Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PADI6	353238	broad.mit.edu	37	1	17708559	17708559	+	Silent	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17708559G>A	uc001bak.1	+	6	651	c.651G>A	c.(649-651)TCG>TCA	p.S217S		NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6	209					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AGGAAGAGTCGAAGAAGGCGA	0.522													12	50	---	---	---	---	capture	Silent	SNP	17708559	17708559	PADI6	1	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	11285	173
HP1BP3	50809	broad.mit.edu	37	1	21071371	21071371	+	Silent	SNP	A	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21071371A>G	uc001bdw.1	-	13	1721	c.1581T>C	c.(1579-1581)CCT>CCC	p.P527P	HP1BP3_uc001bdv.1_Silent_p.P489P|HP1BP3_uc010odh.1_Silent_p.P489P|HP1BP3_uc001bdy.1_Silent_p.P527P|HP1BP3_uc010odf.1_Silent_p.P186P|HP1BP3_uc010odg.1_Silent_p.P375P	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74	527	Lys-rich.				nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		CACTGGTTGCAGGCTTCTTTG	0.458													3	119	---	---	---	---	capture	Silent	SNP	21071371	21071371	HP1BP3	1	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	7253	173
TINAGL1	64129	broad.mit.edu	37	1	32050587	32050587	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32050587C>T	uc001bta.2	+	7	933	c.807C>T	c.(805-807)GGC>GGT	p.G269G	TINAGL1_uc001bsz.2_Silent_p.G124G|TINAGL1_uc010ogj.1_Silent_p.G238G|TINAGL1_uc010ogk.1_Silent_p.G269G	NM_022164	NP_071447	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1	269					endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		AGCAGCAGGGCTGCCGCGGTG	0.627													18	66	---	---	---	---	capture	Silent	SNP	32050587	32050587	TINAGL1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	353	28	2	2	15807	173
WDR78	79819	broad.mit.edu	37	1	67301382	67301382	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:67301382C>T	uc001dcx.2	-	11	1716	c.1660G>A	c.(1660-1662)GTT>ATT	p.V554I	WDR78_uc009waw.2_Missense_Mutation_p.V300I|WDR78_uc009wax.2_Intron	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	554	WD 1.									ovary(2)	2						TGATAGCCAACGGCTAAAAGG	0.363													29	86	---	---	---	---	capture	Missense_Mutation	SNP	67301382	67301382	WDR78	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17209	173
BARHL2	343472	broad.mit.edu	37	1	91182597	91182597	+	Silent	SNP	A	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91182597A>G	uc001dns.2	-	1	198	c.156T>C	c.(154-156)TGT>TGC	p.C52C		NM_020063	NP_064447	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	52						nucleus	sequence-specific DNA binding			ovary(1)	1		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		CAATCTCCGAACAGGGAGATG	0.607													6	84	---	---	---	---	capture	Silent	SNP	91182597	91182597	BARHL2	1	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	1303	173
HSD3B1	3283	broad.mit.edu	37	1	120056674	120056674	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120056674C>T	uc001ehv.1	+	4	673	c.528C>T	c.(526-528)AAC>AAT	p.N176N	HSD3B1_uc001ehw.2_Silent_p.N178N	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1	176					androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	ATCTGAAAAACGGCGGCACCC	0.507													30	55	---	---	---	---	capture	Silent	SNP	120056674	120056674	HSD3B1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7315	173
PDE4DIP	9659	broad.mit.edu	37	1	144859794	144859794	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144859794C>G	uc001elw.3	-	38	6581	c.6290G>C	c.(6289-6291)AGC>ACC	p.S2097T	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.S1991T|PDE4DIP_uc001elv.3_Missense_Mutation_p.S1104T	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2097					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AGGGTCAGTGCTGGCTGGGAA	0.577			T	PDGFRB	MPD								7	84	---	---	---	---	capture	Missense_Mutation	SNP	144859794	144859794	PDE4DIP	1	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	11546	173
PDE4DIP	9659	broad.mit.edu	37	1	144859988	144859988	+	Silent	SNP	C	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144859988C>G	uc001elw.3	-	38	6387	c.6096G>C	c.(6094-6096)CTG>CTC	p.L2032L	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Silent_p.L1926L|PDE4DIP_uc001elv.3_Silent_p.L1039L	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2032	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GACAGGCATCCAGGCTGTAAG	0.527			T	PDGFRB	MPD								24	160	---	---	---	---	capture	Silent	SNP	144859988	144859988	PDE4DIP	1	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	11546	173
ADAMTSL4	54507	broad.mit.edu	37	1	150530495	150530495	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150530495G>A	uc001eux.2	+	14	2488	c.2252G>A	c.(2251-2253)CGG>CAG	p.R751Q	ADAMTSL4_uc001euw.2_Missense_Mutation_p.R751Q|ADAMTSL4_uc009wlw.2_Missense_Mutation_p.R774Q|ADAMTSL4_uc010pcg.1_Missense_Mutation_p.R712Q|ADAMTSL4_uc009wlx.2_5'UTR	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	751	TSP type-1 2.				apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CTGCAGTGCCGGCAGGAATTT	0.706													21	71	---	---	---	---	capture	Missense_Mutation	SNP	150530495	150530495	ADAMTSL4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	277	173
FCGR3A	2214	broad.mit.edu	37	1	161518335	161518335	+	Silent	SNP	G	A	A	rs145248243		TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161518335G>A	uc001gat.3	-	4	332	c.195C>T	c.(193-195)AGC>AGT	p.S65S	FCGR3A_uc001gar.2_Silent_p.S101S|FCGR3A_uc001gas.2_Silent_p.S100S|FCGR3A_uc009wuh.2_Silent_p.S64S|FCGR3A_uc009wui.2_Silent_p.S65S	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	65	Ig-like C2-type 1.|Extracellular (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TTGAGATGAGGCTCTCATTGT	0.552													48	264	---	---	---	---	capture	Silent	SNP	161518335	161518335	FCGR3A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5730	173
GORAB	92344	broad.mit.edu	37	1	170521169	170521169	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:170521169A>G	uc001gha.2	+	5	778	c.751A>G	c.(751-753)AGG>GGG	p.R251G	GORAB_uc009wvx.2_Missense_Mutation_p.R71G|GORAB_uc001ghb.2_Missense_Mutation_p.R71G|GORAB_uc001ghc.2_Missense_Mutation_p.R71G|GORAB_uc001ghd.2_Missense_Mutation_p.R44G	NM_152281	NP_689494	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting isoform a	251	Necessary for interaction with RCHY1.|Potential.					Golgi apparatus|nucleus					0						GCGGTTTGACAGGGCTGAAGC	0.398													3	139	---	---	---	---	capture	Missense_Mutation	SNP	170521169	170521169	GORAB	1	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	6508	173
PAPPA2	60676	broad.mit.edu	37	1	176563936	176563936	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:176563936T>C	uc001gkz.2	+	3	2360	c.1196T>C	c.(1195-1197)TTC>TCC	p.F399S	PAPPA2_uc001gky.1_Missense_Mutation_p.F399S|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	399					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						AACAGCCCCTTCATGGCATCT	0.592													3	103	---	---	---	---	capture	Missense_Mutation	SNP	176563936	176563936	PAPPA2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	11337	173
ANGPTL1	9068	broad.mit.edu	37	1	178822880	178822880	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:178822880G>A	uc001gma.2	-	4	1342	c.866C>T	c.(865-867)TCG>TTG	p.S289L	RALGPS2_uc001gly.1_Intron|RALGPS2_uc001glz.2_Intron|RALGPS2_uc010pnb.1_Intron|ANGPTL1_uc001gmb.2_Missense_Mutation_p.S289L|ANGPTL1_uc010pnc.1_Missense_Mutation_p.S211L	NM_004673	NP_004664	O95841	ANGL1_HUMAN	angiopoietin-like 1 precursor	289	Fibrinogen C-terminal.					extracellular space	receptor binding				0						CCCACTGACCGAATGCCCAGC	0.373													30	91	---	---	---	---	capture	Missense_Mutation	SNP	178822880	178822880	ANGPTL1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	610	173
KIAA1614	57710	broad.mit.edu	37	1	180914469	180914469	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:180914469C>T	uc001gok.2	+	9	3385	c.3318C>T	c.(3316-3318)CTC>CTT	p.L1106L	KIAA1614_uc001gol.1_Silent_p.L727L|KIAA1614_uc001gom.1_Silent_p.L197L|STX6_uc009wxo.1_RNA	NM_020950	NP_066001	Q5VZ46	K1614_HUMAN	hypothetical protein LOC57710	1106										ovary(3)|skin(1)	4						GGCGTGCCCTCAGTGTGGAGG	0.662													16	63	---	---	---	---	capture	Silent	SNP	180914469	180914469	KIAA1614	1	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	8170	173
LAMB3	3914	broad.mit.edu	37	1	209796522	209796522	+	Silent	SNP	G	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209796522G>T	uc001hhg.2	-	16	2751	c.2361C>A	c.(2359-2361)CTC>CTA	p.L787L	LAMB3_uc009xco.2_Silent_p.L787L|LAMB3_uc001hhh.2_Silent_p.L787L|LAMB3_uc010psl.1_RNA	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	787	Domain alpha.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		AGTTGCCACAGAGCTGTGGAC	0.572													10	27	---	---	---	---	capture	Silent	SNP	209796522	209796522	LAMB3	1	G	T	T	T	1	0	0	0	0	0	0	0	1	418	33	4	4	8532	173
TRIM58	25893	broad.mit.edu	37	1	248039229	248039229	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248039229C>T	uc001ido.2	+	6	947	c.899C>T	c.(898-900)GCG>GTG	p.A300V	OR2W3_uc001idp.1_5'UTR	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	300	B30.2/SPRY.					intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCCGCCACGGCGCACCCGAGT	0.552													13	39	---	---	---	---	capture	Missense_Mutation	SNP	248039229	248039229	TRIM58	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16414	173
PTEN	5728	broad.mit.edu	37	10	89692893	89692893	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692893C>T	uc001kfb.2	+	6	1408	c.377C>T	c.(376-378)GCT>GTT	p.A126V		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	126	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.A126T(5)|p.R55fs*1(4)|p.A126D(3)|p.?(2)|p.Y27fs*1(2)|p.A126P(2)|p.Y27_N212>Y(2)|p.A121_F145del(1)|p.A126V(1)|p.A126S(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CACTGTAAAGCTGGAAAGGGA	0.408		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			26	63	---	---	---	---	capture	Missense_Mutation	SNP	89692893	89692893	PTEN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	12633	173
PDE3B	5140	broad.mit.edu	37	11	14839801	14839801	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:14839801G>A	uc001mln.2	+	6	1948	c.1595G>A	c.(1594-1596)CGA>CAA	p.R532Q	PDE3B_uc010rcr.1_Missense_Mutation_p.R481Q	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	532					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						CTAACTAATCGATCACCCATA	0.388													8	42	---	---	---	---	capture	Missense_Mutation	SNP	14839801	14839801	PDE3B	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11541	173
OR5T3	390154	broad.mit.edu	37	11	56020021	56020021	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56020021C>T	uc010rjd.1	+	1	346	c.346C>T	c.(346-348)CTG>TTG	p.L116L		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	116	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					GGTCAATTTCCTGGCAAAAAA	0.368													49	124	---	---	---	---	capture	Silent	SNP	56020021	56020021	OR5T3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	11087	173
SHANK2	22941	broad.mit.edu	37	11	70319235	70319235	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:70319235C>T	uc001oqc.2	-	22	5367	c.5289G>A	c.(5287-5289)TCG>TCA	p.S1763S	SHANK2_uc010rqn.1_Silent_p.S1175S|SHANK2_uc001opz.2_Silent_p.S1168S|uc009ysn.1_Silent_p.G45G|SHANK2_uc001opy.2_Silent_p.S99S	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1384					intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			AGGGGGATGGCGACCTACTGC	0.537													30	100	---	---	---	---	capture	Silent	SNP	70319235	70319235	SHANK2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14158	173
SLCO2B1	11309	broad.mit.edu	37	11	74876887	74876887	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74876887G>A	uc001owb.2	+	4	728	c.341G>A	c.(340-342)CGA>CAA	p.R114Q	SLCO2B1_uc010rrq.1_Intron|SLCO2B1_uc010rrr.1_Intron|SLCO2B1_uc010rrs.1_5'UTR|SLCO2B1_uc001owc.2_5'UTR|SLCO2B1_uc001owd.2_Missense_Mutation_p.R92Q	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	114	Cytoplasmic (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	CGGGTGCACCGACCCCGAATG	0.572													51	138	---	---	---	---	capture	Missense_Mutation	SNP	74876887	74876887	SLCO2B1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14619	173
DRD2	1813	broad.mit.edu	37	11	113286210	113286210	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113286210C>T	uc001pnz.2	-	4	977	c.656G>A	c.(655-657)CGC>CAC	p.R219H	DRD2_uc010rwv.1_Missense_Mutation_p.R218H|DRD2_uc001poa.3_Missense_Mutation_p.R219H|DRD2_uc001pob.3_Missense_Mutation_p.R219H|DRD2_uc009yyr.1_Missense_Mutation_p.R219H	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long	219	Cytoplasmic (By similarity).|Interaction with PPP1R9B (By similarity).				activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	TCGCTTGCGGCGTCTGCGGAG	0.572													27	97	---	---	---	---	capture	Missense_Mutation	SNP	113286210	113286210	DRD2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4712	173
GDF3	9573	broad.mit.edu	37	12	7842975	7842975	+	Silent	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7842975G>A	uc001qte.2	-	2	630	c.594C>T	c.(592-594)TTC>TTT	p.F198F		NM_020634	NP_065685	Q9NR23	GDF3_HUMAN	growth differentiation factor 3 precursor	198					eye development|growth|skeletal system development	extracellular space	cytokine activity|growth factor activity			skin(3)|ovary(1)|lung(1)|central_nervous_system(1)	6						GGAATAACCCGAAATTTTTCC	0.473													21	83	---	---	---	---	capture	Silent	SNP	7842975	7842975	GDF3	12	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	6255	173
ERP27	121506	broad.mit.edu	37	12	15070213	15070213	+	Missense_Mutation	SNP	C	T	T	rs139573344	byFrequency	TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:15070213C>T	uc001rco.2	-	5	496	c.475G>A	c.(475-477)GTA>ATA	p.V159I		NM_152321	NP_689534	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27 kDa precursor	159						endoplasmic reticulum lumen				breast(1)	1						ATCTGAATTACGCTGTTGAAT	0.453													25	82	---	---	---	---	capture	Missense_Mutation	SNP	15070213	15070213	ERP27	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5196	173
CPSF6	11052	broad.mit.edu	37	12	69645041	69645041	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69645041G>C	uc001sut.3	+	2	303	c.193G>C	c.(193-195)GGT>CGT	p.G65R	CPSF6_uc001suu.3_Missense_Mutation_p.G65R	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	65					mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			TGATGATGTGGGTAAAGGAGC	0.378													15	20	---	---	---	---	capture	Missense_Mutation	SNP	69645041	69645041	CPSF6	12	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	3794	173
KIAA1033	23325	broad.mit.edu	37	12	105514968	105514968	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:105514968G>T	uc001tld.2	+	9	738	c.651G>T	c.(649-651)TGG>TGT	p.W217C	KIAA1033_uc010swr.1_Missense_Mutation_p.W217C|KIAA1033_uc010sws.1_Missense_Mutation_p.W29C	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	217					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						AAGACCACTGGACTATGTACA	0.299													9	39	---	---	---	---	capture	Missense_Mutation	SNP	105514968	105514968	KIAA1033	12	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	8128	173
WSCD2	9671	broad.mit.edu	37	12	108603905	108603905	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108603905C>A	uc001tms.2	+	4	1249	c.505C>A	c.(505-507)CTG>ATG	p.L169M	WSCD2_uc001tmt.2_Missense_Mutation_p.L169M	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	169	WSC 1.					integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						CAGGGGTTACCTGTATGGCGG	0.647													10	35	---	---	---	---	capture	Missense_Mutation	SNP	108603905	108603905	WSCD2	12	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	17288	173
TMEM132D	121256	broad.mit.edu	37	12	129563144	129563144	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129563144G>A	uc009zyl.1	-	8	2378	c.2050C>T	c.(2050-2052)CCA>TCA	p.P684S	TMEM132D_uc001uia.2_Missense_Mutation_p.P222S	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	684	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTGCTTCCTGGGCTGAGCTGC	0.577													27	82	---	---	---	---	capture	Missense_Mutation	SNP	129563144	129563144	TMEM132D	12	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15931	173
ANKLE2	23141	broad.mit.edu	37	12	133306704	133306704	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133306704C>G	uc001ukx.2	-	11	2111	c.2044G>C	c.(2044-2046)GAG>CAG	p.E682Q	ANKLE2_uc009zyw.1_Missense_Mutation_p.E37Q	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	682						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		AGGTCTGCCTCCTGCTCCAAG	0.572													32	87	---	---	---	---	capture	Missense_Mutation	SNP	133306704	133306704	ANKLE2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	630	173
SLC39A2	29986	broad.mit.edu	37	14	21469493	21469493	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21469493C>T	uc001vyr.2	+	4	872	c.685C>T	c.(685-687)CTA>TTA	p.L229L	SLC39A2_uc001vys.2_Silent_p.L130L	NM_014579	NP_055394	Q9NP94	S39A2_HUMAN	solute carrier family 39 (zinc transporter),	229	Helical; (Potential).					cytoplasmic membrane-bounded vesicle|integral to plasma membrane	zinc ion transmembrane transporter activity			ovary(2)|central_nervous_system(1)	3	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0187)		GTTCTCCATACTATTATTAGC	0.567													23	57	---	---	---	---	capture	Silent	SNP	21469493	21469493	SLC39A2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	14510	173
C15orf2	23742	broad.mit.edu	37	15	24921103	24921103	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24921103G>A	uc001ywo.2	+	1	563	c.89G>A	c.(88-90)CGG>CAG	p.R30Q		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	30					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CCCCTGTCCCGGGACGCCTCC	0.706													7	7	---	---	---	---	capture	Missense_Mutation	SNP	24921103	24921103	C15orf2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1770	173
CHRNB4	1143	broad.mit.edu	37	15	78917630	78917630	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:78917630C>T	uc002bed.1	-	6	1454	c.1342G>A	c.(1342-1344)GTT>ATT	p.V448I	CHRNB4_uc002bee.1_Silent_p.S121S|uc002bef.1_5'Flank	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	448	Cytoplasmic (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						CAGTCCTCAACGACCTGCAGG	0.607													17	55	---	---	---	---	capture	Missense_Mutation	SNP	78917630	78917630	CHRNB4	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3358	173
CHRNB4	1143	broad.mit.edu	37	15	78922161	78922161	+	Silent	SNP	G	A	A	rs80249872		TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:78922161G>A	uc002bed.1	-	5	598	c.486C>T	c.(484-486)TTC>TTT	p.F162F	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_5'UTR	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	162	Extracellular (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						TCTGCTGGTCGAAGGGAAAGT	0.552													28	46	---	---	---	---	capture	Silent	SNP	78922161	78922161	CHRNB4	15	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	3358	173
SEPT12	124404	broad.mit.edu	37	16	4833669	4833669	+	Missense_Mutation	SNP	C	T	T	rs140969211		TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4833669C>T	uc002cxq.2	-	6	752	c.611G>A	c.(610-612)CGA>CAA	p.R204Q	SEPT12_uc002cxr.2_Missense_Mutation_p.R158Q|SEPT12_uc010bty.2_RNA	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2	204					cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						GAAGGCCTCTCGCTCCTCCAT	0.677													18	38	---	---	---	---	capture	Missense_Mutation	SNP	4833669	4833669	SEPT12	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13955	173
ITGAD	3681	broad.mit.edu	37	16	31435264	31435264	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31435264C>T	uc002ebv.1	+	27	3193	c.3144C>T	c.(3142-3144)TTC>TTT	p.F1048F	ITGAD_uc010cap.1_Silent_p.F1049F	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	1048	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						ATCTCAGTTTCGGCTGGGTCC	0.642													9	33	---	---	---	---	capture	Silent	SNP	31435264	31435264	ITGAD	16	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	7807	173
C16orf78	123970	broad.mit.edu	37	16	49407930	49407930	+	Missense_Mutation	SNP	G	A	A	rs144505396	byFrequency;by1000genomes	TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:49407930G>A	uc002efr.2	+	1	123	c.80G>A	c.(79-81)CGC>CAC	p.R27H		NM_144602	NP_653203	Q8WTQ4	CP078_HUMAN	hypothetical protein LOC123970	27										central_nervous_system(1)	1						GAAGATAGGCGCATGTCTGAC	0.488													4	82	---	---	---	---	capture	Missense_Mutation	SNP	49407930	49407930	C16orf78	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1820	173
NF1	4763	broad.mit.edu	37	17	29588751	29588751	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29588751C>T	uc002hgg.2	+	35	4933	c.4600C>T	c.(4600-4602)CGA>TGA	p.R1534*	NF1_uc002hgh.2_Nonsense_Mutation_p.R1513*|NF1_uc002hgi.1_Nonsense_Mutation_p.R546*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1534					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(3)|p.R1534*(3)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGTTGGAAGACGACCTTTTGA	0.413			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			20	49	---	---	---	---	capture	Nonsense_Mutation	SNP	29588751	29588751	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	10263	173
KRT25	147183	broad.mit.edu	37	17	38904633	38904633	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38904633C>T	uc002hve.2	-	8	1310	c.1249G>A	c.(1249-1251)GCC>ACC	p.A417T		NM_181534	NP_853512	Q7Z3Z0	K1C25_HUMAN	keratin 25	417	Tail.					cytoplasm|intermediate filament	structural molecule activity			ovary(2)	2		Breast(137;0.00526)				ATGGCTTTGGCTGGGTCTGAG	0.348													4	120	---	---	---	---	capture	Missense_Mutation	SNP	38904633	38904633	KRT25	17	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	8382	173
RAD51C	5889	broad.mit.edu	37	17	56809897	56809897	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56809897C>G	uc002iwu.2	+	8	1060	c.1018C>G	c.(1018-1020)CAA>GAA	p.Q340E	RAD51C_uc010woa.1_Missense_Mutation_p.Q340E|RAD51C_uc010ddc.2_RNA|RAD51C_uc002iwv.2_RNA|RAD51C_uc002iww.2_RNA	NM_058216	NP_478123	O43502	RA51C_HUMAN	RAD51 homolog C isoform 1	340					blood coagulation|DNA repair	mitochondrion|nucleoplasm|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGTACTGTTTCAAATCAAAGT	0.338								Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2				6	74	---	---	---	---	capture	Missense_Mutation	SNP	56809897	56809897	RAD51C	17	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	12883	173
BAHCC1	57597	broad.mit.edu	37	17	79412126	79412126	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79412126C>T	uc002kaf.2	+	7	2757	c.2757C>T	c.(2755-2757)CTC>CTT	p.L919L	BAHCC1_uc002kae.2_Silent_p.L118L	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	919	Pro-rich.						DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			CGGGCCAGCTCCCTGTGTACT	0.697													3	14	---	---	---	---	capture	Silent	SNP	79412126	79412126	BAHCC1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	1285	173
LAMA1	284217	broad.mit.edu	37	18	7011448	7011448	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7011448G>A	uc002knm.2	-	25	3632	c.3538C>T	c.(3538-3540)CGT>TGT	p.R1180C	LAMA1_uc010wzj.1_Missense_Mutation_p.R656C	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1180	Laminin IV type A 2.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GAAACCACACGCAGAAGAGGC	0.552													5	23	---	---	---	---	capture	Missense_Mutation	SNP	7011448	7011448	LAMA1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8525	173
MIB1	57534	broad.mit.edu	37	18	19358097	19358097	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19358097G>A	uc002ktq.2	+	5	670	c.670G>A	c.(670-672)GGT>AGT	p.G224S	MIB1_uc002ktp.2_5'UTR	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1	224					Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			TGCCAAGGGAGGTTCTTTCTA	0.403													23	80	---	---	---	---	capture	Missense_Mutation	SNP	19358097	19358097	MIB1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9478	173
DSG3	1830	broad.mit.edu	37	18	29039054	29039054	+	Missense_Mutation	SNP	C	T	T	rs62095186		TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29039054C>T	uc002kws.2	+	5	540	c.431C>T	c.(430-432)ACG>ATG	p.T144M		NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	144	Extracellular (Potential).|Cadherin 1.				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTTATACTAACGGTTAAAATT	0.358													14	50	---	---	---	---	capture	Missense_Mutation	SNP	29039054	29039054	DSG3	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4733	173
ZNF845	91664	broad.mit.edu	37	19	53856702	53856702	+	Missense_Mutation	SNP	G	A	A	rs150688663	by1000genomes	TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53856702G>A	uc010ydv.1	+	4	2891	c.2774G>A	c.(2773-2775)CGT>CAT	p.R925H	ZNF845_uc010ydw.1_Missense_Mutation_p.R925H	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	925	C2H2-type 26.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAAACCTTCCGTCACAATTCA	0.363													4	54	---	---	---	---	capture	Missense_Mutation	SNP	53856702	53856702	ZNF845	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	18067	173
APOB	338	broad.mit.edu	37	2	21232448	21232448	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21232448T>C	uc002red.2	-	26	7420	c.7292A>G	c.(7291-7293)GAT>GGT	p.D2431G		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2431					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTGGTGGTAATCAAATGACTT	0.343													3	118	---	---	---	---	capture	Missense_Mutation	SNP	21232448	21232448	APOB	2	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	778	173
SLC9A4	389015	broad.mit.edu	37	2	103141556	103141556	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103141556G>A	uc002tbz.3	+	10	2349	c.1892G>A	c.(1891-1893)CGC>CAC	p.R631H		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	631	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						CTGATCCGCCGCCAGAACACC	0.507													57	132	---	---	---	---	capture	Missense_Mutation	SNP	103141556	103141556	SLC9A4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14608	173
COL6A1	1291	broad.mit.edu	37	21	47423347	47423347	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47423347G>A	uc002zhu.1	+	35	2609	c.2507G>A	c.(2506-2508)GGC>GAC	p.G836D	COL6A1_uc010gqd.1_Missense_Mutation_p.G167D|COL6A1_uc002zhv.1_Missense_Mutation_p.G167D|COL6A1_uc002zhw.1_5'UTR	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	836	C-terminal globular domain.|VWFA 3.			DGSAS -> EPPPD (in Ref. 1; CAA33889).	axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	CTGCTGGACGGCTCCGCCAGC	0.692													3	37	---	---	---	---	capture	Missense_Mutation	SNP	47423347	47423347	COL6A1	21	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3664	173
SLC5A4	6527	broad.mit.edu	37	22	32628993	32628993	+	Missense_Mutation	SNP	T	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32628993T>G	uc003ami.2	-	9	916	c.914A>C	c.(913-915)AAG>ACG	p.K305T		NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (low affinity glucose	305	Cytoplasmic (Potential).				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity				0						AGACATGTCCTTGCCACACAG	0.557													21	57	---	---	---	---	capture	Missense_Mutation	SNP	32628993	32628993	SLC5A4	22	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	14559	173
CYP2D6	1565	broad.mit.edu	37	22	42523567	42523567	+	Missense_Mutation	SNP	T	C	C	rs61736517		TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42523567T>C	uc003bce.2	-	7	1145	c.1055A>G	c.(1054-1056)CAC>CGC	p.H352R	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Missense_Mutation_p.H46R|CYP2D6_uc003bcf.2_Missense_Mutation_p.H301R	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	352							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						GTAGGGCATGTGAGCCTGGTC	0.592													4	34	---	---	---	---	capture	Missense_Mutation	SNP	42523567	42523567	CYP2D6	22	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	4129	173
EEFSEC	60678	broad.mit.edu	37	3	127981028	127981028	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:127981028C>T	uc003eki.2	+	3	620	c.582C>T	c.(580-582)CCC>CCT	p.P194P	EEFSEC_uc003ekj.2_Silent_p.P194P	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,	194						cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						CAGAGGCCCCCGAAACTGAAG	0.562													40	101	---	---	---	---	capture	Silent	SNP	127981028	127981028	EEFSEC	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4886	173
INTU	27152	broad.mit.edu	37	4	128564761	128564761	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:128564761C>G	uc003ifk.1	+	2	302	c.232C>G	c.(232-234)CTC>GTC	p.L78V	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	78										ovary(1)	1						AGAAGAAAGCCTCCTTCCTGA	0.393													66	205	---	---	---	---	capture	Missense_Mutation	SNP	128564761	128564761	INTU	4	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	7709	173
ELOVL7	79993	broad.mit.edu	37	5	60060144	60060144	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:60060144G>A	uc003jsi.3	-	7	609	c.409C>T	c.(409-411)CGC>TGC	p.R137C	ELOVL7_uc011cqo.1_Missense_Mutation_p.R50C|ELOVL7_uc010iwk.2_Missense_Mutation_p.R137C|ELOVL7_uc003jsj.3_Missense_Mutation_p.R124C	NM_024930	NP_079206	A1L3X0	ELOV7_HUMAN	elongation of very long chain fatty acids-like	137					fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				TTTTTCTTGCGCAGAACAAAA	0.348													9	31	---	---	---	---	capture	Missense_Mutation	SNP	60060144	60060144	ELOVL7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5034	173
PCDHGA3	56112	broad.mit.edu	37	5	140725076	140725076	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140725076C>T	uc003ljm.1	+	1	1476	c.1476C>T	c.(1474-1476)ACC>ACT	p.T492T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Silent_p.T252T|PCDHGA3_uc011dap.1_Silent_p.T492T	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	492	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGCATTGACCGAGGACACTC	0.542													25	159	---	---	---	---	capture	Silent	SNP	140725076	140725076	PCDHGA3	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11458	173
PCDHGA6	56109	broad.mit.edu	37	5	140755737	140755737	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140755737C>T	uc003ljy.1	+	1	2087	c.2087C>T	c.(2086-2088)GCG>GTG	p.A696V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.A696V	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	696	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTGGTGGCGGTGGCCGCG	0.672													26	108	---	---	---	---	capture	Missense_Mutation	SNP	140755737	140755737	PCDHGA6	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11461	173
FAT2	2196	broad.mit.edu	37	5	150942915	150942915	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150942915A>G	uc003lue.3	-	2	3558	c.3545T>C	c.(3544-3546)ATG>ACG	p.M1182T	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Missense_Mutation_p.M1182T	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1182	Extracellular (Potential).|Cadherin 10.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAAGAATCCCATGTAGTTCCC	0.438													21	80	---	---	---	---	capture	Missense_Mutation	SNP	150942915	150942915	FAT2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	5636	173
LARP1	23367	broad.mit.edu	37	5	154135677	154135677	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154135677C>T	uc003lvp.2	+	1	789	c.360C>T	c.(358-360)CCC>CCT	p.P120P	LARP1_uc003lvo.2_Intron|LARP1_uc010jie.1_5'Flank	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	120							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGGAAGCCCCCCCGCCCAAGG	0.627													5	10	---	---	---	---	capture	Silent	SNP	154135677	154135677	LARP1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	274	22	2	2	8548	173
GPR116	221395	broad.mit.edu	37	6	46826522	46826522	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46826522A>T	uc003oyo.3	-	17	3407	c.3118T>A	c.(3118-3120)TCG>ACG	p.S1040T	GPR116_uc011dwj.1_Missense_Mutation_p.S595T|GPR116_uc011dwk.1_Missense_Mutation_p.S469T|GPR116_uc003oyp.3_Missense_Mutation_p.S898T|GPR116_uc003oyq.3_Missense_Mutation_p.S1040T|GPR116_uc010jzi.1_Missense_Mutation_p.S712T	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	1040	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			TTGGTCACCGATTTCCACACC	0.507													20	36	---	---	---	---	capture	Missense_Mutation	SNP	46826522	46826522	GPR116	6	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	6567	173
MANEA	79694	broad.mit.edu	37	6	96054014	96054014	+	Silent	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:96054014G>A	uc003poo.1	+	5	1262	c.1122G>A	c.(1120-1122)CGG>CGA	p.R374R		NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	374	Catalytic (Probable).|Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		AAAACACTCGGAACCGAATCA	0.408													28	75	---	---	---	---	capture	Silent	SNP	96054014	96054014	MANEA	6	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	9135	173
OLIG3	167826	broad.mit.edu	37	6	137815222	137815222	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:137815222T>C	uc003qhp.1	-	1	310	c.86A>G	c.(85-87)CAC>CGC	p.H29R		NM_175747	NP_786923	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	29	Poly-His.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		gtggtggtggtggcggtggtg	0.483													3	92	---	---	---	---	capture	Missense_Mutation	SNP	137815222	137815222	OLIG3	6	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	10766	173
REPS1	85021	broad.mit.edu	37	6	139266737	139266737	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:139266737C>T	uc003qii.2	-	3	954	c.375G>A	c.(373-375)TCG>TCA	p.S125S	REPS1_uc003qig.3_Silent_p.S125S|REPS1_uc011edr.1_Silent_p.S125S|REPS1_uc003qij.2_Silent_p.S125S|REPS1_uc003qik.2_5'UTR	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	125						coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		CACCAGAATACGACCCTTGAT	0.483													4	128	---	---	---	---	capture	Silent	SNP	139266737	139266737	REPS1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	13123	173
PCLO	27445	broad.mit.edu	37	7	82580167	82580167	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82580167C>T	uc003uhx.2	-	6	10026	c.9737G>A	c.(9736-9738)CGA>CAA	p.R3246Q	PCLO_uc003uhv.2_Missense_Mutation_p.R3246Q|PCLO_uc010lec.2_Missense_Mutation_p.R211Q	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3177	Gln-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTCTTGTTCTCGGAACCTTTG	0.473													19	131	---	---	---	---	capture	Missense_Mutation	SNP	82580167	82580167	PCLO	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11486	173
ABCB1	5243	broad.mit.edu	37	7	87174224	87174224	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87174224G>C	uc003uiz.1	-	17	2397	c.1979C>G	c.(1978-1980)TCC>TGC	p.S660C	ABCB1_uc011khc.1_Missense_Mutation_p.S596C	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	660	Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TATTAGACTGGATCTTGAATC	0.388													4	115	---	---	---	---	capture	Missense_Mutation	SNP	87174224	87174224	ABCB1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	40	173
COL1A2	1278	broad.mit.edu	37	7	94039107	94039107	+	Missense_Mutation	SNP	G	A	A	rs67865220		TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94039107G>A	uc003ung.1	+	19	1480	c.1009G>A	c.(1009-1011)GGT>AGT	p.G337S	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	337			G -> S (in OI3).|G -> C (in OI3).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGTGCTGCCGGTGCTACTGG	0.557										HNSCC(75;0.22)			17	71	---	---	---	---	capture	Missense_Mutation	SNP	94039107	94039107	COL1A2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3643	173
C7orf43	55262	broad.mit.edu	37	7	99753440	99753440	+	Silent	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99753440G>A	uc003utr.2	-	9	1429	c.1249C>T	c.(1249-1251)CTG>TTG	p.L417L	C7orf43_uc010lgo.2_Silent_p.L43L|C7orf43_uc010lgp.2_Silent_p.L39L|C7orf43_uc011kjj.1_Silent_p.L185L|C7orf43_uc003uts.2_Silent_p.L148L	NM_018275	NP_060745	Q8WVR3	CG043_HUMAN	hypothetical protein LOC55262	417											0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCCTCACACAGCTGCTTTCCT	0.612													16	55	---	---	---	---	capture	Silent	SNP	99753440	99753440	C7orf43	7	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	2370	173
ZCWPW1	55063	broad.mit.edu	37	7	99998739	99998739	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99998739C>T	uc003uut.2	-	18	2093	c.1845G>A	c.(1843-1845)GAG>GAA	p.E615E	ZCWPW1_uc011kjq.1_Silent_p.E495E|ZCWPW1_uc003uur.2_3'UTR|ZCWPW1_uc003uus.2_Silent_p.E444E|ZCWPW1_uc011kjr.1_3'UTR|ZCWPW1_uc011kjp.1_RNA	NM_017984	NP_060454	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	615							zinc ion binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCATGAGTTGCTCCAGGTCCA	0.612													16	40	---	---	---	---	capture	Silent	SNP	99998739	99998739	ZCWPW1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	17477	173
MUC17	140453	broad.mit.edu	37	7	100677675	100677675	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100677675C>T	uc003uxp.1	+	3	3031	c.2978C>T	c.(2977-2979)ACG>ATG	p.T993M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	993	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|14.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCAGCCACACGCTGGTGGCC	0.512													129	529	---	---	---	---	capture	Missense_Mutation	SNP	100677675	100677675	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9884	173
OR2A25	392138	broad.mit.edu	37	7	143772171	143772171	+	Silent	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143772171C>T	uc011ktx.1	+	1	859	c.859C>T	c.(859-861)CTA>TTA	p.L287L		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	287	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					GCTTAATCCCCTAATTTATAG	0.413													82	388	---	---	---	---	capture	Silent	SNP	143772171	143772171	OR2A25	7	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	10882	173
DEPDC6	64798	broad.mit.edu	37	8	121021282	121021282	+	Silent	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121021282G>A	uc003yow.3	+	8	1198	c.1011G>A	c.(1009-1011)GCG>GCA	p.A337A	DEPDC6_uc011lid.1_Silent_p.A236A	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6	337	PDZ.				intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTGGTGACGCGGTTGGCTGGG	0.542													6	55	---	---	---	---	capture	Silent	SNP	121021282	121021282	DEPDC6	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4401	173
FAM83H	286077	broad.mit.edu	37	8	144808270	144808270	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144808270G>A	uc003yzk.2	-	5	3430	c.3361C>T	c.(3361-3363)CGC>TGC	p.R1121C	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	1121					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCCATGCGGCGCAGCAGCCGA	0.677													7	21	---	---	---	---	capture	Missense_Mutation	SNP	144808270	144808270	FAM83H	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5586	173
TAF1L	138474	broad.mit.edu	37	9	32633525	32633525	+	Missense_Mutation	SNP	G	A	A	rs147409173		TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32633525G>A	uc003zrg.1	-	1	2143	c.2053C>T	c.(2053-2055)CGC>TGC	p.R685C	uc003zrh.1_RNA	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	685					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGAGGTGTGCGCATAAAAAAC	0.448													5	144	---	---	---	---	capture	Missense_Mutation	SNP	32633525	32633525	TAF1L	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15411	173
STRBP	55342	broad.mit.edu	37	9	125909182	125909182	+	Silent	SNP	T	C	C			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125909182T>C	uc004bns.2	-	13	1720	c.1290A>G	c.(1288-1290)GAA>GAG	p.E430E	STRBP_uc004bnt.2_Silent_p.E248E|STRBP_uc004bnu.2_Silent_p.E416E|STRBP_uc004bnv.2_Silent_p.E430E|STRBP_uc004bnr.2_Silent_p.E42E	NM_018387	NP_060857	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	430	DRBM 1.				multicellular organismal development	cytoplasm|nucleus	DNA binding			breast(1)|skin(1)	2						GTCCTGAGGCTTCATATGTTG	0.433													3	134	---	---	---	---	capture	Silent	SNP	125909182	125909182	STRBP	9	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	15217	173
FAM47A	158724	broad.mit.edu	37	X	34150044	34150044	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:34150044C>T	uc004ddg.2	-	1	385	c.352G>A	c.(352-354)GTA>ATA	p.V118I		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	118										ovary(4)|central_nervous_system(1)	5						ACTTGCTCTACGAACGCCTTC	0.547													37	32	---	---	---	---	capture	Missense_Mutation	SNP	34150044	34150044	FAM47A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5517	173
ZNF711	7552	broad.mit.edu	37	X	84526085	84526085	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:84526085G>A	uc004eeo.2	+	9	1884	c.1537G>A	c.(1537-1539)GGT>AGT	p.G513S	ZNF711_uc004eep.2_Missense_Mutation_p.G513S|ZNF711_uc004eeq.2_Missense_Mutation_p.G559S|ZNF711_uc011mqy.1_Missense_Mutation_p.G112S	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN	zinc finger protein 711	513	C2H2-type 4.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			ovary(3)|skin(1)	4						GTGTGGGAAGGGTTTTCGACA	0.413													12	14	---	---	---	---	capture	Missense_Mutation	SNP	84526085	84526085	ZNF711	23	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	17992	173
KRTAP5-10	387273	broad.mit.edu	37	11	71276821	71276910	+	In_Frame_Del	DEL	GCTGTGGCTCCTGTGGGGGCTCCAAGGGGGACTGTGGCTCTTGTGGGGGCTCCAAAGGGGGCTGTGGTTCCTGTGGGGGCTCCAAGGGGG	-	-	rs146095815;rs71473841;rs36179995;rs12787188;rs12792973;rs113426209;rs12788123;rs111331435;rs12793134;rs145089413;rs111692708;rs34154361;rs12289712	by1000genomes	TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71276821_71276910delGCTGTGGCTCCTGTGGGGGCTCCAAGGGGGACTGTGGCTCTTGTGGGGGCTCCAAAGGGGGCTGTGGTTCCTGTGGGGGCTCCAAGGGGG	uc001oqt.1	+	1	213_302	c.188_277delGCTGTGGCTCCTGTGGGGGCTCCAAGGGGGACTGTGGCTCTTGTGGGGGCTCCAAAGGGGGCTGTGGTTCCTGTGGGGGCTCCAAGGGGG	c.(187-279)AGCTGTGGCTCCTGTGGGGGCTCCAAGGGGGACTGTGGCTCTTGTGGGGGCTCCAAAGGGGGCTGTGGTTCCTGTGGGGGCTCCAAGGGGGGC>AGC	p.CGSCGGSKGDCGSCGGSKGGCGSCGGSKGG64del		NM_001012710	NP_001012728	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	64_93	7 X 4 AA repeats of C-C-X-P.					keratin filament		p.G65S(1)		skin(1)	1						TCCTGCTCCAGCTGTGGCTCCTGTGGGGGCTCCAAGGGGGACTGTGGCTCTTGTGGGGGCTCCAAAGGGGGCTGTGGTTCCTGTGGGGGCTCCAAGGGGGGCTGTGGCTC	0.676													10	236	---	---	---	---	capture_indel	In_Frame_Del	DEL	71276821	71276910	KRTAP5-10	11	GCTGTGGCTCCTGTGGGGGCTCCAAGGGGGACTGTGGCTCTTGTGGGGGCTCCAAAGGGGGCTGTGGTTCCTGTGGGGGCTCCAAGGGGG	-	-	-	1	0	1	0	1	0	0	0	0	442	34	5	5	8479	173
GCC2	9648	broad.mit.edu	37	2	109087914	109087914	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109087914delT	uc002tec.2	+	6	2283	c.2129delT	c.(2128-2130)GTTfs	p.V710fs	GCC2_uc002ted.2_Frame_Shift_Del_p.V609fs	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	710	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						GATTTGGAGGTTTTTTTGTCT	0.299													7	429	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	109087914	109087914	GCC2	2	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	6226	173
MAPK8IP2	23542	broad.mit.edu	37	22	51041769	51041771	+	In_Frame_Del	DEL	GAG	-	-			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:51041769_51041771delGAG	uc003bmx.2	+	3	406_408	c.289_291delGAG	c.(289-291)GAGdel	p.E103del	MAPK8IP2_uc003bmy.2_In_Frame_Del_p.E76del|MAPK8IP2_uc011asc.1_5'Flank	NM_012324	NP_036456	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting	103	Asp/Glu-rich (acidic).				behavioral fear response|dendrite morphogenesis|MAPKKK cascade|nonassociative learning|positive regulation of anti-apoptosis|regulation of excitatory postsynaptic membrane potential|regulation of JNK cascade|regulation of receptor activity|regulation of synaptic transmission, glutamatergic|signal complex assembly|social behavior	cytoplasm|postsynaptic density	beta-amyloid binding|kinesin binding|MAP-kinase scaffold activity|protein kinase activator activity|protein kinase binding			large_intestine(2)|central_nervous_system(1)	3		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ggacgaggaagaggaggaggagg	0.483													2	4	---	---	---	---	capture_indel	In_Frame_Del	DEL	51041769	51041771	MAPK8IP2	22	GAG	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	9198	173
SLC22A16	85413	broad.mit.edu	37	6	110768146	110768146	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-5953-01	TCGA-19-5953-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:110768146delA	uc003puf.2	-	3	648	c.581delT	c.(580-582)TTGfs	p.L194fs	SLC22A16_uc003pue.2_Frame_Shift_Del_p.L175fs	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN	solute carrier family 22, member 16	194	Helical; (Potential).				acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity			ovary(1)	1		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)		TATTCCAAACAAAAACATGCT	0.433													25	61	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	110768146	110768146	SLC22A16	6	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	14340	173
