Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MTF1	4520	broad.mit.edu	37	1	38297931	38297931	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38297931C>G	uc001cce.1	-	7	1195	c.1054G>C	c.(1054-1056)GAA>CAA	p.E352Q	MTF1_uc009vvj.1_Missense_Mutation_p.E43Q	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	352						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTGGAATTTTCTCGCAATTCA	0.393													28	42	---	---	---	---	capture	Missense_Mutation	SNP	38297931	38297931	MTF1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	9832	178
BSND	7809	broad.mit.edu	37	1	55470704	55470704	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55470704G>A	uc001cye.2	+	2	430	c.187G>A	c.(187-189)GTC>ATC	p.V63I		NM_057176	NP_476517	Q8WZ55	BSND_HUMAN	barttin	63	Cytoplasmic (Potential).					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex				ovary(1)|skin(1)	2						GATCACCTTCGTCCCTGCTGA	0.582													18	28	---	---	---	---	capture	Missense_Mutation	SNP	55470704	55470704	BSND	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1519	178
HFM1	164045	broad.mit.edu	37	1	91840986	91840986	+	Silent	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91840986C>T	uc001doa.3	-	13	1714	c.1614G>A	c.(1612-1614)AAG>AAA	p.K538K	HFM1_uc010osu.1_Silent_p.K217K|HFM1_uc010osv.1_Silent_p.K222K	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	538	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		GTTGCACACCCTTCCTTGTTG	0.308													37	44	---	---	---	---	capture	Silent	SNP	91840986	91840986	HFM1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	7008	178
TCHH	7062	broad.mit.edu	37	1	152083402	152083402	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152083402C>G	uc001ezp.2	-	2	2291	c.2291G>C	c.(2290-2292)CGC>CCC	p.R764P	TCHH_uc009wne.1_Missense_Mutation_p.R764P	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	764					keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAGTCCCGGCGCTGCTCCTC	0.682													47	62	---	---	---	---	capture	Missense_Mutation	SNP	152083402	152083402	TCHH	1	C	G	G	G	1	0	0	0	0	1	0	0	0	351	27	4	4	15585	178
NCF2	4688	broad.mit.edu	37	1	183546838	183546838	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183546838C>A	uc001gqj.3	-	3	537	c.262G>T	c.(262-264)GAT>TAT	p.D88Y	NCF2_uc010pod.1_Missense_Mutation_p.D88Y|NCF2_uc010poe.1_Missense_Mutation_p.D88Y|NCF2_uc001gqk.3_Missense_Mutation_p.D88Y	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	88	TPR 2.				cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						ATAGCCAAATCATATCTGCAG	0.443													3	61	---	---	---	---	capture	Missense_Mutation	SNP	183546838	183546838	NCF2	1	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	10124	178
OBSCN	84033	broad.mit.edu	37	1	228505193	228505193	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228505193G>T	uc009xez.1	+	52	13634	c.13590G>T	c.(13588-13590)GAG>GAT	p.E4530D	OBSCN_uc001hsn.2_Missense_Mutation_p.E4530D	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	4530	Fibronectin type-III 3.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				AGGATGCTGAGGTGGTGGCTC	0.647													12	13	---	---	---	---	capture	Missense_Mutation	SNP	228505193	228505193	OBSCN	1	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	10717	178
CAMK1D	57118	broad.mit.edu	37	10	12802954	12802954	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:12802954G>A	uc001ilo.2	+	4	542	c.307G>A	c.(307-309)GGT>AGT	p.G103S	CAMK1D_uc001iln.2_Missense_Mutation_p.G103S	NM_153498	NP_705718	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	103	Protein kinase.					calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)		CAGGGTGTCCGGTGGAGAGCT	0.443													38	3	---	---	---	---	capture	Missense_Mutation	SNP	12802954	12802954	CAMK1D	10	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2573	178
OR52M1	119772	broad.mit.edu	37	11	4566796	4566796	+	Missense_Mutation	SNP	G	A	A	rs61751910	byFrequency	TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4566796G>A	uc010qyf.1	+	1	376	c.376G>A	c.(376-378)GTG>ATG	p.V126M		NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M,	126	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGATCGCTACGTGGCCATCTG	0.527													41	10	---	---	---	---	capture	Missense_Mutation	SNP	4566796	4566796	OR52M1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11030	178
GLYAT	10249	broad.mit.edu	37	11	58478160	58478160	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58478160G>A	uc001nnb.2	-	5	546	c.391C>T	c.(391-393)CGC>TGC	p.R131C	GLYAT_uc001nnc.2_Missense_Mutation_p.R131C	NM_201648	NP_964011	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase isoform a	131					acyl-CoA metabolic process|response to toxin|xenobiotic metabolic process	mitochondrial matrix	glycine N-acyltransferase activity|glycine N-benzoyltransferase activity				0		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	TAGAGAATGCGTTGTGTTTGT	0.428													72	8	---	---	---	---	capture	Missense_Mutation	SNP	58478160	58478160	GLYAT	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6415	178
GPR83	10888	broad.mit.edu	37	11	94113665	94113665	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94113665G>A	uc001pet.2	-	4	1094	c.922C>T	c.(922-924)CTC>TTC	p.L308F		NM_016540	NP_057624	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83 precursor	308	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			central_nervous_system(2)|ovary(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TAGCAGTTGAGGGGGAACCAG	0.532													28	4	---	---	---	---	capture	Missense_Mutation	SNP	94113665	94113665	GPR83	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6646	178
MPZL2	10205	broad.mit.edu	37	11	118133277	118133277	+	Silent	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118133277G>A	uc001psn.2	-	3	453	c.312C>T	c.(310-312)TAC>TAT	p.Y104Y	MPZL2_uc001pso.2_Silent_p.Y104Y|MPZL2_uc001psp.1_Silent_p.Y104Y	NM_005797	NP_005788	O60487	MPZL2_HUMAN	myelin protein zero-like 2 precursor	104	Extracellular (Potential).|Ig-like V-type.				anatomical structure morphogenesis|homophilic cell adhesion	cytoskeleton|integral to membrane				skin(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		TGGAGGCATCGTACCGCTCAG	0.527													22	29	---	---	---	---	capture	Silent	SNP	118133277	118133277	MPZL2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9662	178
FLI1	2313	broad.mit.edu	37	11	128680531	128680531	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128680531G>T	uc010sbu.1	+	9	1348	c.1007G>T	c.(1006-1008)AGC>ATC	p.S336I	FLI1_uc010sbt.1_Missense_Mutation_p.S143I|FLI1_uc010sbv.1_Missense_Mutation_p.S303I|FLI1_uc009zci.2_Missense_Mutation_p.S270I	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	336	ETS.				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GACAAGCTGAGCCGGGCCCTC	0.522			T	EWSR1	Ewing sarcoma								24	14	---	---	---	---	capture	Missense_Mutation	SNP	128680531	128680531	FLI1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	5869	178
RASSF9	9182	broad.mit.edu	37	12	86199652	86199652	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:86199652G>A	uc001taf.1	-	2	475	c.136C>T	c.(136-138)CGC>TGC	p.R46C		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	46	Ras-associating.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						GAGGTGGTGCGTTTAGTCAGC	0.453													44	54	---	---	---	---	capture	Missense_Mutation	SNP	86199652	86199652	RASSF9	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12988	178
DCLK1	9201	broad.mit.edu	37	13	36700120	36700120	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:36700120G>T	uc001uvf.2	-	2	388	c.155C>A	c.(154-156)TCC>TAC	p.S52Y		NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	52					cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CTTCTTCTCGGAGCTGAGCGT	0.582													35	45	---	---	---	---	capture	Missense_Mutation	SNP	36700120	36700120	DCLK1	13	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4250	178
SLITRK5	26050	broad.mit.edu	37	13	88329407	88329407	+	Silent	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:88329407C>T	uc001vln.2	+	2	1983	c.1764C>T	c.(1762-1764)GAC>GAT	p.D588D	SLITRK5_uc010tic.1_Silent_p.D347D	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	588	LRRCT 2.|Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCCTAGTGGACGAGGTGATCT	0.512													80	104	---	---	---	---	capture	Silent	SNP	88329407	88329407	SLITRK5	13	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14638	178
CLYBL	171425	broad.mit.edu	37	13	100515267	100515267	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:100515267A>G	uc001vok.2	+	4	475	c.461A>G	c.(460-462)CAC>CGC	p.H154R	CLYBL_uc010tix.1_Missense_Mutation_p.H154R|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531	Q8N0X4	CLYBL_HUMAN	citrate lyase beta like precursor	154					cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TTTTCATTCCACTTAAAAGGC	0.358													35	44	---	---	---	---	capture	Missense_Mutation	SNP	100515267	100515267	CLYBL	13	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	3538	178
TEKT5	146279	broad.mit.edu	37	16	10783110	10783110	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10783110C>T	uc002czz.1	-	3	791	c.719G>A	c.(718-720)CGG>CAG	p.R240Q		NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5	240	Potential.				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						AAGCCCTTACCGCATCTGGAT	0.413													21	24	---	---	---	---	capture	Missense_Mutation	SNP	10783110	10783110	TEKT5	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15641	178
RECQL5	9400	broad.mit.edu	37	17	73625102	73625102	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73625102G>A	uc010dgl.2	-	16	2557	c.2401C>T	c.(2401-2403)CCA>TCA	p.P801S	RECQL5_uc010dgk.2_Missense_Mutation_p.P774S|RECQL5_uc002jot.3_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	801					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TACTTCTCTGGGGCCATCGGG	0.647								Other_identified_genes_with_known_or_suspected_DNA_repair_function					15	33	---	---	---	---	capture	Missense_Mutation	SNP	73625102	73625102	RECQL5	17	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	13098	178
TNFRSF11A	8792	broad.mit.edu	37	18	60036664	60036664	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:60036664C>T	uc002lin.2	+	9	1552	c.1514C>T	c.(1513-1515)GCG>GTG	p.A505V	TNFRSF11A_uc010dpv.2_Intron	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,	505	Cytoplasmic (Potential).				adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity			breast(2)|lung(1)	3		Colorectal(73;0.188)				CCAAGCTCAGCGAGGGCAGGT	0.632									Paget_Disease_of_Bone				36	7	---	---	---	---	capture	Missense_Mutation	SNP	60036664	60036664	TNFRSF11A	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16167	178
CREB3L3	84699	broad.mit.edu	37	19	4171806	4171806	+	Missense_Mutation	SNP	C	T	T	rs148141076		TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4171806C>T	uc002lzl.2	+	10	1342	c.1226C>T	c.(1225-1227)GCG>GTG	p.A409V	CREB3L3_uc002lzm.2_Missense_Mutation_p.A399V|CREB3L3_uc010xib.1_Missense_Mutation_p.A398V|CREB3L3_uc010xic.1_3'UTR	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	409	Lumenal (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGACACCGCGAACCTGACC	0.677													28	41	---	---	---	---	capture	Missense_Mutation	SNP	4171806	4171806	CREB3L3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3823	178
LILRA6	79168	broad.mit.edu	37	19	54744788	54744788	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54744788C>T	uc002qeu.1	-	5	998	c.874G>A	c.(874-876)GGC>AGC	p.G292S	LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Missense_Mutation_p.G292S|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Missense_Mutation_p.G292S|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.G292S|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Missense_Mutation_p.G292S|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Missense_Mutation_p.G292S|LILRA6_uc010yeq.1_Missense_Mutation_p.G292S|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Missense_Mutation_p.G153S	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor,	292	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane	receptor activity			skin(2)	2	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTGTACTGGCCCCCGTGGGAG	0.682													5	113	---	---	---	---	capture	Missense_Mutation	SNP	54744788	54744788	LILRA6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8709	178
EPT1	85465	broad.mit.edu	37	2	26596336	26596336	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26596336G>A	uc010ykz.1	+	5	559	c.412G>A	c.(412-414)GTG>ATG	p.V138M	EPT1_uc010eyl.1_RNA	NM_033505	NP_277040	Q9C0D9	EPT1_HUMAN	selenoprotein I	138	Helical; (Potential).				phospholipid biosynthetic process	integral to membrane	ethanolaminephosphotransferase activity|metal ion binding				0						TTACTTTGTTGTGACTGTTTA	0.433													15	19	---	---	---	---	capture	Missense_Mutation	SNP	26596336	26596336	EPT1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5154	178
TTN	7273	broad.mit.edu	37	2	179432795	179432795	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179432795C>T	uc010zfg.1	-	275	70584	c.70360G>A	c.(70360-70362)GTC>ATC	p.V23454I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V17149I|TTN_uc010zfi.1_Missense_Mutation_p.V17082I|TTN_uc010zfj.1_Missense_Mutation_p.V16957I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24381							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAACCTATGACGGGGCTTCCA	0.443													30	29	---	---	---	---	capture	Missense_Mutation	SNP	179432795	179432795	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	178
ADNP	23394	broad.mit.edu	37	20	49508976	49508976	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49508976G>T	uc002xvt.1	-	5	2620	c.2275C>A	c.(2275-2277)CAT>AAT	p.H759N	ADNP_uc002xvu.1_Missense_Mutation_p.H759N	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector	759	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TCATCTTCATGACCCTTGGGG	0.418													43	45	---	---	---	---	capture	Missense_Mutation	SNP	49508976	49508976	ADNP	20	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	323	178
ATP9A	10079	broad.mit.edu	37	20	50313988	50313988	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50313988A>G	uc002xwg.1	-	5	470	c.470T>C	c.(469-471)GTT>GCT	p.V157A	ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_5'UTR	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	157	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						AAGGTCTCCAACTTGGATGTT	0.418													5	194	---	---	---	---	capture	Missense_Mutation	SNP	50313988	50313988	ATP9A	20	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	1189	178
RCAN1	1827	broad.mit.edu	37	21	35890504	35890504	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35890504C>T	uc002yue.2	-	4	709	c.637G>A	c.(637-639)GTC>ATC	p.V213I	RCAN1_uc002yuc.2_Missense_Mutation_p.V132I|RCAN1_uc002yud.2_Missense_Mutation_p.V78I|RCAN1_uc002yub.2_Missense_Mutation_p.V158I	NM_004414	NP_004405	P53805	RCAN1_HUMAN	calcipressin 1 isoform a	213					blood circulation|calcium-mediated signaling|central nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						CATACATGGACCACCACGCTG	0.493													43	53	---	---	---	---	capture	Missense_Mutation	SNP	35890504	35890504	RCAN1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	13063	178
ZDHHC8	29801	broad.mit.edu	37	22	20131184	20131184	+	Silent	SNP	C	T	T	rs34918643		TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20131184C>T	uc002zrq.2	+	10	2137	c.2031C>T	c.(2029-2031)CCC>CCT	p.P677P	ZDHHC8_uc002zrr.1_Silent_p.P677P|ZDHHC8_uc010gsa.2_Silent_p.P483P	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	677	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					CCTCCCCGCCCGGCACTCCCC	0.716													6	0	---	---	---	---	capture	Silent	SNP	20131184	20131184	ZDHHC8	22	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17501	178
OXSR1	9943	broad.mit.edu	37	3	38266149	38266149	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38266149T>C	uc003chy.2	+	8	1132	c.790T>C	c.(790-792)TTT>CTT	p.F264L	OXSR1_uc010hhb.2_Missense_Mutation_p.F198L|OXSR1_uc010hha.1_Missense_Mutation_p.F196L	NM_005109	NP_005100	O95747	OXSR1_HUMAN	oxidative-stress responsive 1	264	Protein kinase.				intracellular protein kinase cascade|response to oxidative stress		ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TGGAAAATCATTTAGAAAAAT	0.313													34	27	---	---	---	---	capture	Missense_Mutation	SNP	38266149	38266149	OXSR1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	11240	178
TRAK1	22906	broad.mit.edu	37	3	42242442	42242442	+	Silent	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42242442C>T	uc003cky.2	+	12	1539	c.1323C>T	c.(1321-1323)TGC>TGT	p.C441C	TRAK1_uc011azh.1_Silent_p.C441C|TRAK1_uc011azi.1_Silent_p.C441C|TRAK1_uc003ckz.3_Silent_p.C367C|TRAK1_uc011azj.1_Silent_p.C367C|TRAK1_uc003cla.2_Silent_p.C383C	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN	OGT(O-Glc-NAc transferase)-interacting protein	441	Interaction with HGS.				endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1						TGTCCAGCTGCGTCAGCACCC	0.582													58	73	---	---	---	---	capture	Silent	SNP	42242442	42242442	TRAK1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	16332	178
CASR	846	broad.mit.edu	37	3	122003250	122003250	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122003250G>A	uc003eev.3	+	7	2821	c.2449G>A	c.(2449-2451)GTC>ATC	p.V817I	CASR_uc003eew.3_Missense_Mutation_p.V827I	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	817	Helical; Name=6; (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CTTCTTCATCGTCTGGATCTC	0.527													35	50	---	---	---	---	capture	Missense_Mutation	SNP	122003250	122003250	CASR	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2658	178
COL6A6	131873	broad.mit.edu	37	3	130313143	130313143	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:130313143G>C	uc010htl.2	+	17	4520	c.4489G>C	c.(4489-4491)GGG>CGG	p.G1497R	COL6A6_uc003eni.3_5'UTR	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1497	Triple-helical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						AGGGAAGAGAGGGACTCCTGG	0.463													30	56	---	---	---	---	capture	Missense_Mutation	SNP	130313143	130313143	COL6A6	3	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	3668	178
TP63	8626	broad.mit.edu	37	3	189587160	189587160	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189587160C>T	uc003fry.2	+	9	1266	c.1177C>T	c.(1177-1179)CGA>TGA	p.R393*	TP63_uc003frx.2_Nonsense_Mutation_p.R393*|TP63_uc003frz.2_Nonsense_Mutation_p.R393*|TP63_uc010hzc.1_Nonsense_Mutation_p.R393*|TP63_uc003fsa.2_Nonsense_Mutation_p.R299*|TP63_uc003fsb.2_Nonsense_Mutation_p.R299*|TP63_uc003fsc.2_Nonsense_Mutation_p.R299*|TP63_uc003fsd.2_Nonsense_Mutation_p.R299*|TP63_uc010hzd.1_Nonsense_Mutation_p.R214*|TP63_uc003fse.1_Nonsense_Mutation_p.R270*	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	393					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CATCAAGAAACGAAGATCCCC	0.413									Hay-Wells_syndrome	HNSCC(45;0.13)			13	13	---	---	---	---	capture	Nonsense_Mutation	SNP	189587160	189587160	TP63	3	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	16275	178
FYTTD1	84248	broad.mit.edu	37	3	197497100	197497100	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:197497100G>T	uc003fyi.2	+	4	701	c.482G>T	c.(481-483)AGC>ATC	p.S161I	FYTTD1_uc011bui.1_Missense_Mutation_p.S135I|FYTTD1_uc011buj.1_Intron|FYTTD1_uc011buk.1_Missense_Mutation_p.S94I	NM_032288	NP_115664	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1 isoform 1	161					mRNA export from nucleus	nuclear speck	mRNA binding|protein binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		AAGAGACCTAGCCAGCTAAGC	0.363													7	17	---	---	---	---	capture	Missense_Mutation	SNP	197497100	197497100	FYTTD1	3	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	6069	178
EGF	1950	broad.mit.edu	37	4	110895931	110895931	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110895931A>T	uc003hzy.3	+	12	2249	c.1797A>T	c.(1795-1797)CAA>CAT	p.Q599H	EGF_uc011cfu.1_Missense_Mutation_p.Q557H|EGF_uc011cfv.1_Missense_Mutation_p.Q599H	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	599	LDL-receptor class B 7.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	ACATCTCTCAACCACGAGGAA	0.388													30	46	---	---	---	---	capture	Missense_Mutation	SNP	110895931	110895931	EGF	4	A	T	T	T	1	0	0	0	0	1	0	0	0	24	2	4	4	4917	178
C6	729	broad.mit.edu	37	5	41196027	41196027	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41196027T>C	uc003jmk.2	-	5	664	c.454A>G	c.(454-456)ATT>GTT	p.I152V	C6_uc003jml.1_Missense_Mutation_p.I152V	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	152	LDL-receptor class A.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TTTCTGGCAATGCAGCGGCCT	0.358													33	40	---	---	---	---	capture	Missense_Mutation	SNP	41196027	41196027	C6	5	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	2292	178
C5orf34	375444	broad.mit.edu	37	5	43487196	43487196	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:43487196C>A	uc003jnz.1	-	14	2055	c.1738G>T	c.(1738-1740)GGT>TGT	p.G580C		NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	580										breast(1)	1	Lung NSC(6;2.07e-05)					TTTAGGATACCACTATTTTCT	0.313													13	28	---	---	---	---	capture	Missense_Mutation	SNP	43487196	43487196	C5orf34	5	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	2271	178
FGFR4	2264	broad.mit.edu	37	5	176519769	176519769	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176519769G>A	uc003mfl.2	+	8	1208	c.1041G>A	c.(1039-1041)TGG>TGA	p.W347*	FGFR4_uc003mfm.2_Nonsense_Mutation_p.W347*|FGFR4_uc011dfu.1_Nonsense_Mutation_p.W347*|FGFR4_uc011dfw.1_Nonsense_Mutation_p.W347*|FGFR4_uc003mfo.2_Nonsense_Mutation_p.W347*	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	347	Extracellular (Potential).|Ig-like C2-type 3.				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	AGTCTGCCTGGCTCACGGTGC	0.647										TSP Lung(9;0.080)			23	32	---	---	---	---	capture	Nonsense_Mutation	SNP	176519769	176519769	FGFR4	5	G	A	A	A	1	0	0	0	0	0	1	0	0	546	42	5	2	5814	178
TMEM217	221468	broad.mit.edu	37	6	37186701	37186701	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:37186701G>T	uc003onl.2	-	2	187	c.106C>A	c.(106-108)CAC>AAC	p.H36N	TMEM217_uc010jwr.2_Missense_Mutation_p.H36N|TMEM217_uc010jws.2_Intron|TMEM217_uc003onm.3_Missense_Mutation_p.H36N	NM_145316	NP_660359	Q8N7C4	TM217_HUMAN	transmembrane protein 217 isoform 1	36						integral to membrane					0						TTCCCTAGGTGCTTCTGTTCA	0.468													6	134	---	---	---	---	capture	Missense_Mutation	SNP	37186701	37186701	TMEM217	6	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	16023	178
DNAH8	1769	broad.mit.edu	37	6	38830180	38830180	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38830180G>A	uc003ooe.1	+	42	6205	c.5605G>A	c.(5605-5607)GTG>ATG	p.V1869M		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						ATATGTGGTCGTGTTCAATTG	0.418													67	11	---	---	---	---	capture	Missense_Mutation	SNP	38830180	38830180	DNAH8	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4563	178
LRFN2	57497	broad.mit.edu	37	6	40400626	40400626	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:40400626G>A	uc003oph.1	-	2	692	c.227C>T	c.(226-228)ACG>ATG	p.T76M		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	76	Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					CACCAGCCCCGTCATGTTGGC	0.597													27	1	---	---	---	---	capture	Missense_Mutation	SNP	40400626	40400626	LRFN2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8854	178
TBP	6908	broad.mit.edu	37	6	170880497	170880497	+	Splice_Site	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:170880497G>A	uc003qxt.2	+	7	1078	c.846_splice	c.e7-1	p.S282_splice	TBP_uc003qxu.2_Splice_Site_p.S282_splice|TBP_uc011ehf.1_Splice_Site_p.S262_splice	NM_003194	NP_003185	P20226	TBP_HUMAN	TATA box binding protein						cell death|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription from RNA polymerase III promoter|viral reproduction	transcription factor TFIIA complex|transcription factor TFIID complex	repressing transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		TTTCCTTCTAGTTATGAGCCA	0.318													6	343	---	---	---	---	capture	Splice_Site	SNP	170880497	170880497	TBP	6	G	A	A	A	1	0	0	0	0	0	0	1	0	468	36	5	2	15531	178
TECPR1	25851	broad.mit.edu	37	7	97862242	97862242	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97862242G>A	uc003upg.2	-	12	1920	c.1715C>T	c.(1714-1716)CCG>CTG	p.P572L	TECPR1_uc003uph.1_Missense_Mutation_p.P502L	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	572						integral to membrane	protein binding			pancreas(1)	1						GGTCTGGGCCGGCGTGATGGA	0.652													26	58	---	---	---	---	capture	Missense_Mutation	SNP	97862242	97862242	TECPR1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15628	178
CYP3A5	1577	broad.mit.edu	37	7	99264589	99264589	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99264589C>T	uc003urq.2	-	5	505	c.418G>A	c.(418-420)GGA>AGA	p.G140R	ZNF498_uc003urn.2_Intron|CYP3A5_uc003urp.2_5'UTR|CYP3A5_uc003urr.2_Missense_Mutation_p.G27R|CYP3A5_uc011kiy.1_Missense_Mutation_p.G130R|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron	NM_000777	NP_000768	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A,	140					alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)	TTGAGTTTTCCGCTGGTGAAG	0.413													3	85	---	---	---	---	capture	Missense_Mutation	SNP	99264589	99264589	CYP3A5	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4140	178
KIAA1147	57189	broad.mit.edu	37	7	141365018	141365018	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141365018C>G	uc003vwk.2	-	6	921	c.921G>C	c.(919-921)GAG>GAC	p.E307D		NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189	307										ovary(1)	1	Melanoma(164;0.0171)					CCTCCAGGCTCTCGATGTCAG	0.602													10	18	---	---	---	---	capture	Missense_Mutation	SNP	141365018	141365018	KIAA1147	7	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	8132	178
ARHGEF5	7984	broad.mit.edu	37	7	144060770	144060770	+	Silent	SNP	T	C	C	rs141931104	by1000genomes	TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144060770T>C	uc003wel.2	+	2	1126	c.1008T>C	c.(1006-1008)AAT>AAC	p.N336N	ARHGEF5_uc003wek.2_Silent_p.N336N	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	336					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					CAGAAGAGAATAGGGCGGACT	0.512													3	10	---	---	---	---	capture	Silent	SNP	144060770	144060770	ARHGEF5	7	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	902	178
NOS3	4846	broad.mit.edu	37	7	150695737	150695737	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150695737G>A	uc003wif.2	+	7	1081	c.785G>A	c.(784-786)CGG>CAG	p.R262Q	NOS3_uc011kuy.1_Missense_Mutation_p.R56Q|NOS3_uc011kuz.1_Missense_Mutation_p.R262Q|NOS3_uc011kva.1_Missense_Mutation_p.R262Q|NOS3_uc011kvb.1_Missense_Mutation_p.R262Q	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	262	Interaction with NOSIP.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	GGCTCTGTGCGGGGGGACCCA	0.652													7	12	---	---	---	---	capture	Missense_Mutation	SNP	150695737	150695737	NOS3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10451	178
IMPAD1	54928	broad.mit.edu	37	8	57905955	57905955	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:57905955G>A	uc003xte.3	-	1	473	c.190C>T	c.(190-192)CGC>TGC	p.R64C		NM_017813	NP_060283	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	64						Golgi apparatus|integral to membrane	inositol-1(or 4)-monophosphatase activity|metal ion binding			ovary(1)	1		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)				AGCATCTCGCGCAAGTCCACG	0.572													3	23	---	---	---	---	capture	Missense_Mutation	SNP	57905955	57905955	IMPAD1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7648	178
TPD52	7163	broad.mit.edu	37	8	80954870	80954870	+	Silent	SNP	C	T	T			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:80954870C>T	uc003ybr.1	-	5	862	c.540G>A	c.(538-540)AAG>AAA	p.K180K	TPD52_uc010lzr.2_RNA|TPD52_uc010lzs.1_RNA|TPD52_uc003ybs.1_Silent_p.K163K|TPD52_uc003ybt.1_Silent_p.K140K|TPD52_uc003ybq.1_RNA|TPD52_uc003ybu.1_RNA	NM_001025252	NP_001020423	P55327	TPD52_HUMAN	tumor protein D52 isoform 1	180					anatomical structure morphogenesis|B cell differentiation|secretion	endoplasmic reticulum|perinuclear region of cytoplasm	calcium ion binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			AGTTTTCGACCTTTTCTTCAA	0.308													22	39	---	---	---	---	capture	Silent	SNP	80954870	80954870	TPD52	8	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	16280	178
FBP1	2203	broad.mit.edu	37	9	97401548	97401548	+	Silent	SNP	G	C	C			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97401548G>C	uc004auw.3	-	1	376	c.45C>G	c.(43-45)ACC>ACG	p.T15T	FBP1_uc010mrl.2_Silent_p.T15T	NM_000507	NP_000498	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1	15					gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	TGACGAAGCGGGTCAGGGTGT	0.667													4	6	---	---	---	---	capture	Silent	SNP	97401548	97401548	FBP1	9	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	5651	178
TRAF2	7186	broad.mit.edu	37	9	139818449	139818449	+	Silent	SNP	G	A	A			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139818449G>A	uc010nbu.2	+	11	1457	c.1284G>A	c.(1282-1284)CAG>CAA	p.Q428Q	TRAF2_uc004cjv.2_Silent_p.Q428Q|TRAF2_uc011mek.1_Silent_p.Q417Q|TRAF2_uc010nbw.2_Silent_p.Q403Q	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	428	MATH.				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		CCTTCAACCAGAAGGTGAGGC	0.647													14	20	---	---	---	---	capture	Silent	SNP	139818449	139818449	TRAF2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	16321	178
C10orf76	79591	broad.mit.edu	37	10	103716424	103716424	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103716424delG	uc009xwy.1	-	22	1737	c.1635delC	c.(1633-1635)CCCfs	p.P545fs	C10orf76_uc009xwx.1_RNA	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591	545						integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		CATAGCTGCTGGGGGTTGGCA	0.408													35	10	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	103716424	103716424	C10orf76	10	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	1604	178
NUFIP2	57532	broad.mit.edu	37	17	27620990	27620992	+	In_Frame_Del	DEL	GCT	-	-			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27620990_27620992delGCT	uc002hdy.3	-	1	175_177	c.86_88delAGC	c.(85-90)CAGCCG>CCG	p.Q29del	NUFIP2_uc002hdx.3_In_Frame_Del_p.Q29del	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein	29	His-rich.					nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			tggtggtgcggctgctgctgctg	0.251													7	95	---	---	---	---	capture_indel	In_Frame_Del	DEL	27620990	27620992	NUFIP2	17	GCT	-	-	-	1	0	1	0	1	0	0	0	0	546	42	5	5	10656	178
NOX3	50508	broad.mit.edu	37	6	155743925	155743926	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155743925_155743926delCA	uc003qqm.2	-	10	1313_1314	c.1210_1211delTG	c.(1210-1212)TGCfs	p.C404fs		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	404	Helical; (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CGCGGCAACGCACACACACACT	0.530													7	968	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	155743925	155743926	NOX3	6	CA	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	10464	178
PCDH19	57526	broad.mit.edu	37	X	99663560	99663562	+	In_Frame_Del	DEL	CAG	-	-			TCGA-19-5960-01	TCGA-19-5960-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99663560_99663562delCAG	uc010nmz.2	-	1	1710_1712	c.34_36delCTG	c.(34-36)CTGdel	p.L12del	PCDH19_uc004efw.3_In_Frame_Del_p.L12del|PCDH19_uc004efx.3_In_Frame_Del_p.L12del	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	12					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						ACAGTATGGCCAGCAGCAGCAGC	0.665													2	4	---	---	---	---	capture_indel	In_Frame_Del	DEL	99663560	99663562	PCDH19	23	CAG	-	-	-	1	0	1	0	1	0	0	0	0	262	21	5	5	11417	178
