc003ahb.2	-	3	329	c.277C>T	c.(277-279)CGG>TGG	p.R93W		NM_020530	NP_065391	P13725	ONCM_HUMAN	oncostatin M precursor	93					cell proliferation|immune response|negative regulation of cell proliferation|negative regulation of hormone secretion|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of MAPKKK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of growth	extracellular space|oncostatin-M receptor complex	cytokine activity|growth factor activity|oncostatin-M receptor binding			skin(1)	1			Epithelial(10;0.206)			AGGAAGCCCCGCCTGCCCAGC	0.642													24	32	---	---	---	---	capture	Missense_Mutation	SNP	30660354	30660354	OSM	22	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	11195	172
CX3CR1	1524	broad.mit.edu	37	3	39307959	39307959	+	Silent	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39307959G>A	uc003cjl.2	-	2	134	c.42C>T	c.(40-42)TAC>TAT	p.Y14Y		NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	14	Extracellular (Potential).				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		CCAAATCATCGTACTCAAAGT	0.443													17	29	---	---	---	---	capture	Silent	SNP	39307959	39307959	CX3CR1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4035	172
WDR82	80335	broad.mit.edu	37	3	52292683	52292683	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52292683C>T	uc003ddl.2	-	8	1063	c.781G>A	c.(781-783)GGC>AGC	p.G261S	WDR82_uc003ddk.2_Missense_Mutation_p.G186S	NM_025222	NP_079498	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	261	WD 5.				histone H3-K4 methylation	chromatin|PTW/PP1 phosphatase complex|Set1C/COMPASS complex	protein binding				0				BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		TGGATCTTGCCATCCTCTGAA	0.438													31	74	---	---	---	---	capture	Missense_Mutation	SNP	52292683	52292683	WDR82	3	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	17212	172
TRH	7200	broad.mit.edu	37	3	129695840	129695840	+	Silent	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:129695840G>A	uc003enc.2	+	3	1071	c.510G>A	c.(508-510)GAG>GAA	p.E170E		NM_007117	NP_009048	P20396	TRH_HUMAN	thyrotropin-releasing hormone	170					cell-cell signaling|hormone-mediated signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|thyrotropin-releasing hormone activity			ovary(1)	1						Gggaagaagaggaggaggagg	0.547													3	74	---	---	---	---	capture	Silent	SNP	129695840	129695840	TRH	3	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	16361	172
GFM1	85476	broad.mit.edu	37	3	158378683	158378683	+	Silent	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:158378683C>T	uc003fce.2	+	10	1349	c.1242C>T	c.(1240-1242)GCC>GCT	p.A414A	GFM1_uc003fcd.2_Silent_p.A414A|GFM1_uc003fcf.2_RNA|GFM1_uc003fcg.2_Silent_p.A345A	NM_024996	NP_079272	Q96RP9	EFGM_HUMAN	G elongation factor, mitochondrial 1 precursor	414					mitochondrial translational elongation	mitochondrion	GTP binding|GTPase activity|translation elongation factor activity			ovary(3)|central_nervous_system(1)	4			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			AAGTATATGCCGGAGACATCT	0.353													48	106	---	---	---	---	capture	Silent	SNP	158378683	158378683	GFM1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6281	172
FGG	2266	broad.mit.edu	37	4	155528019	155528019	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155528019C>T	uc003ioj.2	-	8	1108	c.967G>A	c.(967-969)GAT>AAT	p.D323N	FGG_uc003iog.2_Missense_Mutation_p.D323N|FGG_uc003ioh.2_Missense_Mutation_p.D331N|FGG_uc010ipx.2_Missense_Mutation_p.D151N|FGG_uc010ipy.2_Missense_Mutation_p.D34N|FGG_uc003ioi.2_Missense_Mutation_p.D34N|FGG_uc003iok.2_Missense_Mutation_p.D331N	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	323	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	CTAGGATCATCGCCAAAATCA	0.468													43	91	---	---	---	---	capture	Missense_Mutation	SNP	155528019	155528019	FGG	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5816	172
IRX4	50805	broad.mit.edu	37	5	1880903	1880903	+	Silent	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1880903G>A	uc003jcz.2	-	3	462	c.343C>T	c.(343-345)CTG>TTG	p.L115L	IRX4_uc011cmf.1_5'UTR	NM_016358	NP_057442	P78413	IRX4_HUMAN	iroquois homeobox 4	115					heart development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(108;0.242)		GCTGGTGCCAGGCCCCCATGC	0.622													52	79	---	---	---	---	capture	Silent	SNP	1880903	1880903	IRX4	5	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7769	172
TRPC7	57113	broad.mit.edu	37	5	135692954	135692954	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135692954G>A	uc003lbn.1	-	1	122	c.119C>T	c.(118-120)ACG>ATG	p.T40M	TRPC7_uc010jef.1_Missense_Mutation_p.T32M|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.T32M|TRPC7_uc010jei.1_Missense_Mutation_p.T32M|TRPC7_uc010jej.1_Translation_Start_Site	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	41	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTCCTCGGGCGTCAGACTGGT	0.602													61	111	---	---	---	---	capture	Missense_Mutation	SNP	135692954	135692954	TRPC7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16467	172
PCDHGA6	56109	broad.mit.edu	37	5	140754770	140754770	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140754770C>T	uc003ljy.1	+	1	1120	c.1120C>T	c.(1120-1122)CGA>TGA	p.R374*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Nonsense_Mutation_p.R374*	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	374	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTGTTCGATCGAGACTCTGG	0.428													38	81	---	---	---	---	capture	Nonsense_Mutation	SNP	140754770	140754770	PCDHGA6	5	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	11461	172
FBXO38	81545	broad.mit.edu	37	5	147807296	147807296	+	Silent	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147807296C>T	uc003lpf.1	+	15	2559	c.2439C>T	c.(2437-2439)TCC>TCT	p.S813S	FBXO38_uc003lpg.1_Intron|FBXO38_uc003lph.2_Intron	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	813						cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTACGAGATCCGCCTTTTCCT	0.567													11	45	---	---	---	---	capture	Silent	SNP	147807296	147807296	FBXO38	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5692	172
FAM54A	113115	broad.mit.edu	37	6	136554632	136554632	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:136554632G>A	uc010kgp.1	-	7	1265	c.875C>T	c.(874-876)CCT>CTT	p.P292L	FAM54A_uc003qgt.1_Missense_Mutation_p.P292L|FAM54A_uc003qgu.1_Missense_Mutation_p.P249L	NM_001099286	NP_001092756	Q6P444	FA54A_HUMAN	DUF729 domain containing 1	292										skin(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00228)|OV - Ovarian serous cystadenocarcinoma(155;0.00504)		TCTACCGCCAGGTGACCtatt	0.313													22	14	---	---	---	---	capture	Missense_Mutation	SNP	136554632	136554632	FAM54A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	5530	172
SDK1	221935	broad.mit.edu	37	7	3991529	3991529	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:3991529C>T	uc003smx.2	+	7	1266	c.1127C>T	c.(1126-1128)GCG>GTG	p.A376V		NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	376	Ig-like C2-type 3.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCGGCCAGGGCGACGGCCTTT	0.577													24	64	---	---	---	---	capture	Missense_Mutation	SNP	3991529	3991529	SDK1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13861	172
CALCR	799	broad.mit.edu	37	7	93055883	93055883	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93055883G>A	uc003umv.1	-	15	1573	c.1312C>T	c.(1312-1314)CGC>TGC	p.R438C	CALCR_uc011kia.1_Missense_Mutation_p.R218C|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.R404C|CALCR_uc003umw.2_Missense_Mutation_p.R404C	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	420	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	GCCCATTGGCGCTTCACGGTG	0.537													4	96	---	---	---	---	capture	Missense_Mutation	SNP	93055883	93055883	CALCR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2555	172
KIAA1549	57670	broad.mit.edu	37	7	138593736	138593736	+	Splice_Site	SNP	C	A	A			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138593736C>A	uc011kql.1	-	5	3325	c.3276_splice	c.e5+1	p.Q1092_splice	KIAA1549_uc003vuk.3_Splice_Site_p.Q1042_splice|KIAA1549_uc011kqj.1_Splice_Site_p.Q1092_splice	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1							integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						GATATTCTCACCTGCACCGTG	0.468			O	BRAF	pilocytic astrocytoma								25	58	---	---	---	---	capture	Splice_Site	SNP	138593736	138593736	KIAA1549	7	C	A	A	A	1	0	0	0	0	0	0	1	0	234	18	5	4	8166	172
PRKAG2	51422	broad.mit.edu	37	7	151261177	151261177	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151261177A>T	uc003wkk.2	-	14	2182	c.1571T>A	c.(1570-1572)ATA>AAA	p.I524K	PRKAG2_uc003wki.2_Missense_Mutation_p.I283K|PRKAG2_uc011kvl.1_Missense_Mutation_p.I399K|PRKAG2_uc003wkj.2_Missense_Mutation_p.I480K|PRKAG2_uc003wkl.2_Missense_Mutation_p.I72K	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit	524	CBS 4.				ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		AGCTCTTACTATTCTGTCCAC	0.517													57	169	---	---	---	---	capture	Missense_Mutation	SNP	151261177	151261177	PRKAG2	7	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	12397	172
FRMD3	257019	broad.mit.edu	37	9	85913683	85913683	+	Silent	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:85913683C>T	uc004ams.1	-	12	1252	c.1050G>A	c.(1048-1050)AGG>AGA	p.R350R	FRMD3_uc004amr.1_Silent_p.R336R	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	350						cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						CAGGAGGCTCCCTCTGGATCT	0.493													17	46	---	---	---	---	capture	Silent	SNP	85913683	85913683	FRMD3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	5993	172
LRRC8A	56262	broad.mit.edu	37	9	131669841	131669841	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131669841C>T	uc004bwl.3	+	3	652	c.398C>T	c.(397-399)ACG>ATG	p.T133M	LRRC8A_uc010myp.2_Missense_Mutation_p.T133M|LRRC8A_uc010myq.2_Missense_Mutation_p.T133M	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member	133	Helical; (Potential).				pre-B cell differentiation	integral to membrane					0						CTTCTGCACACGCTCATCTTC	0.557													16	72	---	---	---	---	capture	Missense_Mutation	SNP	131669841	131669841	LRRC8A	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8936	172
PIK3C2B	5287	broad.mit.edu	37	1	204438072	204438072	+	Frame_Shift_Del	DEL	G	-	-	rs115574296	by1000genomes	TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204438072delG	uc001haw.2	-	3	1338	c.859delC	c.(859-861)CGCfs	p.R287fs	PIK3C2B_uc010pqv.1_Frame_Shift_Del_p.R287fs|PIK3C2B_uc001hax.1_Frame_Shift_Del_p.R287fs|PIK3C2B_uc009xbd.1_RNA	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	287	Interaction with GRB2.				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GCATAGGTGCGGGGGGGCACC	0.622													9	1174	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	204438072	204438072	PIK3C2B	1	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	11813	172
APBB1IP	54518	broad.mit.edu	37	10	26849669	26849672	+	Frame_Shift_Del	DEL	CTCT	-	-	rs145279460		TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26849669_26849672delCTCT	uc001iss.2	+	13	1586_1589	c.1265_1268delCTCT	c.(1264-1269)ACTCTCfs	p.T422fs		NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	422_423				L -> F (in Ref. 1; BAC41256).	blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						TATGGGAAGACTCTCTATGATAAC	0.461													26	37	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	26849669	26849672	APBB1IP	10	CTCT	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	753	172
POLRMT	5442	broad.mit.edu	37	19	618520	618522	+	In_Frame_Del	DEL	GGA	-	-			TCGA-19-5952-01	TCGA-19-5952-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:618520_618522delGGA	uc002lpf.1	-	17	3444_3446	c.3388_3390delTCC	c.(3388-3390)TCCdel	p.S1130del		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	1130	Mediates interaction with TEFM.				transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCATCATGTGGGAGGAGTCCAGC	0.660													9	37	---	---	---	---	capture_indel	In_Frame_Del	DEL	618520	618522	POLRMT	19	GGA	-	-	-	1	0	1	0	1	0	0	0	0	548	43	5	5	12140	172
