Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TTLL10	254173	broad.mit.edu	37	1	1120451	1120451	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1120451C>T	uc001acy.2	+	13	1514	c.1363C>T	c.(1363-1365)CGG>TGG	p.R455W	TTLL10_uc010nyg.1_Missense_Mutation_p.R455W|TTLL10_uc001acz.1_Missense_Mutation_p.R382W	NM_001130045	NP_001123517	Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	455	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity			large_intestine(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CTGGAAGGCCCGGGGCCTCGC	0.612													6	82	---	---	---	---	capture	Missense_Mutation	SNP	1120451	1120451	TTLL10	1	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	16605	179
TCHH	7062	broad.mit.edu	37	1	152081494	152081494	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152081494C>T	uc001ezp.2	-	2	4199	c.4199G>A	c.(4198-4200)CGC>CAC	p.R1400H	TCHH_uc009wne.1_Missense_Mutation_p.R1400H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1400	23 X 26 AA approximate tandem repeats.		R -> P (found in a renal cell carcinoma sample; somatic mutation).		keratinization	cytoskeleton	calcium ion binding	p.R1400P(1)		ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTGGCAGCGCAGCTGCTG	0.587													51	96	---	---	---	---	capture	Missense_Mutation	SNP	152081494	152081494	TCHH	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15585	179
PCP4L1	654790	broad.mit.edu	37	1	161253488	161253488	+	Nonsense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161253488C>T	uc001gad.2	+	2	288	c.40C>T	c.(40-42)CAG>TAG	p.Q14*		NM_001102566	NP_001096036	A6NKN8	PC4L1_HUMAN	Purkinje cell protein 4 like 1	14											0	all_cancers(52;4.16e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AGCAACCAACCAGGCAGCTGG	0.428													7	16	---	---	---	---	capture	Nonsense_Mutation	SNP	161253488	161253488	PCP4L1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	11502	179
NMNAT2	23057	broad.mit.edu	37	1	183261948	183261948	+	Silent	SNP	G	A	A	rs138225647		TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183261948G>A	uc001gqc.1	-	3	554	c.219C>T	c.(217-219)GCC>GCT	p.A73A	NMNAT2_uc001gqb.1_Silent_p.A68A|NMNAT2_uc001gqd.2_5'Flank	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase	73					water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						AATTCTGGACGGCCAGCTGAC	0.562													3	43	---	---	---	---	capture	Silent	SNP	183261948	183261948	NMNAT2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10406	179
AKR1C4	1109	broad.mit.edu	37	10	5254979	5254979	+	Missense_Mutation	SNP	C	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5254979C>A	uc001ihw.2	+	7	736	c.703C>A	c.(703-705)CTT>ATT	p.L235I		NM_001818	NP_001809	P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	235	NADP.				androgen metabolic process|bile acid biosynthetic process	cytosol	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid transmembrane transporter activity|chlordecone reductase activity|electron carrier activity			ovary(1)	1					NADH(DB00157)	CTCCCCAGTTCTTTTGGAGGA	0.527													7	17	---	---	---	---	capture	Missense_Mutation	SNP	5254979	5254979	AKR1C4	10	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	472	179
HPS6	79803	broad.mit.edu	37	10	103825336	103825336	+	Silent	SNP	T	C	C			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103825336T>C	uc001kuj.2	+	1	190	c.105T>C	c.(103-105)CGT>CGC	p.R35R		NM_024747	NP_079023	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome-6	35						cytosol|early endosome membrane|endoplasmic reticulum|microsome					0		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		TCCGAGTCCGTGGCAGTCCGG	0.756									Hermansky-Pudlak_syndrome				2	4	---	---	---	---	capture	Silent	SNP	103825336	103825336	HPS6	10	T	C	C	C	1	0	0	0	0	0	0	0	1	756	59	3	3	7268	179
NPAS4	266743	broad.mit.edu	37	11	66192484	66192484	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66192484C>T	uc001ohx.1	+	7	2299	c.2123C>T	c.(2122-2124)ACG>ATG	p.T708M	NPAS4_uc010rpc.1_Missense_Mutation_p.T498M	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	708					transcription, DNA-dependent		DNA binding|signal transducer activity				0						CTGGAAGAGACGCCCGTGGAA	0.612													68	98	---	---	---	---	capture	Missense_Mutation	SNP	66192484	66192484	NPAS4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10472	179
CABP4	57010	broad.mit.edu	37	11	67225127	67225127	+	Nonsense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67225127C>T	uc001olo.2	+	4	702	c.625C>T	c.(625-627)CGA>TGA	p.R209*	CABP4_uc001oln.2_Nonsense_Mutation_p.R104*	NM_145200	NP_660201	P57796	CABP4_HUMAN	calcium binding protein 4	209	EF-hand 3.				visual perception	cytoplasm|extracellular region|terminal button	calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GCTGGGGGTGCGAGAGCTGCG	0.637													10	12	---	---	---	---	capture	Nonsense_Mutation	SNP	67225127	67225127	CABP4	11	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	2509	179
SORL1	6653	broad.mit.edu	37	11	121424742	121424742	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:121424742G>A	uc001pxx.2	+	17	2443	c.2363G>A	c.(2362-2364)CGG>CAG	p.R788Q		NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class	788	Extracellular (Potential).				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		ACCGGGCTACGGGCAGCAGTG	0.562													80	108	---	---	---	---	capture	Missense_Mutation	SNP	121424742	121424742	SORL1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14826	179
TFDP1	7027	broad.mit.edu	37	13	114294537	114294537	+	Silent	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:114294537C>T	uc001vtw.2	+	12	1400	c.1188C>T	c.(1186-1188)GAC>GAT	p.D396D	TFDP1_uc010tkd.1_Silent_p.D297D|TFDP1_uc010tke.1_Silent_p.D367D|TFDP1_uc001vty.3_Silent_p.D392D|TFDP1_uc001vtx.2_3'UTR	NM_007111	NP_009042	Q14186	TFDP1_HUMAN	transcription factor Dp-1	396	Asp/Glu-rich (acidic; NCB domain).				cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			lung(4)|ovary(2)|skin(1)	7	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			tcggggaggacgacgaggagg	0.378										TSP Lung(29;0.18)			34	37	---	---	---	---	capture	Silent	SNP	114294537	114294537	TFDP1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15682	179
CDC42BPB	9578	broad.mit.edu	37	14	103523372	103523372	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:103523372G>A	uc001ymi.1	-	1	371	c.139C>T	c.(139-141)CGC>TGC	p.R47C		NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	47					actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TTGTCGCGGCGCAGGGCCGAG	0.721													2	4	---	---	---	---	capture	Missense_Mutation	SNP	103523372	103523372	CDC42BPB	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3044	179
KIAA1370	56204	broad.mit.edu	37	15	52902145	52902145	+	Silent	SNP	A	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:52902145A>G	uc002acg.3	-	6	1119	c.966T>C	c.(964-966)GGT>GGC	p.G322G	KIAA1370_uc002ach.3_RNA|KIAA1370_uc010bfg.1_Silent_p.G234G|KIAA1370_uc010ugf.1_Silent_p.G329G	NM_019600	NP_062546	Q32MH5	K1370_HUMAN	hypothetical protein LOC56204	322											0				all cancers(107;0.0803)		TATCACCTATACCACTAAAGC	0.383													2	12	---	---	---	---	capture	Silent	SNP	52902145	52902145	KIAA1370	15	A	G	G	G	1	0	0	0	0	0	0	0	1	171	14	3	3	8148	179
ANPEP	290	broad.mit.edu	37	15	90349552	90349552	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90349552G>A	uc002bop.3	-	2	555	c.263C>T	c.(262-264)ACG>ATG	p.T88M		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	88	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	CGGTCTCAGCGTCACCCGGTA	0.597													54	84	---	---	---	---	capture	Missense_Mutation	SNP	90349552	90349552	ANPEP	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	704	179
NOD2	64127	broad.mit.edu	37	16	50745689	50745689	+	Missense_Mutation	SNP	C	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50745689C>G	uc002egm.1	+	4	1972	c.1867C>G	c.(1867-1869)CCA>GCA	p.P623A	NOD2_uc010cbk.1_Missense_Mutation_p.P596A|NOD2_uc002egl.1_Missense_Mutation_p.P401A|NOD2_uc010cbl.1_Missense_Mutation_p.P401A|NOD2_uc010cbm.1_Missense_Mutation_p.P401A|NOD2_uc010cbn.1_RNA|NOD2_uc010cbo.1_RNA|NOD2_uc010cbp.1_5'Flank|NOD2_uc010cbq.1_5'Flank|NOD2_uc010cbr.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	623					activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				TGATGTGCCACCAGCTTTGCT	0.582													2	54	---	---	---	---	capture	Missense_Mutation	SNP	50745689	50745689	NOD2	16	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	10424	179
NUP93	9688	broad.mit.edu	37	16	56865910	56865910	+	Silent	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56865910G>A	uc002eka.2	+	11	1363	c.1242G>A	c.(1240-1242)CTG>CTA	p.L414L	NUP93_uc002ekb.2_Silent_p.L291L|NUP93_uc010vhi.1_Silent_p.L291L	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	414					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						AGGATTACCTGTGGCTGAAGG	0.502													83	98	---	---	---	---	capture	Silent	SNP	56865910	56865910	NUP93	16	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	10679	179
CDYL2	124359	broad.mit.edu	37	16	80718650	80718650	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:80718650G>A	uc002ffs.2	-	2	506	c.401C>T	c.(400-402)ACG>ATG	p.T134M		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	134						nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						GTAAGACACCGTCTTGGTGGC	0.537													65	91	---	---	---	---	capture	Missense_Mutation	SNP	80718650	80718650	CDYL2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3155	179
NLRP1	22861	broad.mit.edu	37	17	5418262	5418262	+	Nonsense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5418262G>A	uc002gci.2	-	17	4789	c.4234C>T	c.(4234-4236)CAG>TAG	p.Q1412*	NLRP1_uc002gcg.1_Intron|NLRP1_uc002gck.2_Nonsense_Mutation_p.Q1368*|NLRP1_uc002gcj.2_Nonsense_Mutation_p.Q1382*|NLRP1_uc002gcl.2_Nonsense_Mutation_p.Q1338*|NLRP1_uc002gch.3_Nonsense_Mutation_p.Q1368*	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	1412	CARD.				defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				CTCTCGTACTGCTCCTGGCTC	0.572													18	72	---	---	---	---	capture	Nonsense_Mutation	SNP	5418262	5418262	NLRP1	17	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	10378	179
DNAH2	146754	broad.mit.edu	37	17	7708677	7708677	+	Silent	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7708677C>T	uc002giu.1	+	60	9422	c.9408C>T	c.(9406-9408)AAC>AAT	p.N3136N	DNAH2_uc010cnm.1_Silent_p.N74N	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	3136	Stalk (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTCGAGGCAACGAGCCCACAT	0.403													54	103	---	---	---	---	capture	Silent	SNP	7708677	7708677	DNAH2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4559	179
PRPSAP2	5636	broad.mit.edu	37	17	18833933	18833933	+	Silent	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18833933C>T	uc002gup.1	+	12	1243	c.1032C>T	c.(1030-1032)ATC>ATT	p.I344I	PRPSAP2_uc002guo.1_Silent_p.I258I|PRPSAP2_uc010vyi.1_Silent_p.I292I|PRPSAP2_uc010vyj.1_Silent_p.I258I|PRPSAP2_uc010vyk.1_Silent_p.I283I|PRPSAP2_uc002guq.1_Silent_p.I131I	NM_002767	NP_002758	O60256	KPRB_HUMAN	phosphoribosyl pyrophosphate	344					nucleotide biosynthetic process		enzyme inhibitor activity|magnesium ion binding|ribose phosphate diphosphokinase activity			skin(1)	1						TCAGCATGATCCTTTCAGAGG	0.448													6	157	---	---	---	---	capture	Silent	SNP	18833933	18833933	PRPSAP2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	382	30	2	2	12478	179
SLC6A4	6532	broad.mit.edu	37	17	28537542	28537542	+	Silent	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:28537542G>A	uc002hey.3	-	11	1984	c.1440C>T	c.(1438-1440)ACC>ACT	p.T480T	SLC6A4_uc010csg.2_RNA	NM_001045	NP_001036	P31645	SC6A4_HUMAN	solute carrier family 6 member 4	480	Helical; Name=9; (Potential).				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity			skin(3)|ovary(1)	4					Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)	CAAAAGTCAGGGTGACCAGGG	0.582													42	91	---	---	---	---	capture	Silent	SNP	28537542	28537542	SLC6A4	17	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	14578	179
C17orf71	55181	broad.mit.edu	37	17	57288448	57288448	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:57288448G>A	uc002ixi.2	+	1	1078	c.1036G>A	c.(1036-1038)GAC>AAC	p.D346N		NM_018149	NP_060619	Q8ND04	SMG8_HUMAN	SMG8 protein	346					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding				0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					CCAGGAGGAGGACCCAGTAGG	0.527													17	121	---	---	---	---	capture	Missense_Mutation	SNP	57288448	57288448	C17orf71	17	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	1863	179
ABCA5	23461	broad.mit.edu	37	17	67305454	67305454	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67305454G>A	uc002jif.2	-	3	1636	c.418C>T	c.(418-420)CGT>TGT	p.R140C	ABCA5_uc002jig.2_Missense_Mutation_p.R140C|ABCA5_uc002jih.2_Missense_Mutation_p.R140C|ABCA5_uc010dfe.2_Missense_Mutation_p.R140C	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5	140					cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					GGAAAAAAACGAAGTTCATAG	0.328													23	124	---	---	---	---	capture	Missense_Mutation	SNP	67305454	67305454	ABCA5	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	35	179
RECQL5	9400	broad.mit.edu	37	17	73626864	73626864	+	Missense_Mutation	SNP	C	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73626864C>G	uc010dgl.2	-	12	1795	c.1639G>C	c.(1639-1641)GTG>CTG	p.V547L	RECQL5_uc010dgk.2_Missense_Mutation_p.V520L|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	547					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CTTACCTTCACAGTCAGCCTG	0.657								Other_identified_genes_with_known_or_suspected_DNA_repair_function					2	8	---	---	---	---	capture	Missense_Mutation	SNP	73626864	73626864	RECQL5	17	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	13098	179
GALK1	2584	broad.mit.edu	37	17	73754163	73754163	+	Missense_Mutation	SNP	C	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73754163C>A	uc010wsi.1	-	8	1216	c.1153G>T	c.(1153-1155)GAT>TAT	p.D385Y	GALK1_uc002jpk.2_Missense_Mutation_p.D385Y	NM_000154	NP_000145	P51570	GALK1_HUMAN	galactokinase 1	385					galactose catabolic process	cytosol	ATP binding|galactokinase activity|galactose binding				0	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTGGCTCCATCGGCTGCTTGA	0.682													9	21	---	---	---	---	capture	Missense_Mutation	SNP	73754163	73754163	GALK1	17	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	6143	179
OR10H3	26532	broad.mit.edu	37	19	15852470	15852470	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15852470C>T	uc010xoq.1	+	1	268	c.268C>T	c.(268-270)CAT>TAT	p.H90Y		NM_013938	NP_039226	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCTCTTCACCCATCGTTCCAT	0.502													191	448	---	---	---	---	capture	Missense_Mutation	SNP	15852470	15852470	OR10H3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	10811	179
CPAMD8	27151	broad.mit.edu	37	19	17017835	17017835	+	Silent	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17017835G>A	uc002nfb.2	-	30	4127	c.4095C>T	c.(4093-4095)TAC>TAT	p.Y1365Y		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1318						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						GGGTCAGCGCGTAGGTAGTCA	0.662													17	24	---	---	---	---	capture	Silent	SNP	17017835	17017835	CPAMD8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3760	179
PSG1	5669	broad.mit.edu	37	19	43373123	43373123	+	Nonsense_Mutation	SNP	A	C	C			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43373123A>C	uc002ovb.2	-	4	911	c.773T>G	c.(772-774)TTA>TGA	p.L258*	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Nonsense_Mutation_p.L258*|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_RNA|PSG1_uc002our.1_Nonsense_Mutation_p.L258*|PSG1_uc010eio.1_Nonsense_Mutation_p.L258*|PSG1_uc002oux.1_Nonsense_Mutation_p.L187*|PSG1_uc002ouy.1_Intron|PSG1_uc002ouz.1_Nonsense_Mutation_p.L258*|PSG1_uc002ova.1_Nonsense_Mutation_p.L165*|PSG1_uc002ovc.2_Nonsense_Mutation_p.L165*|PSG1_uc002ovd.1_Nonsense_Mutation_p.L258*	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	258	Ig-like C2-type 2.				female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				GGTGAAGTTTAAGACATCCTT	0.488													187	312	---	---	---	---	capture	Nonsense_Mutation	SNP	43373123	43373123	PSG1	19	A	C	C	C	1	0	0	0	0	0	1	0	0	169	13	5	4	12548	179
MFSD2B	388931	broad.mit.edu	37	2	24247038	24247038	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:24247038G>A	uc002reo.1	+	13	1401	c.1387G>A	c.(1387-1389)GCC>ACC	p.A463T		NM_001080473	NP_001073942	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing	463	Helical; (Potential).				transport	integral to membrane				ovary(2)	2						CCTCATTGGCGCCGTGCCCAC	0.607													29	53	---	---	---	---	capture	Missense_Mutation	SNP	24247038	24247038	MFSD2B	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9443	179
VAX2	25806	broad.mit.edu	37	2	71160172	71160172	+	Silent	SNP	G	A	A	rs144443163	byFrequency	TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71160172G>A	uc002shh.2	+	3	743	c.711G>A	c.(709-711)GCG>GCA	p.A237A	ATP6V1B1_uc002shi.1_5'Flank|ATP6V1B1_uc002shj.2_5'Flank|ATP6V1B1_uc010fdv.2_5'Flank|ATP6V1B1_uc010fdw.2_5'Flank	NM_012476	NP_036608	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	237					ectoderm development|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CGGCCTCAGCGTCCCCCCCAC	0.692													12	43	---	---	---	---	capture	Silent	SNP	71160172	71160172	VAX2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17017	179
EXOC6B	23233	broad.mit.edu	37	2	72692422	72692422	+	Missense_Mutation	SNP	T	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:72692422T>A	uc010fep.2	-	18	1985	c.1847A>T	c.(1846-1848)CAG>CTG	p.Q616L	EXOC6B_uc002sij.2_Missense_Mutation_p.Q616L	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2	616					protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						GTCAATCTTCTGGTTTAAGTT	0.393													3	25	---	---	---	---	capture	Missense_Mutation	SNP	72692422	72692422	EXOC6B	2	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	5264	179
SPTLC3	55304	broad.mit.edu	37	20	13052931	13052931	+	Missense_Mutation	SNP	G	C	C			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13052931G>C	uc002wod.1	+	3	620	c.331G>C	c.(331-333)GAA>CAA	p.E111Q		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	111					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	TCAAGACTTTGAAAATTTTTA	0.428													183	278	---	---	---	---	capture	Missense_Mutation	SNP	13052931	13052931	SPTLC3	20	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	15017	179
KRTAP10-11	386678	broad.mit.edu	37	21	46066487	46066487	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46066487G>A	uc002zfr.3	+	1	157	c.112G>A	c.(112-114)GCC>ACC	p.A38T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198692	NP_941965	P60412	KR10B_HUMAN	keratin associated protein 10-11	38	2.|25 X 5 AA repeats of C-C-X(3).					keratin filament				ovary(1)	1						CAGCTGCTGCGCCCCGGCCCC	0.697													18	51	---	---	---	---	capture	Missense_Mutation	SNP	46066487	46066487	KRTAP10-11	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8427	179
CECR6	27439	broad.mit.edu	37	22	17600851	17600851	+	Silent	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:17600851C>T	uc002zmb.2	-	1	1363	c.1167G>A	c.(1165-1167)CGG>CGA	p.R389R	CECR6_uc002zma.2_Silent_p.R34R|uc002zmc.2_5'Flank	NM_031890	NP_114096	Q9BXQ6	CECR6_HUMAN	cat eye syndrome chromosome region, candidate 6	389											0		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.221)		CCGCGCGGTGCCGCTGGGGCT	0.736													2	4	---	---	---	---	capture	Silent	SNP	17600851	17600851	CECR6	22	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	3176	179
GNB1L	54584	broad.mit.edu	37	22	19794193	19794193	+	Missense_Mutation	SNP	G	C	C			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19794193G>C	uc002zqe.1	-	5	899	c.505C>G	c.(505-507)CGG>GGG	p.R169G	GNB1L_uc002zqd.1_Missense_Mutation_p.R25G|GNB1L_uc002zqf.1_Missense_Mutation_p.R169G	NM_053004	NP_443730	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein	169	WD 3.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)					TGCCACAGCCGCAGGCACATG	0.607													2	31	---	---	---	---	capture	Missense_Mutation	SNP	19794193	19794193	GNB1L	22	G	C	C	C	1	0	0	0	0	1	0	0	0	493	38	4	4	6452	179
CSF2RB	1439	broad.mit.edu	37	22	37325775	37325775	+	Missense_Mutation	SNP	G	A	A	rs149714683		TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37325775G>A	uc003aqa.3	+	6	861	c.644G>A	c.(643-645)CGC>CAC	p.R215H	CSF2RB_uc003aqc.3_Missense_Mutation_p.R215H	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	215	Fibronectin type-III 1.|Extracellular (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	GTACGGACCCGCCTGGCCCCA	0.647													35	45	---	---	---	---	capture	Missense_Mutation	SNP	37325775	37325775	CSF2RB	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3900	179
SSTR3	6753	broad.mit.edu	37	22	37603101	37603101	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37603101G>A	uc003ara.2	-	2	804	c.742C>T	c.(742-744)CGG>TGG	p.R248W	SSTR3_uc003arb.2_Missense_Mutation_p.R248W	NM_001051	NP_001042	P32745	SSR3_HUMAN	somatostatin receptor 3	248	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity			lung(1)	1						GAGCGCCGCCGCCGCTGGCAC	0.667													26	23	---	---	---	---	capture	Missense_Mutation	SNP	37603101	37603101	SSTR3	22	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	15091	179
SUSD5	26032	broad.mit.edu	37	3	33194868	33194868	+	Missense_Mutation	SNP	T	C	C			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:33194868T>C	uc003cfo.1	-	5	1674	c.1256A>G	c.(1255-1257)AAG>AGG	p.K419R		NM_015551	NP_056366	O60279	SUSD5_HUMAN	sushi domain containing 5 precursor	419	Extracellular (Potential).				cell adhesion	integral to membrane	hyaluronic acid binding			ovary(1)|central_nervous_system(1)	2						ACTCTTGGGCTTCTTAACTTC	0.517													2	29	---	---	---	---	capture	Missense_Mutation	SNP	33194868	33194868	SUSD5	3	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	15299	179
SGEF	26084	broad.mit.edu	37	3	153867229	153867229	+	Missense_Mutation	SNP	C	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:153867229C>G	uc011bog.1	+	5	1532	c.1321C>G	c.(1321-1323)CAA>GAA	p.Q441E	SGEF_uc011boh.1_Missense_Mutation_p.Q441E	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine	441	DH.				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AAGAAAGAGACAAGAGGTATG	0.393													2	32	---	---	---	---	capture	Missense_Mutation	SNP	153867229	153867229	SGEF	3	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	14098	179
DCHS2	54798	broad.mit.edu	37	4	155219800	155219800	+	Missense_Mutation	SNP	C	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155219800C>G	uc003inw.2	-	18	4301	c.4301G>C	c.(4300-4302)CGT>CCT	p.R1434P		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1434	Cadherin 12.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GTCCAAAGCACGAGTGGTTGA	0.393													48	122	---	---	---	---	capture	Missense_Mutation	SNP	155219800	155219800	DCHS2	4	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	4247	179
DCHS2	54798	broad.mit.edu	37	4	155242236	155242236	+	Silent	SNP	A	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155242236A>G	uc003inw.2	-	14	2950	c.2950T>C	c.(2950-2952)TTA>CTA	p.L984L		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	984	Cadherin 8.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTAAAATGTAACTTTCCATTA	0.328													49	71	---	---	---	---	capture	Silent	SNP	155242236	155242236	DCHS2	4	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	4247	179
HEATR7B2	133558	broad.mit.edu	37	5	41058241	41058241	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41058241C>T	uc003jmj.3	-	7	1170	c.680G>A	c.(679-681)CGT>CAT	p.R227H	HEATR7B2_uc003jmi.3_Translation_Start_Site	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	227							binding			ovary(6)|central_nervous_system(2)	8						GGCGTATCCACGGAAGTCTTC	0.517													16	75	---	---	---	---	capture	Missense_Mutation	SNP	41058241	41058241	HEATR7B2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6961	179
MAST4	375449	broad.mit.edu	37	5	66460510	66460510	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:66460510G>A	uc003jut.1	+	28	5004	c.4936G>A	c.(4936-4938)GTG>ATG	p.V1646M	MAST4_uc003juw.2_Missense_Mutation_p.V1574M|MAST4_uc003jux.2_5'Flank	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	1838						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AAGTGGTGACGTGAGGGCCTC	0.562													53	72	---	---	---	---	capture	Missense_Mutation	SNP	66460510	66460510	MAST4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9240	179
TRPC7	57113	broad.mit.edu	37	5	135692416	135692416	+	Silent	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135692416G>A	uc003lbn.1	-	1	660	c.657C>T	c.(655-657)AAC>AAT	p.N219N	TRPC7_uc010jef.1_Silent_p.N211N|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Silent_p.N211N|TRPC7_uc010jei.1_Silent_p.N211N|TRPC7_uc010jej.1_Translation_Start_Site	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	220	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTTGTAGGCGTTCATGCGCG	0.607													27	34	---	---	---	---	capture	Silent	SNP	135692416	135692416	TRPC7	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16467	179
PCDHA9	9752	broad.mit.edu	37	5	140229393	140229393	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140229393C>T	uc003lhu.2	+	1	2037	c.1313C>T	c.(1312-1314)ACG>ATG	p.T438M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.T438M	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	438	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTGGGCCACGGCCAGGGTG	0.657													82	108	---	---	---	---	capture	Missense_Mutation	SNP	140229393	140229393	PCDHA9	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11434	179
RUNX2	860	broad.mit.edu	37	6	45390685	45390685	+	Silent	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:45390685G>A	uc011dvx.1	+	3	624	c.414G>A	c.(412-414)GTG>GTA	p.V138V	RUNX2_uc011dvy.1_Silent_p.V138V|RUNX2_uc003oxt.2_Silent_p.V124V	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a	138	Runt.				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						CCCTGCCCGTGGCCTTCAAGG	0.577													4	44	---	---	---	---	capture	Silent	SNP	45390685	45390685	RUNX2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	13640	179
DBNL	28988	broad.mit.edu	37	7	44100419	44100419	+	Silent	SNP	G	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44100419G>T	uc003tjp.3	+	13	1295	c.1197G>T	c.(1195-1197)ACG>ACT	p.T399T	DBNL_uc003tjo.3_Silent_p.T400T|DBNL_uc003tjr.3_Silent_p.T272T|DBNL_uc003tjq.3_Silent_p.T408T|DBNL_uc011kbm.1_Silent_p.T375T|DBNL_uc011kbn.1_Silent_p.T296T|DBNL_uc011kbo.1_Silent_p.T300T|DBNL_uc011kbp.1_Silent_p.T351T|DBNL_uc011kbq.1_Silent_p.T324T|DBNL_uc011kbr.1_Silent_p.T348T|DBNL_uc011kbs.1_Silent_p.T304T	NM_001014436	NP_001014436	Q9UJU6	DBNL_HUMAN	drebrin-like isoform b	399	SH3.				activation of JUN kinase activity|cellular component disassembly involved in apoptosis|endocytosis|Rac protein signal transduction	cell cortex|cytoskeleton|cytosol|lamellipodium	actin binding|enzyme activator activity|identical protein binding			skin(1)	1						ACCTCATCACGGGCATCGAGG	0.587													3	65	---	---	---	---	capture	Silent	SNP	44100419	44100419	DBNL	7	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	4214	179
POM121L12	285877	broad.mit.edu	37	7	53103950	53103950	+	Silent	SNP	T	C	C			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103950T>C	uc003tpz.2	+	1	602	c.586T>C	c.(586-588)TTG>CTG	p.L196L		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	196											0						CGACGGGCCGTTGTGGTTCGA	0.607													47	108	---	---	---	---	capture	Silent	SNP	53103950	53103950	POM121L12	7	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	12143	179
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			478	448	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	179
ADAM22	53616	broad.mit.edu	37	7	87760639	87760639	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87760639C>T	uc003ujn.2	+	11	960	c.881C>T	c.(880-882)GCG>GTG	p.A294V	ADAM22_uc003ujj.1_Missense_Mutation_p.A294V|ADAM22_uc003ujk.1_Missense_Mutation_p.A294V|ADAM22_uc003ujl.1_Missense_Mutation_p.A294V|ADAM22_uc003ujm.2_Missense_Mutation_p.A294V|ADAM22_uc003ujo.2_Missense_Mutation_p.A294V|ADAM22_uc003ujp.1_Missense_Mutation_p.A346V	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1	294	Peptidase M12B.|Extracellular (Potential).				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			GAAACCTGGGCGACTGACAAC	0.358													48	119	---	---	---	---	capture	Missense_Mutation	SNP	87760639	87760639	ADAM22	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	244	179
EPHB4	2050	broad.mit.edu	37	7	100404060	100404060	+	Nonsense_Mutation	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100404060C>T	uc003uwn.1	-	14	2957	c.2466G>A	c.(2464-2466)TGG>TGA	p.W822*	EPHB4_uc003uwm.1_Nonsense_Mutation_p.W729*|EPHB4_uc010lhj.1_Nonsense_Mutation_p.W822*	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor	822	Cytoplasmic (Potential).|Protein kinase.				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGCTCATGTCCCAGTACGGCC	0.562													51	135	---	---	---	---	capture	Nonsense_Mutation	SNP	100404060	100404060	EPHB4	7	C	T	T	T	1	0	0	0	0	0	1	0	0	286	22	5	2	5132	179
TAF2	6873	broad.mit.edu	37	8	120774701	120774701	+	Missense_Mutation	SNP	T	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120774701T>G	uc003you.2	-	19	2782	c.2512A>C	c.(2512-2514)AAT>CAT	p.N838H		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	838					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTTTCCATATTCAAAAATCTG	0.313													16	82	---	---	---	---	capture	Missense_Mutation	SNP	120774701	120774701	TAF2	8	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	15412	179
FLJ43860	389690	broad.mit.edu	37	8	142505515	142505515	+	Missense_Mutation	SNP	T	C	C			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142505515T>C	uc003ywi.2	-	3	412	c.331A>G	c.(331-333)AAG>GAG	p.K111E	FLJ43860_uc011ljs.1_5'Flank|FLJ43860_uc010meu.1_5'Flank	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	111							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			TTCTTGATCTTCTTGATGATG	0.527													40	107	---	---	---	---	capture	Missense_Mutation	SNP	142505515	142505515	FLJ43860	8	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	5874	179
PLEC	5339	broad.mit.edu	37	8	144993831	144993831	+	Silent	SNP	C	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144993831C>T	uc003zaf.1	-	32	10739	c.10569G>A	c.(10567-10569)GCG>GCA	p.A3523A	PLEC_uc003zab.1_Silent_p.A3386A|PLEC_uc003zac.1_Silent_p.A3390A|PLEC_uc003zad.2_Silent_p.A3386A|PLEC_uc003zae.1_Silent_p.A3354A|PLEC_uc003zag.1_Silent_p.A3364A|PLEC_uc003zah.2_Silent_p.A3372A|PLEC_uc003zaj.2_Silent_p.A3413A	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3523	Plectin 13.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CCAGCAGGAGCGCAGCCGTTG	0.692													7	9	---	---	---	---	capture	Silent	SNP	144993831	144993831	PLEC	8	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11955	179
FBXL6	26233	broad.mit.edu	37	8	145581939	145581939	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145581939G>A	uc003zcb.2	-	1	194	c.169C>T	c.(169-171)CCC>TCC	p.P57S	C8ORFK29_uc003zby.3_5'Flank|FBXL6_uc003zbz.2_5'Flank|FBXL6_uc003zca.2_Missense_Mutation_p.P57S|FBXL6_uc010mfx.2_5'UTR|GPR172A_uc003zcc.1_5'Flank|GPR172A_uc003zcd.1_5'Flank|GPR172A_uc003zce.1_5'Flank|GPR172A_uc010mfy.1_5'Flank|GPR172A_uc003zcf.1_5'Flank|GPR172A_uc011llc.1_5'Flank	NM_012162	NP_036294	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6 isoform	57	F-box.				proteolysis		ubiquitin-protein ligase activity			ovary(1)|lung(1)	2	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			tgtgcgcggggccgggcgggg	0.413													2	3	---	---	---	---	capture	Missense_Mutation	SNP	145581939	145581939	FBXL6	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5669	179
DMRT3	58524	broad.mit.edu	37	9	977245	977245	+	Missense_Mutation	SNP	A	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:977245A>G	uc003zgw.1	+	1	282	c.244A>G	c.(244-246)AGC>GGC	p.S82G		NM_021240	NP_067063	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor	82					cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(2)|central_nervous_system(1)	3		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		GGCCAACGAGAGCTTGGAGAG	0.483													13	20	---	---	---	---	capture	Missense_Mutation	SNP	977245	977245	DMRT3	9	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	4545	179
CACNA1B	774	broad.mit.edu	37	9	141014620	141014620	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:141014620G>A	uc004cog.2	+	44	6179	c.6034G>A	c.(6034-6036)GTC>ATC	p.V2012I	CACNA1B_uc004coi.2_Missense_Mutation_p.V1224I	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	2012	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	CCCACAGCCCGTCACAGATGC	0.672													6	5	---	---	---	---	capture	Missense_Mutation	SNP	141014620	141014620	CACNA1B	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2515	179
EFNB1	1947	broad.mit.edu	37	X	68058542	68058542	+	Missense_Mutation	SNP	C	G	G			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:68058542C>G	uc004dxd.3	+	2	991	c.211C>G	c.(211-213)CGG>GGG	p.R71G	EFNB1_uc004dxe.2_Missense_Mutation_p.R71G	NM_004429	NP_004420	P98172	EFNB1_HUMAN	ephrin-B1 precursor	71	Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to plasma membrane|soluble fraction|synapse	ephrin receptor binding				0						AGAAGCAGGGCGGCCCTATGA	0.572													2	20	---	---	---	---	capture	Missense_Mutation	SNP	68058542	68058542	EFNB1	23	C	G	G	G	1	0	0	0	0	1	0	0	0	347	27	4	4	4910	179
SPEN	23013	broad.mit.edu	37	1	16255142	16255143	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16255142_16255143delGA	uc001axk.1	+	11	2611_2612	c.2407_2408delGA	c.(2407-2409)GAGfs	p.E803fs	SPEN_uc010obp.1_Frame_Shift_Del_p.E762fs	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	803	Arg-rich.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGAGAGAGTGGAGAGAGAGAGA	0.431													8	216	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	16255142	16255143	SPEN	1	GA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	14930	179
ADC	113451	broad.mit.edu	37	1	33583680	33583681	+	Frame_Shift_Ins	INS	-	C	C			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33583680_33583681insC	uc001bwr.2	+	11	1794_1795	c.1207_1208insC	c.(1207-1209)GCCfs	p.A403fs	ADC_uc001bws.2_Frame_Shift_Ins_p.A403fs|ADC_uc009vue.2_Frame_Shift_Ins_p.A403fs|ADC_uc001bwt.1_Frame_Shift_Ins_p.A308fs|ADC_uc001bwu.2_Frame_Shift_Ins_p.A308fs|ADC_uc001bwv.2_Frame_Shift_Ins_p.A308fs|ADC_uc001bww.2_Frame_Shift_Ins_p.A308fs|ADC_uc001bwx.1_Frame_Shift_Ins_p.A380fs|ADC_uc009vug.2_Frame_Shift_Ins_p.A423fs	NM_052998	NP_443724	Q96A70	ADC_HUMAN	ODC antizyme inhibitor-2	403					polyamine biosynthetic process|spermatogenesis	cytosol	arginine decarboxylase activity			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)|Pyridoxal Phosphate(DB00114)	GGGGACCCAGGCCTGCCACATC	0.614													8	186	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	33583680	33583681	ADC	1	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	287	179
CACNA1E	777	broad.mit.edu	37	1	181680102	181680103	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:181680102_181680103delAG	uc001gow.2	+	8	1233_1234	c.1068_1069delAG	c.(1066-1071)AAAGAGfs	p.K356fs	CACNA1E_uc009wxs.2_Frame_Shift_Del_p.K263fs	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	356_357	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						AATTTGCCAAAGAGAGAGAGAG	0.510													7	211	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	181680102	181680103	CACNA1E	1	AG	-	-	-	1	0	1	0	1	0	0	0	0	37	3	5	5	2518	179
WDR62	284403	broad.mit.edu	37	19	36583666	36583668	+	In_Frame_Del	DEL	GCA	-	-			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36583666_36583668delGCA	uc002odc.2	+	19	2377_2379	c.2286_2288delGCA	c.(2284-2289)CGGCAG>CGG	p.Q766del	WDR62_uc002odd.2_In_Frame_Del_p.Q766del	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2	766					cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TTGACCACCGGCAGCAGCAGCAG	0.567													7	273	---	---	---	---	capture_indel	In_Frame_Del	DEL	36583666	36583668	WDR62	19	GCA	-	-	-	1	0	1	0	1	0	0	0	0	535	42	5	5	17194	179
UGDH	7358	broad.mit.edu	37	4	39515752	39515753	+	Frame_Shift_Ins	INS	-	A	A			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39515752_39515753insA	uc003guk.1	-	3	530_531	c.214_215insT	c.(214-216)TCTfs	p.S72fs	UGDH_uc011byp.1_5'UTR|UGDH_uc003gul.1_Frame_Shift_Ins_p.S72fs	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase	72					glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	AATATTGGTAGAAAAAAAAAGA	0.297													7	218	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	39515752	39515753	UGDH	4	-	A	A	A	1	0	1	1	0	0	0	0	0	429	33	5	5	16822	179
LRRTM2	26045	broad.mit.edu	37	5	138209080	138209081	+	Frame_Shift_Ins	INS	-	T	T			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:138209080_138209081insT	uc011cyz.1	-	2	1626_1627	c.1169_1170insA	c.(1168-1170)TACfs	p.Y390fs	CTNNA1_uc003ldh.2_Intron|CTNNA1_uc011cyx.1_Intron|CTNNA1_uc011cyy.1_Intron|CTNNA1_uc003ldi.2_Intron|CTNNA1_uc003ldj.2_Intron|LRRTM2_uc010jez.2_Intron|LRRTM2_uc011cza.1_Frame_Shift_Ins_p.Y256fs|CTNNA1_uc003ldl.2_5'Flank	NM_015564	NP_056379	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	390	Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CTCCCACATGGTAACTTGATGA	0.431													92	150	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	138209080	138209081	LRRTM2	5	-	T	T	T	1	0	1	1	0	0	0	0	0	568	44	5	5	8955	179
MUC17	140453	broad.mit.edu	37	7	100684307	100684308	+	In_Frame_Ins	INS	-	CTC	CTC			TCGA-26-1439-01	TCGA-26-1439-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100684307_100684308insCTC	uc003uxp.1	+	3	9663_9664	c.9610_9611insCTC	c.(9610-9612)TCT>TCTCCT	p.3204_3205insP	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3204_3205	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|52.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AGCCACTTCATCTACAACTGCT	0.500													9	817	---	---	---	---	capture_indel	In_Frame_Ins	INS	100684307	100684308	MUC17	7	-	CTC	CTC	CTC	1	0	1	1	0	0	0	0	0	650	50	5	5	9884	179
