Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GABRD	2563	broad.mit.edu	37	1	1961508	1961508	+	Silent	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1961508C>T	uc001aip.2	+	9	1241	c.1146C>T	c.(1144-1146)CGC>CGT	p.R382R		NM_000815	NP_000806	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	382	Cytoplasmic (Probable).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		GGCAGCGCCGCGTCCCGGGGA	0.692													19	31	---	---	---	---	capture	Silent	SNP	1961508	1961508	GABRD	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6111	174
DNAJC11	55735	broad.mit.edu	37	1	6704720	6704720	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6704720C>T	uc001aof.2	-	10	1101	c.995G>A	c.(994-996)GGG>GAG	p.G332E	DNAJC11_uc010nzt.1_Intron|DNAJC11_uc001aog.2_Missense_Mutation_p.G332E|DNAJC11_uc010nzu.1_Missense_Mutation_p.G242E	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	332					protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CACCACCGTCCCAAAGAAGCC	0.562													11	31	---	---	---	---	capture	Missense_Mutation	SNP	6704720	6704720	DNAJC11	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	4586	174
TNFRSF9	3604	broad.mit.edu	37	1	7998781	7998781	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7998781C>A	uc001aot.2	-	3	336	c.208G>T	c.(208-210)GGT>TGT	p.G70C		NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,	70	TNFR-Cys 2.|Extracellular (Potential).				induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		GAACTCATACCTTTACACTGC	0.398													58	127	---	---	---	---	capture	Missense_Mutation	SNP	7998781	7998781	TNFRSF9	1	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	16183	174
FBLIM1	54751	broad.mit.edu	37	1	16095074	16095074	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16095074G>A	uc001axd.1	+	6	933	c.490G>A	c.(490-492)GAA>AAA	p.E164K	FBLIM1_uc001axe.1_Missense_Mutation_p.E164K|FBLIM1_uc001axf.2_RNA|FBLIM1_uc001axg.1_Missense_Mutation_p.E164K|FBLIM1_uc001axh.1_Intron|FBLIM1_uc001axi.1_Intron	NM_017556	NP_060026	Q8WUP2	FBLI1_HUMAN	filamin-binding LIM protein-1 isoform a	164	Pro-rich.				cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		GCCCATGGAGGAAGAGCTGCC	0.652													27	54	---	---	---	---	capture	Missense_Mutation	SNP	16095074	16095074	FBLIM1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5643	174
C1orf38	9473	broad.mit.edu	37	1	28208484	28208484	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:28208484C>T	uc001bpc.3	+	4	677	c.649C>T	c.(649-651)CGC>TGC	p.R217C	C1orf38_uc001boz.2_Intron|C1orf38_uc001bpa.2_Intron|C1orf38_uc010ofn.1_Intron|C1orf38_uc010ofo.1_Missense_Mutation_p.R217C	NM_001105556	NP_001099026	Q5TEJ8	THMS2_HUMAN	basement membrane-induced gene isoform 3	217	CABIT 1.				cell adhesion|inflammatory response					ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;2.52e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		CTCCACAGTGCGCAGGACCAT	0.652													14	35	---	---	---	---	capture	Missense_Mutation	SNP	28208484	28208484	C1orf38	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2021	174
FLG	2312	broad.mit.edu	37	1	152276552	152276552	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152276552C>T	uc001ezu.1	-	3	10846	c.10810G>A	c.(10810-10812)GAG>AAG	p.E3604K		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3604	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGGAATTCTCTGCATGATGA	0.562									Ichthyosis				45	303	---	---	---	---	capture	Missense_Mutation	SNP	152276552	152276552	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	5867	174
FLG	2312	broad.mit.edu	37	1	152280440	152280440	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152280440C>T	uc001ezu.1	-	3	6958	c.6922G>A	c.(6922-6924)GAG>AAG	p.E2308K		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2308	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGGAATTCTCTGCATGATGA	0.562									Ichthyosis				94	308	---	---	---	---	capture	Missense_Mutation	SNP	152280440	152280440	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	5867	174
SEC16B	89866	broad.mit.edu	37	1	177936906	177936906	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:177936906G>T	uc001gli.1	-	2	301	c.211C>A	c.(211-213)CAT>AAT	p.H71N	SEC16B_uc001glk.1_5'UTR|SEC16B_uc009wwz.1_5'UTR|SEC16B_uc001glj.1_Missense_Mutation_p.H71N|SEC16B_uc001gll.3_Missense_Mutation_p.H71N	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN	leucine zipper transcription regulator 2	71	Required for endoplasmic reticulum localization.				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4						GATGCATAATGGGGCTGCTGC	0.542													33	59	---	---	---	---	capture	Missense_Mutation	SNP	177936906	177936906	SEC16B	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	13880	174
LAMB3	3914	broad.mit.edu	37	1	209791966	209791966	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209791966C>T	uc001hhg.2	-	18	3130	c.2740G>A	c.(2740-2742)GAG>AAG	p.E914K	LAMB3_uc009xco.2_Missense_Mutation_p.E914K|LAMB3_uc001hhh.2_Missense_Mutation_p.E914K	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	914	Domain I.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		AGCACGGCCTCGCTGACCTCC	0.582													12	42	---	---	---	---	capture	Missense_Mutation	SNP	209791966	209791966	LAMB3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8532	174
CENPF	1063	broad.mit.edu	37	1	214819178	214819178	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214819178G>A	uc001hkm.2	+	13	6439	c.6265G>A	c.(6265-6267)GTC>ATC	p.V2089I		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	2185	Potential.|Interaction with NDE1 and NDEL1.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AAAGCTGAATGTCTCCAAGGC	0.473													39	48	---	---	---	---	capture	Missense_Mutation	SNP	214819178	214819178	CENPF	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	3199	174
AGAP6	414189	broad.mit.edu	37	10	51748622	51748622	+	Silent	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:51748622A>G	uc001jix.3	+	1	545	c.147A>G	c.(145-147)GTA>GTG	p.V49V		NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	49					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						CTGCTGCTGTACAGCCTGCTG	0.582													3	29	---	---	---	---	capture	Silent	SNP	51748622	51748622	AGAP6	10	A	G	G	G	1	0	0	0	0	0	0	0	1	171	14	3	3	372	174
MYOF	26509	broad.mit.edu	37	10	95148849	95148849	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:95148849A>G	uc001kin.2	-	18	1642	c.1519T>C	c.(1519-1521)TAT>CAT	p.Y507H	MYOF_uc001kio.2_Missense_Mutation_p.Y494H	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	507	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						GGGCTTCCATAAAGATTCAGG	0.428													46	27	---	---	---	---	capture	Missense_Mutation	SNP	95148849	95148849	MYOF	10	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	9999	174
MKI67	4288	broad.mit.edu	37	10	129906302	129906302	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129906302G>A	uc001lke.2	-	13	3997	c.3802C>T	c.(3802-3804)CGA>TGA	p.R1268*	MKI67_uc001lkf.2_Nonsense_Mutation_p.R908*|MKI67_uc009yav.1_Nonsense_Mutation_p.R843*|MKI67_uc009yaw.1_Nonsense_Mutation_p.R418*	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	1268	16 X 122 AA approximate repeats.|3.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTCTTGGGTCGTTGCTTTGTG	0.507													68	51	---	---	---	---	capture	Nonsense_Mutation	SNP	129906302	129906302	MKI67	10	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	9510	174
F2	2147	broad.mit.edu	37	11	46750326	46750326	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46750326C>G	uc001ndf.3	+	11	1454	c.1411C>G	c.(1411-1413)CCT>GCT	p.P471A	F2_uc001ndg.3_RNA	NM_000506	NP_000497	P00734	THRB_HUMAN	coagulation factor II preproprotein	471	Peptidase S1.				activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity	p.P471S(1)		ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)	GCTGAAGAAGCCTGTTGCCTT	0.493													46	70	---	---	---	---	capture	Missense_Mutation	SNP	46750326	46750326	F2	11	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	5296	174
FAM111A	63901	broad.mit.edu	37	11	58919918	58919918	+	Silent	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58919918A>G	uc010rkp.1	+	5	1004	c.777A>G	c.(775-777)TTA>TTG	p.L259L	FAM111A_uc010rkq.1_Silent_p.L259L|FAM111A_uc010rkr.1_Silent_p.L259L|FAM111A_uc001nno.2_Silent_p.L259L|FAM111A_uc001nnp.2_Silent_p.L259L|FAM111A_uc001nnq.2_Silent_p.L259L	NM_001142521	NP_001135993	Q96PZ2	F111A_HUMAN	hypothetical protein LOC63901	259					proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_epithelial(135;0.139)				TTGATGAATTAGAAGGCAGAT	0.423													47	62	---	---	---	---	capture	Silent	SNP	58919918	58919918	FAM111A	11	A	G	G	G	1	0	0	0	0	0	0	0	1	193	15	3	3	5353	174
NRXN2	9379	broad.mit.edu	37	11	64375399	64375399	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64375399G>A	uc001oap.2	-	8	1781	c.1270C>T	c.(1270-1272)CGC>TGC	p.R424C	NRXN2_uc001oar.2_Missense_Mutation_p.R1470C|NRXN2_uc001oas.2_Missense_Mutation_p.R1400C|NRXN2_uc001oao.2_Missense_Mutation_p.R110C|NRXN2_uc001oaq.2_Missense_Mutation_p.R1137C	NM_138734	NP_620063	P58401	NRX2B_HUMAN	neurexin 2 isoform beta precursor	424	Extracellular (Potential).				cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						GAgggcgggcggcgcgcggcg	0.612													2	2	---	---	---	---	capture	Missense_Mutation	SNP	64375399	64375399	NRXN2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10573	174
IL10RA	3587	broad.mit.edu	37	11	117860220	117860220	+	Silent	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117860220C>T	uc001prv.2	+	3	329	c.252C>T	c.(250-252)ACC>ACT	p.T84T	IL10RA_uc010rxl.1_Silent_p.T64T|IL10RA_uc010rxm.1_Silent_p.T64T|IL10RA_uc010rxn.1_Intron|IL10RA_uc001prw.2_5'UTR	NM_001558	NP_001549	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha precursor	84	Extracellular (Potential).		T -> I (in IBD28).			integral to membrane|plasma membrane	interleukin-10 receptor activity			ovary(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		ATGACCTTACCGCAGTGACCT	0.577													33	55	---	---	---	---	capture	Silent	SNP	117860220	117860220	IL10RA	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7543	174
APLP2	334	broad.mit.edu	37	11	129999030	129999030	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:129999030G>A	uc010sby.1	+	10	1541	c.1384G>A	c.(1384-1386)GCT>ACT	p.A462T	APLP2_uc001qfp.2_Missense_Mutation_p.A462T|APLP2_uc001qfq.2_Missense_Mutation_p.A406T|APLP2_uc010sbz.1_Missense_Mutation_p.A250T|APLP2_uc001qfr.2_Missense_Mutation_p.A228T|APLP2_uc001qfs.2_Missense_Mutation_p.A233T|APLP2_uc001qfv.2_Missense_Mutation_p.A353T	NM_001642	NP_001633	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	462	Extracellular (Potential).				G-protein coupled receptor protein signaling pathway	integral to membrane|nucleus|plasma membrane	DNA binding|identical protein binding|serine-type endopeptidase inhibitor activity			ovary(3)	3	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		CCGAGTGGAAGCTATGCTGAA	0.582													33	59	---	---	---	---	capture	Missense_Mutation	SNP	129999030	129999030	APLP2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	772	174
TAS2R30	259293	broad.mit.edu	37	12	11286246	11286246	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11286246A>G	uc009zhs.1	-	1	598	c.598T>C	c.(598-600)TGT>CGT	p.C200R	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_001097643	NP_001091112			type 2 taste receptor member 30												0						CACAGAGAACAGATTAACAGC	0.428													10	262	---	---	---	---	capture	Missense_Mutation	SNP	11286246	11286246	TAS2R30	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	15461	174
SOAT2	8435	broad.mit.edu	37	12	53516999	53516999	+	Silent	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53516999A>G	uc001sbv.2	+	13	1459	c.1371A>G	c.(1369-1371)GGA>GGG	p.G457G	SOAT2_uc009zms.2_RNA	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2	457	Helical; (Potential).				cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						TTGTCATTGGAGGTGAGCTGG	0.582													3	73	---	---	---	---	capture	Silent	SNP	53516999	53516999	SOAT2	12	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	14803	174
CLYBL	171425	broad.mit.edu	37	13	100425088	100425088	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:100425088C>G	uc001vok.2	+	2	87	c.73C>G	c.(73-75)CTA>GTA	p.L25V	CLYBL_uc010tix.1_Missense_Mutation_p.L25V|CLYBL_uc010tiy.1_Missense_Mutation_p.L25V	NM_206808	NP_996531	Q8N0X4	CLYBL_HUMAN	citrate lyase beta like precursor	25					cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GAAAGCGTCTCTAGCAGCTGA	0.388													40	74	---	---	---	---	capture	Missense_Mutation	SNP	100425088	100425088	CLYBL	13	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	3538	174
ALDH6A1	4329	broad.mit.edu	37	14	74534253	74534253	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74534253A>G	uc001xpo.2	-	8	971	c.872T>C	c.(871-873)GTA>GCA	p.V291A	C14orf45_uc001xpm.1_Intron|ALDH6A1_uc010asa.2_Missense_Mutation_p.V136A|ALDH6A1_uc010tuq.1_Missense_Mutation_p.V278A	NM_005589	NP_005580	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6A1 precursor	291						mitochondrial matrix|nucleus	fatty-acyl-CoA binding|malonate-semialdehyde dehydrogenase (acetylating) activity|methylmalonate-semialdehyde dehydrogenase (acylating) activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00354)	NADH(DB00157)	TGGCATGACTACCCCATGGTT	0.448													24	37	---	---	---	---	capture	Missense_Mutation	SNP	74534253	74534253	ALDH6A1	14	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	503	174
LTBP2	4053	broad.mit.edu	37	14	75078642	75078642	+	Silent	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75078642C>T	uc001xqa.2	-	1	393	c.6G>A	c.(4-6)AGG>AGA	p.R2R		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	2					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGGTCCGCGGCCTCATGGCGC	0.756													6	10	---	---	---	---	capture	Silent	SNP	75078642	75078642	LTBP2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	8989	174
GABRB3	2562	broad.mit.edu	37	15	26812728	26812728	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26812728C>T	uc001zaz.2	-	7	977	c.835G>A	c.(835-837)GGG>AGG	p.G279R	GABRB3_uc010uae.1_Missense_Mutation_p.G194R|GABRB3_uc001zba.2_Missense_Mutation_p.G279R|GABRB3_uc001zbb.2_Missense_Mutation_p.G335R	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	279	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TAGCACATACCGAGGGCAACT	0.373													25	32	---	---	---	---	capture	Missense_Mutation	SNP	26812728	26812728	GABRB3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6110	174
ALDH1A2	8854	broad.mit.edu	37	15	58306465	58306465	+	Silent	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:58306465G>A	uc002aex.2	-	2	190	c.132C>T	c.(130-132)AAC>AAT	p.N44N	ALDH1A2_uc002aey.2_Silent_p.N44N|ALDH1A2_uc010ugv.1_Silent_p.N23N|ALDH1A2_uc010ugw.1_Silent_p.N15N|ALDH1A2_uc002aew.2_5'Flank	NM_003888	NP_003879	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 1	44					negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TCTGCCACTCGTTGTTTATAA	0.453													29	53	---	---	---	---	capture	Silent	SNP	58306465	58306465	ALDH1A2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	491	174
CIB1	10519	broad.mit.edu	37	15	90775506	90775506	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90775506G>A	uc002bpb.3	-	3	302	c.140C>T	c.(139-141)TCG>TTG	p.S47L	C15orf58_uc002bpc.2_5'Flank	NM_006384	NP_006375	Q99828	CIB1_HUMAN	calcium and integrin binding 1	47					apoptosis|cell adhesion|double-strand break repair	apical plasma membrane|endoplasmic reticulum|filopodium|nucleoplasm	calcium ion binding|protein binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0141)|all_lung(78;0.0303)		BRCA - Breast invasive adenocarcinoma(143;0.00269)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			CCGAAGTGACGACTCCACGCT	0.612													38	59	---	---	---	---	capture	Missense_Mutation	SNP	90775506	90775506	CIB1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3385	174
HS3ST6	64711	broad.mit.edu	37	16	1962053	1962053	+	Silent	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1962053G>A	uc002cnf.2	-	2	474	c.474C>T	c.(472-474)TCC>TCT	p.S158S		NM_001009606	NP_001009606	C9JH64	C9JH64_HUMAN	heparan sulfate (glucosamine)	158											0						GGGCGTAGTCGGAGATGGCCC	0.721													7	15	---	---	---	---	capture	Silent	SNP	1962053	1962053	HS3ST6	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7294	174
CHD9	80205	broad.mit.edu	37	16	53308187	53308187	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53308187A>T	uc002ehb.2	+	23	5104	c.4940A>T	c.(4939-4941)CAG>CTG	p.Q1647L	CHD9_uc002egy.2_Missense_Mutation_p.Q1647L|CHD9_uc002ehc.2_Missense_Mutation_p.Q1647L|CHD9_uc002ehf.2_Missense_Mutation_p.Q761L|CHD9_uc010cbw.2_Missense_Mutation_p.Q15L	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1647					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				AATGAGTGTCAGAAAGTATTT	0.244													4	14	---	---	---	---	capture	Missense_Mutation	SNP	53308187	53308187	CHD9	16	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	3298	174
MFSD6L	162387	broad.mit.edu	37	17	8702398	8702398	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8702398C>A	uc002glp.1	-	1	189	c.41G>T	c.(40-42)GGG>GTG	p.G14V		NM_152599	NP_689812	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing	14						integral to membrane				central_nervous_system(1)	1						CTTGGCCACCCCCAGCGCCCT	0.726													15	38	---	---	---	---	capture	Missense_Mutation	SNP	8702398	8702398	MFSD6L	17	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	9448	174
SREBF1	6720	broad.mit.edu	37	17	17721038	17721038	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:17721038G>T	uc002gru.1	-	7	1570	c.1376C>A	c.(1375-1377)CCT>CAT	p.P459H	SREBF1_uc002grp.1_Missense_Mutation_p.L29M|SREBF1_uc002grq.1_Translation_Start_Site|SREBF1_uc002grr.1_Missense_Mutation_p.P205H|SREBF1_uc002grs.1_Missense_Mutation_p.P435H|SREBF1_uc002grt.1_Missense_Mutation_p.P489H|SREBF1_uc010cpp.1_Missense_Mutation_p.P435H|SREBF1_uc010cpq.1_Missense_Mutation_p.P459H	NM_004176	NP_004167	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription	459	Gly/Pro/Ser-rich.|Cytoplasmic (Potential).|Interaction with LMNA (By similarity).				cellular response to starvation|cholesterol metabolic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleus	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|sterol response element binding			skin(1)	1						TGGGCTGTCAGGCTCCGAGTC	0.607													25	31	---	---	---	---	capture	Missense_Mutation	SNP	17721038	17721038	SREBF1	17	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	15033	174
RGS9	8787	broad.mit.edu	37	17	63221294	63221294	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:63221294G>A	uc002jfe.2	+	18	1692	c.1582G>A	c.(1582-1584)GTG>ATG	p.V528M	RGS9_uc010dem.2_Missense_Mutation_p.V525M|RGS9_uc002jfd.2_Missense_Mutation_p.V525M|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_Missense_Mutation_p.V299M	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	528				RVALE -> LVVLD (in Ref. 7; AAC25430).	intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						ACCCATCAGAGTGGCCTTGGA	0.677													64	104	---	---	---	---	capture	Missense_Mutation	SNP	63221294	63221294	RGS9	17	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	13205	174
SERPINB2	5055	broad.mit.edu	37	18	61570323	61570323	+	Silent	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61570323G>A	uc010xeu.1	+	9	1365	c.1032G>A	c.(1030-1032)TCG>TCA	p.S344S	SERPINB2_uc002ljo.2_Silent_p.S344S|SERPINB2_uc010dqh.2_Silent_p.S274S|SERPINB2_uc002ljp.1_Intron|SERPINB2_uc002ljq.1_Intron	NM_001143818	NP_001137290	P05120	PAI2_HUMAN	serine (or cysteine) proteinase inhibitor, clade	344					anti-apoptosis|blood coagulation|fibrinolysis|regulation of proteolysis	extracellular space|Golgi apparatus|plasma membrane	serine-type endopeptidase inhibitor activity			lung(1)|skin(1)	2		Esophageal squamous(42;0.131)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	CAGGGATGTCGGAGAGGAATG	0.498													40	49	---	---	---	---	capture	Silent	SNP	61570323	61570323	SERPINB2	18	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13994	174
ADNP2	22850	broad.mit.edu	37	18	77895050	77895050	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77895050G>A	uc002lnw.2	+	4	2209	c.1754G>A	c.(1753-1755)GGT>GAT	p.G585D		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	585					cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GTGAGACCTGGTGCTTCGCAG	0.552													34	48	---	---	---	---	capture	Missense_Mutation	SNP	77895050	77895050	ADNP2	18	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	324	174
VAV1	7409	broad.mit.edu	37	19	6828672	6828672	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6828672G>A	uc002mfu.1	+	12	1229	c.1132G>A	c.(1132-1134)GAG>AAG	p.E378K	VAV1_uc010xjh.1_Missense_Mutation_p.E346K|VAV1_uc010dva.1_Missense_Mutation_p.E378K|VAV1_uc002mfv.1_Missense_Mutation_p.E323K	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	378					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						GCGAGACAACGAGACACTGCG	0.637													93	163	---	---	---	---	capture	Missense_Mutation	SNP	6828672	6828672	VAV1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17013	174
MUC16	94025	broad.mit.edu	37	19	9014654	9014654	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9014654C>T	uc002mkp.2	-	31	38525	c.38321G>A	c.(38320-38322)CGT>CAT	p.R12774H	MUC16_uc010xki.1_5'Flank	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12776	SEA 5.|Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGGGTCAAGACGGTGGGTGCA	0.567													32	50	---	---	---	---	capture	Missense_Mutation	SNP	9014654	9014654	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9883	174
IL27RA	9466	broad.mit.edu	37	19	14150321	14150321	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14150321C>T	uc002mxx.2	+	3	643	c.220C>T	c.(220-222)CGT>TGT	p.R74C		NM_004843	NP_004834	Q6UWB1	I27RA_HUMAN	class I cytokine receptor precursor	74	Extracellular (Potential).				cell surface receptor linked signaling pathway|immune response	integral to plasma membrane	transmembrane receptor activity				0						TCCTCACAGCCGTTCCAACAA	0.547													28	50	---	---	---	---	capture	Missense_Mutation	SNP	14150321	14150321	IL27RA	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7604	174
CPAMD8	27151	broad.mit.edu	37	19	17017818	17017818	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17017818C>T	uc002nfb.2	-	30	4144	c.4112G>A	c.(4111-4113)CGC>CAC	p.R1371H		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1324						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						TGCCGGGCTGCGGAGCAGGGT	0.667													10	15	---	---	---	---	capture	Missense_Mutation	SNP	17017818	17017818	CPAMD8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3760	174
ABHD8	79575	broad.mit.edu	37	19	17411828	17411828	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17411828G>A	uc002ngb.3	-	2	838	c.598C>T	c.(598-600)CGC>TGC	p.R200C		NM_024527	NP_078803	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	200							hydrolase activity				0						TAGCCTAGGCGCACAAAGAAG	0.642													45	101	---	---	---	---	capture	Missense_Mutation	SNP	17411828	17411828	ABHD8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	87	174
LGALS14	56891	broad.mit.edu	37	19	40197279	40197279	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40197279G>A	uc002omg.2	+	2	281	c.58G>A	c.(58-60)GTG>ATG	p.V20M	LGALS14_uc002omf.2_Missense_Mutation_p.V49M	NM_020129	NP_064514	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14 isoform	20	Galectin.					nucleus	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			TGGTTCGTGCGTGATAATCAC	0.498													75	116	---	---	---	---	capture	Missense_Mutation	SNP	40197279	40197279	LGALS14	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8661	174
KLK5	25818	broad.mit.edu	37	19	51452018	51452018	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51452018T>C	uc002pue.2	-	6	822	c.604A>G	c.(604-606)AAG>GAG	p.K202E	KLK5_uc002puf.2_Missense_Mutation_p.K202E|KLK5_uc002pug.2_Missense_Mutation_p.K202E	NM_001077491	NP_001070959	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5 preproprotein	202	Peptidase S1.				epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		TGGAGGACCTTAGGGAAGTGC	0.502													34	40	---	---	---	---	capture	Missense_Mutation	SNP	51452018	51452018	KLK5	19	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	8327	174
KIR3DL1	3811	broad.mit.edu	37	19	55331314	55331314	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55331314G>A	uc002qhk.3	+	4	565	c.502G>A	c.(502-504)GTT>ATT	p.V168I	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.V110I|KIR3DL1_uc010esf.2_Missense_Mutation_p.V73I|KIR3DL1_uc010yfo.1_Missense_Mutation_p.V110I|KIR3DL1_uc002qhl.3_Missense_Mutation_p.V168I	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	168	Extracellular (Potential).|Ig-like C2-type 2.				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		CTCACGCCTCGTTGGACAGAT	0.502													79	20	---	---	---	---	capture	Missense_Mutation	SNP	55331314	55331314	KIR3DL1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8242	174
SYT5	6861	broad.mit.edu	37	19	55685985	55685985	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55685985C>T	uc002qjm.1	-	7	1920	c.860G>A	c.(859-861)GGC>GAC	p.G287D	SYT5_uc002qjp.2_Missense_Mutation_p.G283D|SYT5_uc002qjn.1_Missense_Mutation_p.G287D|SYT5_uc002qjo.1_Missense_Mutation_p.G286D	NM_003180	NP_003171	O00445	SYT5_HUMAN	synaptotagmin V	287	Cytoplasmic (Potential).|C2 2.				energy reserve metabolic process|regulation of insulin secretion|synaptic transmission	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane	metal ion binding|transporter activity				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CACCTTTTTGCCGCCCTGCAG	0.517													4	142	---	---	---	---	capture	Missense_Mutation	SNP	55685985	55685985	SYT5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15365	174
ZSCAN1	284312	broad.mit.edu	37	19	58565136	58565136	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58565136G>A	uc002qrc.1	+	6	1191	c.944G>A	c.(943-945)CGC>CAC	p.R315H		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	315					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		AAGACCCATCGCGAGGAAGGG	0.647													27	39	---	---	---	---	capture	Missense_Mutation	SNP	58565136	58565136	ZSCAN1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	18102	174
ADCY3	109	broad.mit.edu	37	2	25141642	25141642	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:25141642C>T	uc002rfs.3	-	1	414	c.215G>A	c.(214-216)AGG>AAG	p.R72K	ADCY3_uc010ykm.1_Missense_Mutation_p.R72K	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	72	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GTGGCGCTGCCTTTTGAAGTA	0.597													7	58	---	---	---	---	capture	Missense_Mutation	SNP	25141642	25141642	ADCY3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	295	174
UXS1	80146	broad.mit.edu	37	2	106710571	106710571	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:106710571G>A	uc002tdm.2	-	15	1272	c.1174C>T	c.(1174-1176)CGT>TGT	p.R392C	UXS1_uc002tdk.2_Missense_Mutation_p.R190C|UXS1_uc002tdl.2_Missense_Mutation_p.R224C|UXS1_uc002tdn.2_Missense_Mutation_p.R397C|UXS1_uc002tdo.2_Missense_Mutation_p.R335C	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	392	Lumenal (Potential).				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						AGTTCTTTACGGAAGTAGTGA	0.468													3	61	---	---	---	---	capture	Missense_Mutation	SNP	106710571	106710571	UXS1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16991	174
TUBA3D	113457	broad.mit.edu	37	2	132238151	132238151	+	Silent	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:132238151C>T	uc002tsu.3	+	4	992	c.885C>T	c.(883-885)TGC>TGT	p.C295C		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	295					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)		CCAATGCCTGCTTCGAGCCAG	0.597													63	51	---	---	---	---	capture	Silent	SNP	132238151	132238151	TUBA3D	2	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	16629	174
HOXD9	3235	broad.mit.edu	37	2	176988850	176988850	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:176988850C>A	uc010zex.1	+	2	1090	c.1006C>A	c.(1006-1008)CGT>AGT	p.R336S		NM_014213	NP_055028	P28356	HXD9_HUMAN	homeobox D9	336	Homeobox.					nucleus	sequence-specific DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		GTTTCAGAACCGTAGGATGAA	0.532													58	84	---	---	---	---	capture	Missense_Mutation	SNP	176988850	176988850	HOXD9	2	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	7251	174
AOX1	316	broad.mit.edu	37	2	201478599	201478599	+	Silent	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201478599G>A	uc002uvx.2	+	15	1622	c.1521G>A	c.(1519-1521)GCG>GCA	p.A507A	AOX1_uc010zhf.1_Silent_p.A63A|AOX1_uc010fsu.2_5'UTR	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	507					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TGGGCTCGGCGCCAGGTGGGA	0.468													32	47	---	---	---	---	capture	Silent	SNP	201478599	201478599	AOX1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	722	174
ERG	2078	broad.mit.edu	37	21	39795376	39795376	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:39795376G>A	uc010gnw.2	-	5	660	c.365C>T	c.(364-366)CCC>CTC	p.P122L	ERG_uc002yxa.2_Missense_Mutation_p.P115L|ERG_uc011aek.1_Missense_Mutation_p.P23L|ERG_uc010gnv.2_Missense_Mutation_p.P23L|ERG_uc010gnx.2_Missense_Mutation_p.P122L|ERG_uc011ael.1_Missense_Mutation_p.P122L|ERG_uc002yxb.2_Missense_Mutation_p.P122L|ERG_uc011aem.1_Missense_Mutation_p.P115L|ERG_uc002yxc.3_Missense_Mutation_p.P122L	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4	122	PNT.				cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				CATGTTTGGGGGTGGCATGTG	0.592													25	34	---	---	---	---	capture	Missense_Mutation	SNP	39795376	39795376	ERG	21	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	5177	174
POFUT2	23275	broad.mit.edu	37	21	46689872	46689872	+	Silent	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46689872G>A	uc002zhc.2	-	7	919	c.894C>T	c.(892-894)TTC>TTT	p.F298F	POFUT2_uc002zha.2_RNA|POFUT2_uc002zhb.2_RNA|POFUT2_uc002zhd.2_Silent_p.F298F	NM_133635	NP_598368	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2 isoform C	298					fucose metabolic process	endoplasmic reticulum	peptide-O-fucosyltransferase activity				0				Colorectal(79;0.243)		GACCCCAGATGAAATCTTTTC	0.572													49	44	---	---	---	---	capture	Silent	SNP	46689872	46689872	POFUT2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	12087	174
GRIP2	80852	broad.mit.edu	37	3	14552933	14552933	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14552933C>T	uc011avi.1	-	16	2069	c.2069G>A	c.(2068-2070)AGC>AAC	p.S690N	GRIP2_uc010heh.2_RNA|GRIP2_uc011avh.1_Missense_Mutation_p.S221N	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	592	PDZ 5.				synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						GTGTGCCACGCTGCCTTTCTT	0.597													18	31	---	---	---	---	capture	Missense_Mutation	SNP	14552933	14552933	GRIP2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	6721	174
TRIM71	131405	broad.mit.edu	37	3	32915463	32915463	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32915463C>T	uc003cff.2	+	2	1069	c.1006C>T	c.(1006-1008)CGA>TGA	p.R336*		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	336					multicellular organismal development	cytoplasm	zinc ion binding	p.R336fs*6(1)		ovary(2)|large_intestine(1)	3						CCAGCAGGGACGACAGGCAAT	0.612													34	100	---	---	---	---	capture	Nonsense_Mutation	SNP	32915463	32915463	TRIM71	3	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	16427	174
MINA	84864	broad.mit.edu	37	3	97686291	97686291	+	Silent	SNP	G	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97686291G>T	uc003drz.1	-	2	653	c.147C>A	c.(145-147)ATC>ATA	p.I49I	MINA_uc003dsa.1_Silent_p.I49I|MINA_uc003dsb.1_Silent_p.I49I|MINA_uc003dsc.1_Silent_p.I49I|MINA_uc010hpa.1_RNA|MINA_uc010hpb.1_Intron	NM_001042533	NP_001035998	Q8IUF8	MINA_HUMAN	MYC induced nuclear antigen isoform a	49					ribosome biogenesis	cytoplasm|nucleolus				ovary(1)	1						TCTCTGTCTTGATGGGCGAGA	0.488													32	71	---	---	---	---	capture	Silent	SNP	97686291	97686291	MINA	3	G	T	T	T	1	0	0	0	0	0	0	0	1	577	45	4	4	9498	174
ALCAM	214	broad.mit.edu	37	3	105238918	105238918	+	Silent	SNP	A	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:105238918A>T	uc003dvx.2	+	2	621	c.81A>T	c.(79-81)GGA>GGT	p.G27G	ALCAM_uc003dvv.2_Silent_p.G27G|ALCAM_uc003dvw.1_Silent_p.G27G|ALCAM_uc003dvy.2_Silent_p.G27G|ALCAM_uc011bhh.1_5'UTR	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	27					cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						AAGGCCTTGGATGGTATACTG	0.294													32	34	---	---	---	---	capture	Silent	SNP	105238918	105238918	ALCAM	3	A	T	T	T	1	0	0	0	0	0	0	0	1	145	12	4	4	487	174
BCHE	590	broad.mit.edu	37	3	165503999	165503999	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:165503999T>C	uc003fem.3	-	3	1778	c.1618A>G	c.(1618-1620)ACG>GCG	p.T540A	BCHE_uc003fen.3_RNA	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	540					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	CGTAGTTTCGTCATTATTCTT	0.363													26	39	---	---	---	---	capture	Missense_Mutation	SNP	165503999	165503999	BCHE	3	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	1347	174
PIK3CA	5290	broad.mit.edu	37	3	178916623	178916623	+	Nonsense_Mutation	SNP	C	T	T	rs1051397		TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916623C>T	uc003fjk.2	+	2	167	c.10C>T	c.(10-12)CGA>TGA	p.R4*		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	4					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AATGCCTCCACGACCATCATC	0.393		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			22	27	---	---	---	---	capture	Nonsense_Mutation	SNP	178916623	178916623	PIK3CA	3	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	11816	174
PIK3CA	5290	broad.mit.edu	37	3	178916945	178916945	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916945A>G	uc003fjk.2	+	2	489	c.332A>G	c.(331-333)AAG>AGG	p.K111R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	111					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.K111N(10)|p.K111E(7)|p.K111R(1)|p.K111del(1)|p.K111_I112>N(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			CGTGAAGAAAAGATCCTCAAT	0.333		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			33	81	---	---	---	---	capture	Missense_Mutation	SNP	178916945	178916945	PIK3CA	3	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	11816	174
WDR1	9948	broad.mit.edu	37	4	10099515	10099515	+	Silent	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:10099515C>T	uc003gmf.2	-	5	661	c.378G>A	c.(376-378)AAG>AAA	p.K126K	WDR1_uc003gmg.2_Intron	NM_017491	NP_059830	O75083	WDR1_HUMAN	WD repeat-containing protein 1 isoform 1	126	WD 2.				platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding			ovary(2)|pancreas(1)	3				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CTGCTCCAAACCTTGACCCAA	0.478													4	7	---	---	---	---	capture	Silent	SNP	10099515	10099515	WDR1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	17153	174
CDKL2	8999	broad.mit.edu	37	4	76539498	76539498	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76539498C>G	uc003hiq.2	-	3	829	c.304G>C	c.(304-306)GTA>CTA	p.V102L	CDKL2_uc011cbp.1_Missense_Mutation_p.V102L|CDKL2_uc010iix.1_Intron	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2	102	Protein kinase.				sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TTTTGAACTACTTGGTAGTCT	0.294													14	23	---	---	---	---	capture	Missense_Mutation	SNP	76539498	76539498	CDKL2	4	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	3124	174
OTUD4	54726	broad.mit.edu	37	4	146059006	146059006	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:146059006G>A	uc003ika.3	-	21	2864	c.2726C>T	c.(2725-2727)ACT>ATT	p.T909I	OTUD4_uc003ijz.3_Missense_Mutation_p.T908I	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	973							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					AACAGGCACAGTTTCTCTCTC	0.463													5	197	---	---	---	---	capture	Missense_Mutation	SNP	146059006	146059006	OTUD4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	11218	174
HTR1A	3350	broad.mit.edu	37	5	63256355	63256355	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:63256355C>T	uc011cqt.1	-	1	1192	c.1192G>A	c.(1192-1194)GTC>ATC	p.V398I		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	398	Helical; Name=7; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	GCGTAAATGACGGGGTTAAGC	0.517													128	190	---	---	---	---	capture	Missense_Mutation	SNP	63256355	63256355	HTR1A	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7361	174
GPR98	84059	broad.mit.edu	37	5	90049615	90049615	+	Silent	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90049615G>A	uc003kju.2	+	54	11442	c.11346G>A	c.(11344-11346)GCG>GCA	p.A3782A	GPR98_uc003kjt.2_Silent_p.A1488A|GPR98_uc003kjv.2_Silent_p.A1382A	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3782	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGCGTGCTGCGTCTGTCTTCA	0.368													9	10	---	---	---	---	capture	Silent	SNP	90049615	90049615	GPR98	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	6654	174
PCDHA8	56140	broad.mit.edu	37	5	140222810	140222810	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140222810G>A	uc003lhs.2	+	1	1904	c.1904G>A	c.(1903-1905)CGT>CAT	p.R635H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.R635H	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	635	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCACCACTCGTGTCCTGGAC	0.647													78	117	---	---	---	---	capture	Missense_Mutation	SNP	140222810	140222810	PCDHA8	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11433	174
KIF4B	285643	broad.mit.edu	37	5	154395782	154395782	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154395782G>A	uc010jih.1	+	1	2523	c.2363G>A	c.(2362-2364)CGG>CAG	p.R788Q		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	788	Interaction with PRC1 (By similarity).|Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AAGGAATCTCGGGAGAATCCA	0.438													12	20	---	---	---	---	capture	Missense_Mutation	SNP	154395782	154395782	KIF4B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8226	174
ME1	4199	broad.mit.edu	37	6	84056027	84056027	+	Silent	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84056027A>G	uc003pjy.2	-	5	571	c.465T>C	c.(463-465)CGT>CGC	p.R155R	ME1_uc011dzb.1_Silent_p.R80R|ME1_uc011dzc.1_5'UTR	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1	155		NADP (By similarity).			carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)	AGCCAAGAATACGCTCTCCAT	0.428													24	48	---	---	---	---	capture	Silent	SNP	84056027	84056027	ME1	6	A	G	G	G	1	0	0	0	0	0	0	0	1	171	14	3	3	9330	174
PRDM13	59336	broad.mit.edu	37	6	100062503	100062503	+	Silent	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100062503C>T	uc003pqg.1	+	4	2253	c.1992C>T	c.(1990-1992)GAC>GAT	p.D664D		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	664					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		AAGCGGGCGACGGCCCGGGTG	0.687													14	17	---	---	---	---	capture	Silent	SNP	100062503	100062503	PRDM13	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12350	174
DSE	29940	broad.mit.edu	37	6	116720360	116720360	+	Splice_Site	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116720360G>A	uc003pws.2	+	2	142	c.-52_splice	c.e2-1		DSE_uc011ebf.1_Splice_Site|DSE_uc003pwq.1_Splice_Site|DSE_uc011ebg.1_Splice_Site_p.G2_splice|DSE_uc003pwt.2_Splice_Site	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor						dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		ATCTCACGTAGGATCTTTCGA	0.433													19	26	---	---	---	---	capture	Splice_Site	SNP	116720360	116720360	DSE	6	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	4729	174
C6orf170	221322	broad.mit.edu	37	6	121427228	121427228	+	Nonsense_Mutation	SNP	T	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:121427228T>A	uc003pyo.1	-	30	3474	c.3406A>T	c.(3406-3408)AAG>TAG	p.K1136*		NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	1136	Rab-GAP TBC.				multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		AACTCAGCCTTCAGTAGCATT	0.393													98	149	---	---	---	---	capture	Nonsense_Mutation	SNP	121427228	121427228	C6orf170	6	T	A	A	A	1	0	0	0	0	0	1	0	0	806	62	5	4	2321	174
SYNE1	23345	broad.mit.edu	37	6	152660497	152660497	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152660497T>C	uc010kiw.2	-	75	12832	c.12230A>G	c.(12229-12231)AAA>AGA	p.K4077R	SYNE1_uc003qot.3_Missense_Mutation_p.K4006R|SYNE1_uc003qou.3_Missense_Mutation_p.K4077R|SYNE1_uc010kja.1_Missense_Mutation_p.K782R	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4077	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTGAAGTGTTTGACCTGGAA	0.403										HNSCC(10;0.0054)			23	41	---	---	---	---	capture	Missense_Mutation	SNP	152660497	152660497	SYNE1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	15333	174
SNX13	23161	broad.mit.edu	37	7	17861198	17861198	+	Silent	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:17861198C>T	uc003stw.1	-	18	2025	c.1812G>A	c.(1810-1812)GAG>GAA	p.E604E	SNX13_uc003stv.2_Silent_p.E593E|SNX13_uc010kuc.2_Silent_p.E390E|SNX13_uc010kub.2_5'UTR			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;	604	PX.				cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TCCACATCTCCTCACTGTTTA	0.413													43	126	---	---	---	---	capture	Silent	SNP	17861198	17861198	SNX13	7	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	14776	174
CHN2	1124	broad.mit.edu	37	7	29407583	29407583	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:29407583A>G	uc003szz.2	+	3	561	c.124A>G	c.(124-126)AGA>GGA	p.R42G	CHN2_uc011jzs.1_Missense_Mutation_p.R117G|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_RNA|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Missense_Mutation_p.R55G|CHN2_uc010kvd.2_Missense_Mutation_p.R42G|CHN2_uc011jzu.1_Missense_Mutation_p.R27G	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2	42					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						TCGTCCCAAGAGAATCATTTG	0.403													16	65	---	---	---	---	capture	Missense_Mutation	SNP	29407583	29407583	CHN2	7	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	3328	174
CDK13	8621	broad.mit.edu	37	7	40117639	40117639	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40117639C>T	uc003thh.3	+	10	3098	c.2816C>T	c.(2815-2817)CCT>CTT	p.P939L	CDK13_uc003thi.3_Missense_Mutation_p.P939L|CDK13_uc003thj.2_5'UTR	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	939	Protein kinase.				alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						GCAGTGTGGCCTGATGTAATC	0.368													51	128	---	---	---	---	capture	Missense_Mutation	SNP	40117639	40117639	CDK13	7	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	3099	174
PSPH	5723	broad.mit.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56085002C>T	uc003trg.2	-	5	709	c.346G>A	c.(346-348)GTA>ATA	p.V116I	PSPH_uc003trh.2_Missense_Mutation_p.V116I|PSPH_uc003tri.2_Missense_Mutation_p.V116I|PSPH_uc003trj.2_Missense_Mutation_p.V145I	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase	116					L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393													6	190	---	---	---	---	capture	Missense_Mutation	SNP	56085002	56085002	PSPH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12612	174
ABCB1	5243	broad.mit.edu	37	7	87148696	87148696	+	Missense_Mutation	SNP	C	T	T	rs144369247		TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87148696C>T	uc003uiz.1	-	24	3291	c.2873G>A	c.(2872-2874)CGG>CAG	p.R958Q	ABCB1_uc011khc.1_Missense_Mutation_p.R894Q	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	958	ABC transmembrane type-1 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	GGCTCCAAACCGGAAACATCC	0.323													34	69	---	---	---	---	capture	Missense_Mutation	SNP	87148696	87148696	ABCB1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	40	174
SAMD9L	219285	broad.mit.edu	37	7	92761184	92761184	+	Silent	SNP	T	C	C			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92761184T>C	uc003umh.1	-	5	5317	c.4101A>G	c.(4099-4101)CTA>CTG	p.L1367L	SAMD9L_uc003umj.1_Silent_p.L1367L|SAMD9L_uc003umi.1_Silent_p.L1367L|SAMD9L_uc010lfb.1_Silent_p.L1367L|SAMD9L_uc003umk.1_Silent_p.L1367L|SAMD9L_uc010lfc.1_Silent_p.L1367L|SAMD9L_uc010lfd.1_Silent_p.L1367L|SAMD9L_uc011khx.1_3'UTR	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1367										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TTTGCTGCAGTAGGAAGGCAT	0.383													77	247	---	---	---	---	capture	Silent	SNP	92761184	92761184	SAMD9L	7	T	C	C	C	1	0	0	0	0	0	0	0	1	730	57	3	3	13719	174
MUC17	140453	broad.mit.edu	37	7	100685627	100685627	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100685627A>G	uc003uxp.1	+	3	10983	c.10930A>G	c.(10930-10932)ACC>GCC	p.T3644A	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3644	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|58.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GCCTGTCAGCACCACATCGGT	0.478													39	97	---	---	---	---	capture	Missense_Mutation	SNP	100685627	100685627	MUC17	7	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	9884	174
PTPRZ1	5803	broad.mit.edu	37	7	121651361	121651361	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121651361A>G	uc003vjy.2	+	12	2656	c.2261A>G	c.(2260-2262)AAT>AGT	p.N754S	PTPRZ1_uc003vjz.2_Missense_Mutation_p.N754S|PTPRZ1_uc011knt.1_Missense_Mutation_p.N204S	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	754	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						CCGGTATACAATGGTGAGACA	0.488													47	140	---	---	---	---	capture	Missense_Mutation	SNP	121651361	121651361	PTPRZ1	7	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	12709	174
OR6V1	346517	broad.mit.edu	37	7	142749543	142749543	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142749543G>A	uc011ksv.1	+	1	106	c.106G>A	c.(106-108)GCC>ACC	p.A36T		NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V,	36	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.059)					TTATCTTCTCGCCTTCATGGG	0.498													83	200	---	---	---	---	capture	Missense_Mutation	SNP	142749543	142749543	OR6V1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11115	174
IDO2	169355	broad.mit.edu	37	8	39836613	39836613	+	Nonsense_Mutation	SNP	A	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:39836613A>T	uc010lwy.1	+	4	504	c.262A>T	c.(262-264)AAG>TAG	p.K88*	IDO2_uc003xno.1_RNA|IDO2_uc010lwz.1_5'UTR	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1	75					tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2						CCAGTTCCTGAAGGGTCACCG	0.637													4	11	---	---	---	---	capture	Nonsense_Mutation	SNP	39836613	39836613	IDO2	8	A	T	T	T	1	0	0	0	0	0	1	0	0	117	9	5	4	7427	174
FBXO43	286151	broad.mit.edu	37	8	101149805	101149805	+	Silent	SNP	T	C	C			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:101149805T>C	uc003yjd.2	-	3	2375	c.1662A>G	c.(1660-1662)AAA>AAG	p.K554K	FBXO43_uc003yje.2_Silent_p.K520K|FBXO43_uc010mbp.1_Silent_p.K554K	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	554					meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			CAGAATCTGTTTTCAGTTGTG	0.308													19	30	---	---	---	---	capture	Silent	SNP	101149805	101149805	FBXO43	8	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	5698	174
TRPM6	140803	broad.mit.edu	37	9	77436668	77436668	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:77436668G>T	uc004ajl.1	-	8	1165	c.927C>A	c.(925-927)GAC>GAA	p.D309E	TRPM6_uc004ajk.1_Missense_Mutation_p.D304E|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.D309E|TRPM6_uc010mpd.1_Missense_Mutation_p.D309E|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	309	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						CTGGGTCCTTGTCCTTGACAG	0.592													41	52	---	---	---	---	capture	Missense_Mutation	SNP	77436668	77436668	TRPM6	9	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	16473	174
MXRA5	25878	broad.mit.edu	37	X	3242355	3242355	+	Silent	SNP	G	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3242355G>T	uc004crg.3	-	5	1528	c.1371C>A	c.(1369-1371)ACC>ACA	p.T457T		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	457						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GAGAATACTGGGTGTAGTAGG	0.488													74	104	---	---	---	---	capture	Silent	SNP	3242355	3242355	MXRA5	23	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	9913	174
DCAF8L1	139425	broad.mit.edu	37	X	27999353	27999353	+	Silent	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:27999353C>T	uc004dbx.1	-	1	214	c.99G>A	c.(97-99)ACG>ACA	p.T33T		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	33										ovary(3)|skin(1)	4						AGGAGGCCGCCGTCACCGCTG	0.567													24	40	---	---	---	---	capture	Silent	SNP	27999353	27999353	DCAF8L1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4236	174
GPR34	2857	broad.mit.edu	37	X	41555890	41555890	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:41555890G>A	uc004dfp.3	+	3	1288	c.1004G>A	c.(1003-1005)CGC>CAC	p.R335H	CASK_uc004dfl.3_Intron|CASK_uc004dfm.3_Intron|CASK_uc004dfn.3_Intron|GPR34_uc004dfq.3_Missense_Mutation_p.R335H|GPR34_uc010nhg.2_Missense_Mutation_p.R335H|GPR34_uc004dfr.3_Missense_Mutation_p.R335H	NM_001097579	NP_001091048	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	335	Cytoplasmic (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1						AGTAACATTCGCAAAATAATG	0.373													18	34	---	---	---	---	capture	Missense_Mutation	SNP	41555890	41555890	GPR34	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6623	174
DGAT2L6	347516	broad.mit.edu	37	X	69420246	69420246	+	Missense_Mutation	SNP	T	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69420246T>A	uc004dxx.1	+	4	506	c.409T>A	c.(409-411)TTT>ATT	p.F137I		NM_198512	NP_940914	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	137					lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)	1						CATCACTCCCTTTGTAGGGAC	0.413													28	39	---	---	---	---	capture	Missense_Mutation	SNP	69420246	69420246	DGAT2L6	23	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	4417	174
CENPI	2491	broad.mit.edu	37	X	100382542	100382542	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100382542A>G	uc004egx.2	+	10	1232	c.962A>G	c.(961-963)GAA>GGA	p.E321G	CENPI_uc011mrg.1_Missense_Mutation_p.E321G|CENPI_uc004egy.2_Missense_Mutation_p.E321G	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	321					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1						TACACTAAAGAATGTGGAAAA	0.353													47	68	---	---	---	---	capture	Missense_Mutation	SNP	100382542	100382542	CENPI	23	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	3201	174
ARMCX5	64860	broad.mit.edu	37	X	101858029	101858029	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:101858029G>C	uc004ejg.2	+	6	1841	c.960G>C	c.(958-960)AAG>AAC	p.K320N	ARMCX5_uc004ejh.2_Missense_Mutation_p.K320N	NM_022838	NP_073749	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	320	ARM 1.						binding			ovary(1)	1						CCCTCCTTAAGTTAACTAAGG	0.383													40	74	---	---	---	---	capture	Missense_Mutation	SNP	101858029	101858029	ARMCX5	23	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	955	174
SLITRK4	139065	broad.mit.edu	37	X	142717642	142717642	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142717642C>T	uc004fbx.2	-	2	1659	c.1283G>A	c.(1282-1284)CGC>CAC	p.R428H	SLITRK4_uc004fby.2_Missense_Mutation_p.R428H	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	428	Extracellular (Potential).|LRR 9.					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					ATATAGCCTGCGTAAATTAGT	0.358													36	88	---	---	---	---	capture	Missense_Mutation	SNP	142717642	142717642	SLITRK4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14637	174
PASD1	139135	broad.mit.edu	37	X	150828252	150828252	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150828252C>A	uc004fev.3	+	10	1117	c.785C>A	c.(784-786)TCT>TAT	p.S262Y		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	262						nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TTTGTAGATTCTGATTCAACT	0.373													42	67	---	---	---	---	capture	Missense_Mutation	SNP	150828252	150828252	PASD1	23	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	11374	174
DUSP9	1852	broad.mit.edu	37	X	152915703	152915703	+	Silent	SNP	G	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152915703G>A	uc004fhx.3	+	4	1302	c.1098G>A	c.(1096-1098)CCG>CCA	p.P366P	DUSP9_uc004fhy.3_Silent_p.P366P	NM_001395	NP_001386	Q99956	DUS9_HUMAN	dual specificity phosphatase 9	366	Tyrosine-protein phosphatase.				inactivation of MAPK activity|JNK cascade	cytosol|endoplasmic reticulum|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			ovary(2)	2	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTCCAACCCGCCCTCCTTCT	0.716													33	43	---	---	---	---	capture	Silent	SNP	152915703	152915703	DUSP9	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4787	174
GDPD3	79153	broad.mit.edu	37	16	30124034	30124036	+	In_Frame_Del	DEL	TCA	-	-			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30124034_30124036delTCA	uc002dwp.2	-	3	340_342	c.261_263delTGA	c.(259-264)GATGAG>GAG	p.D87del	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|GDPD3_uc002dwq.2_In_Frame_Del_p.D25del|LOC100271831_uc010vei.1_5'Flank	NM_024307	NP_077283	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain	87	Extracellular (Potential).|GDPD.				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0						GCACAGGTTCTCATCATGTGACA	0.645											OREG0023731	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	26	67	---	---	---	---	capture_indel	In_Frame_Del	DEL	30124034	30124036	GDPD3	16	TCA	-	-	-	1	0	1	0	1	0	0	0	0	702	54	5	5	6265	174
EMILIN3	90187	broad.mit.edu	37	20	39990117	39990119	+	In_Frame_Del	DEL	CCT	-	-			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39990117_39990119delCCT	uc002xjy.1	-	4	2314_2316	c.2090_2092delAGG	c.(2089-2094)GAGGGT>GGT	p.E697del		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	697						proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				CTGCACGCACCCTCCACTTGTGC	0.665													9	20	---	---	---	---	capture_indel	In_Frame_Del	DEL	39990117	39990119	EMILIN3	20	CCT	-	-	-	1	0	1	0	1	0	0	0	0	286	22	5	5	5050	174
PLEKHA8	84725	broad.mit.edu	37	7	30088881	30088882	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30088881_30088882insA	uc003tam.1	+	5	571_572	c.480_481insA	c.(478-483)AATACTfs	p.N160fs	PLEKHA8_uc003tao.2_Frame_Shift_Ins_p.N44fs|PLEKHA8_uc003tap.1_Frame_Shift_Ins_p.N160fs|PLEKHA8_uc003tan.2_Frame_Shift_Ins_p.N160fs	NM_032639	NP_116028	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A	160_161					protein transport	cytoplasm	glycolipid binding|glycolipid transporter activity			breast(3)|ovary(1)	4						CAACCTGTAATACTTTTCTGAA	0.465													106	273	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	30088881	30088882	PLEKHA8	7	-	A	A	A	1	0	1	1	0	0	0	0	0	634	49	5	5	11965	174
ARMCX5	64860	broad.mit.edu	37	X	101858012	101858012	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-5954-01	TCGA-19-5954-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:101858012delC	uc004ejg.2	+	6	1824	c.943delC	c.(943-945)CTTfs	p.L315fs	ARMCX5_uc004ejh.2_Frame_Shift_Del_p.L315fs	NM_022838	NP_073749	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	315	ARM 1.						binding			ovary(1)	1						GTTTGATAAACTTGTTGCCCT	0.388													38	69	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	101858012	101858012	ARMCX5	23	C	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	955	174
