Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TIE1	7075	broad.mit.edu	37	1	43778133	43778133	+	Silent	SNP	C	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43778133C>T	uc001ciu.2	+	12	1867	c.1788C>T	c.(1786-1788)AAC>AAT	p.N596N	TIE1_uc010okd.1_Silent_p.N596N|TIE1_uc010oke.1_Silent_p.N551N|TIE1_uc009vwq.2_Silent_p.N552N|TIE1_uc010okf.1_Silent_p.N241N|TIE1_uc010okg.1_Silent_p.N241N	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	596	Fibronectin type-III 2.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGCGGGAGAACGTCTCATCCC	0.697													15	24	---	---	---	---	capture	Silent	SNP	43778133	43778133	TIE1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15778	180
DNAJB4	11080	broad.mit.edu	37	1	78478954	78478954	+	Missense_Mutation	SNP	G	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78478954G>C	uc001dij.2	+	2	590	c.431G>C	c.(430-432)AGA>ACA	p.R144T	DNAJB4_uc010orn.1_Missense_Mutation_p.R29T	NM_007034	NP_008965	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	144					protein folding|response to heat|response to unfolded protein	cytoplasm|plasma membrane	heat shock protein binding|unfolded protein binding				0						GGATATCCAAGAGACAGGAAT	0.413													10	111	---	---	---	---	capture	Missense_Mutation	SNP	78478954	78478954	DNAJB4	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	4578	180
S100A8	6279	broad.mit.edu	37	1	153362982	153362982	+	Missense_Mutation	SNP	G	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153362982G>T	uc001fbs.2	-	2	85	c.30C>A	c.(28-30)AAC>AAA	p.N10K		NM_002964	NP_002955	P05109	S10A8_HUMAN	S100 calcium-binding protein A8	10					chemotaxis	cytoplasm|cytoskeleton|plasma membrane	calcium ion binding|protein binding				0	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGATGATAGAGTTCAAGGCTT	0.502													5	232	---	---	---	---	capture	Missense_Mutation	SNP	153362982	153362982	S100A8	1	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	13678	180
C1orf14	81626	broad.mit.edu	37	1	182920519	182920519	+	Silent	SNP	A	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:182920519A>T	uc001gpu.2	-	2	774	c.489T>A	c.(487-489)ACT>ACA	p.T163T	C1orf14_uc001gpv.2_Silent_p.T44T|C1orf14_uc010pnz.1_Silent_p.T21T|C1orf14_uc001gpw.2_5'UTR	NM_030933	NP_112195	Q9BZQ2	SHP1L_HUMAN	chromosome 1 open reading frame 14	235											0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)		CACTGGGATTAGTCTTCCAGA	0.318													24	37	---	---	---	---	capture	Silent	SNP	182920519	182920519	C1orf14	1	A	T	T	T	1	0	0	0	0	0	0	0	1	184	15	4	4	1982	180
CFHR4	10877	broad.mit.edu	37	1	196887345	196887345	+	Missense_Mutation	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196887345T>C	uc001gto.2	+	6	874	c.805T>C	c.(805-807)TGT>CGT	p.C269R	CFHR4_uc009wyy.2_Missense_Mutation_p.C515R|CFHR4_uc001gtp.2_Missense_Mutation_p.C516R	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	269	Sushi 5.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						TTCAGATCCATGTATAATAAC	0.259													7	7	---	---	---	---	capture	Missense_Mutation	SNP	196887345	196887345	CFHR4	1	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	3253	180
CACNA1S	779	broad.mit.edu	37	1	201042718	201042718	+	Missense_Mutation	SNP	C	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201042718C>G	uc001gvv.2	-	15	2343	c.2116G>C	c.(2116-2118)GAG>CAG	p.E706Q		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	706	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GGTTTCTGCTCCAGCTTCTTG	0.542													17	738	---	---	---	---	capture	Missense_Mutation	SNP	201042718	201042718	CACNA1S	1	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	2523	180
USH2A	7399	broad.mit.edu	37	1	216348801	216348801	+	Missense_Mutation	SNP	G	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216348801G>C	uc001hku.1	-	21	4807	c.4420C>G	c.(4420-4422)CTG>GTG	p.L1474V	USH2A_uc001hkv.2_Missense_Mutation_p.L1474V	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1474	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCTTTAACCAGAGGTGGCCTC	0.403										HNSCC(13;0.011)			3	17	---	---	---	---	capture	Missense_Mutation	SNP	216348801	216348801	USH2A	1	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	16918	180
DLG5	9231	broad.mit.edu	37	10	79581222	79581222	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:79581222G>A	uc001jzk.2	-	15	3090	c.3020C>T	c.(3019-3021)GCG>GTG	p.A1007V	DLG5_uc001jzi.2_5'Flank|DLG5_uc001jzj.2_Intron|DLG5_uc009xru.1_RNA|DLG5_uc001jzl.3_Missense_Mutation_p.A611V	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	1007	Pro-rich.				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CAGAGGCCCCGCCCTCTTGGA	0.592													35	96	---	---	---	---	capture	Missense_Mutation	SNP	79581222	79581222	DLG5	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4516	180
CDHR1	92211	broad.mit.edu	37	10	85972090	85972090	+	Missense_Mutation	SNP	A	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:85972090A>G	uc001kcv.2	+	15	1709	c.1709A>G	c.(1708-1710)AAT>AGT	p.N570S	CDHR1_uc001kcw.2_Missense_Mutation_p.N570S|CDHR1_uc009xst.2_Missense_Mutation_p.N274S|CDHR1_uc001kcx.2_5'Flank	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	570	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						CTGGATGTCAATGACCACCCC	0.522													15	110	---	---	---	---	capture	Missense_Mutation	SNP	85972090	85972090	CDHR1	10	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	3089	180
TRPM5	29850	broad.mit.edu	37	11	2434731	2434731	+	Missense_Mutation	SNP	C	T	T	rs149949624	byFrequency	TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2434731C>T	uc001lwm.3	-	13	1987	c.1978G>A	c.(1978-1980)GTC>ATC	p.V660I	TRPM5_uc010qxl.1_Missense_Mutation_p.V660I|TRPM5_uc009ydn.2_Missense_Mutation_p.V662I	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,	660	Helical; (Potential).					integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		TTGGTATAGACGAGGGCGGGG	0.677													9	14	---	---	---	---	capture	Missense_Mutation	SNP	2434731	2434731	TRPM5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16472	180
OR52B6	340980	broad.mit.edu	37	11	5602310	5602310	+	Silent	SNP	C	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5602310C>A	uc010qzi.1	+	1	204	c.204C>A	c.(202-204)GTC>GTA	p.V68V	HBG2_uc001mak.1_Intron	NM_001005162	NP_001005162	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B,	68	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAATTTGTGTCATCCTCTCCC	0.522													6	45	---	---	---	---	capture	Silent	SNP	5602310	5602310	OR52B6	11	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	11017	180
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5656037	5656037	+	Missense_Mutation	SNP	G	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5656037G>T	uc001mbf.2	+	10	2002	c.1758G>T	c.(1756-1758)GAG>GAT	p.E586D	HBG2_uc001mak.1_Intron|TRIM34_uc001mbh.2_Missense_Mutation_p.E232D|TRIM34_uc009yeq.2_5'UTR|TRIM34_uc001mbi.2_Missense_Mutation_p.E232D|TRIM34_uc001mbj.2_Missense_Mutation_p.E232D	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite	586						intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		TGGTGAGAGAGCTCATCTCAG	0.488													4	33	---	---	---	---	capture	Missense_Mutation	SNP	5656037	5656037	TRIM6-TRIM34	11	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	16417	180
MRVI1	10335	broad.mit.edu	37	11	10673684	10673684	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:10673684G>A	uc010rcc.1	-	2	499	c.113C>T	c.(112-114)GCG>GTG	p.A38V	MRVI1_uc001miw.2_Missense_Mutation_p.A29V|MRVI1_uc010rcb.1_Missense_Mutation_p.A29V|MRVI1_uc009ygb.1_5'UTR|MRVI1_uc001mix.2_5'UTR|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Missense_Mutation_p.A38V|MRVI1_uc009ygd.1_Intron	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c	29					platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CGGAACCTCCGCTGCGTCAGC	0.647													5	10	---	---	---	---	capture	Missense_Mutation	SNP	10673684	10673684	MRVI1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9763	180
MS4A8B	83661	broad.mit.edu	37	11	60470903	60470903	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60470903C>T	uc001npv.2	+	3	475	c.272C>T	c.(271-273)GCG>GTG	p.A91V	MS4A8B_uc009yne.1_Missense_Mutation_p.A91V	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	91	Helical; (Potential).					integral to membrane	receptor activity				0						TCCATCATGGCGACGGTTCTC	0.552													41	64	---	---	---	---	capture	Missense_Mutation	SNP	60470903	60470903	MS4A8B	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9777	180
HRASLS5	117245	broad.mit.edu	37	11	63257740	63257740	+	Missense_Mutation	SNP	C	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63257740C>G	uc001nwy.2	-	2	418	c.244G>C	c.(244-246)GAA>CAA	p.E82Q	HRASLS5_uc001nwz.2_Missense_Mutation_p.E72Q|HRASLS5_uc010rmq.1_Missense_Mutation_p.E82Q|HRASLS5_uc009yos.2_RNA	NM_054108	NP_473449	Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5 isoform 1	82										ovary(1)	1						CTGCCCTGTTCTAATGTGCCC	0.498													11	438	---	---	---	---	capture	Missense_Mutation	SNP	63257740	63257740	HRASLS5	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	7276	180
PFKM	5213	broad.mit.edu	37	12	48529142	48529142	+	Silent	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48529142G>A	uc001rrc.2	+	10	1082	c.912G>A	c.(910-912)ACG>ACA	p.T304T	PFKM_uc001rra.1_5'UTR|PFKM_uc001rrb.1_Silent_p.T375T|PFKM_uc001rrd.2_5'UTR|PFKM_uc001rre.1_Silent_p.T304T|PFKM_uc001rrg.1_Intron	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle	304					fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						GGGGTGGGACGCCATCAGCCT	0.572													29	53	---	---	---	---	capture	Silent	SNP	48529142	48529142	PFKM	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11668	180
ESPL1	9700	broad.mit.edu	37	12	53663316	53663316	+	Missense_Mutation	SNP	G	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53663316G>T	uc001sck.2	+	3	681	c.590G>T	c.(589-591)CGA>CTA	p.R197L	ESPL1_uc001scj.2_5'UTR	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	197					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						ACAGCCTGTCGAGCGGTAGCT	0.517													88	446	---	---	---	---	capture	Missense_Mutation	SNP	53663316	53663316	ESPL1	12	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	5208	180
SP1	6667	broad.mit.edu	37	12	53804896	53804896	+	Missense_Mutation	SNP	A	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53804896A>T	uc001scw.2	+	6	2327	c.2230A>T	c.(2230-2232)ATT>TTT	p.I744F	SP1_uc010sog.1_Missense_Mutation_p.I737F	NM_138473	NP_612482	P08047	SP1_HUMAN	Sp1 transcription factor isoform a	744	Domain D.|VZV IE62-binding.				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(357;0.00527)		TTCAGCCCTTATTACCACCAA	0.572													14	92	---	---	---	---	capture	Missense_Mutation	SNP	53804896	53804896	SP1	12	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	14851	180
ITGA7	3679	broad.mit.edu	37	12	56087909	56087909	+	Splice_Site	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56087909T>C	uc001shh.2	-	19	2665	c.2445_splice	c.e19-1	p.G815_splice	ITGA7_uc001shg.2_Splice_Site_p.G811_splice|ITGA7_uc010sps.1_Splice_Site_p.G718_splice|ITGA7_uc009znw.2_Splice_Site_p.G58_splice|ITGA7_uc009znx.2_Splice_Site_p.G692_splice	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						ATGGCCATTCTGGCGTGGAGA	0.592													7	46	---	---	---	---	capture	Splice_Site	SNP	56087909	56087909	ITGA7	12	T	C	C	C	1	0	0	0	0	0	0	1	0	715	55	5	3	7804	180
MTERFD3	80298	broad.mit.edu	37	12	107372183	107372183	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107372183C>T	uc001tme.1	-	2	2129	c.310G>A	c.(310-312)GCA>ACA	p.A104T	MTERFD3_uc001tmf.1_Missense_Mutation_p.A104T|MTERFD3_uc001tmg.1_Missense_Mutation_p.A104T|MTERFD3_uc001tmh.1_Missense_Mutation_p.A104T	NM_025198	NP_079474	Q49AM1	MTER3_HUMAN	transcription termination factor-like protein	104					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	transcription regulatory region DNA binding				0						CAGACAATTGCTTCCGGGCAG	0.423													13	84	---	---	---	---	capture	Missense_Mutation	SNP	107372183	107372183	MTERFD3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	9831	180
EIF2B1	1967	broad.mit.edu	37	12	124116941	124116941	+	Silent	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124116941T>C	uc001ufm.2	-	2	209	c.66A>G	c.(64-66)TCA>TCG	p.S22S	GTF2H3_uc001ufo.1_5'Flank|GTF2H3_uc010tau.1_5'Flank|EIF2B1_uc001ufn.2_Silent_p.S22S|EIF2B1_uc010tat.1_Silent_p.S22S	NM_001414	NP_001405	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B,	22					cellular response to stimulus|oligodendrocyte development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex|membrane fraction|plasma membrane	protein binding|translation initiation factor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		CAGCCACTGCTGAGGCCATGT	0.398													9	180	---	---	---	---	capture	Silent	SNP	124116941	124116941	EIF2B1	12	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	4955	180
FZD10	11211	broad.mit.edu	37	12	130648643	130648643	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130648643G>A	uc001uii.2	+	1	1612	c.1156G>A	c.(1156-1158)GTG>ATG	p.V386M	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	386	Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		GGTCTGCTACGTGGGCAGCAT	0.657													4	72	---	---	---	---	capture	Missense_Mutation	SNP	130648643	130648643	FZD10	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6071	180
C13orf26	122046	broad.mit.edu	37	13	31531137	31531137	+	Missense_Mutation	SNP	C	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:31531137C>G	uc001uti.2	+	4	459	c.440C>G	c.(439-441)ACT>AGT	p.T147S		NM_152325	NP_689538	Q8N6G2	CM026_HUMAN	hypothetical protein LOC122046	147										ovary(2)|skin(1)	3		Lung SC(185;0.0281)		all cancers(112;0.0176)|Epithelial(112;0.0768)|OV - Ovarian serous cystadenocarcinoma(117;0.0852)		ATTTCCCTTACTAAGAGAGAC	0.318													10	79	---	---	---	---	capture	Missense_Mutation	SNP	31531137	31531137	C13orf26	13	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	1708	180
SLC15A1	6564	broad.mit.edu	37	13	99378425	99378425	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:99378425G>A	uc001vno.2	-	4	274	c.197C>T	c.(196-198)ACG>ATG	p.T66M	SLC15A1_uc001vnp.1_Missense_Mutation_p.T34M	NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide	66	Helical; (Potential).				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	GAGAATTGGCGTCAGGTAGCA	0.463													7	37	---	---	---	---	capture	Missense_Mutation	SNP	99378425	99378425	SLC15A1	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14291	180
CHD8	57680	broad.mit.edu	37	14	21870120	21870120	+	Missense_Mutation	SNP	G	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21870120G>C	uc001was.1	-	20	3315	c.3221C>G	c.(3220-3222)GCT>GGT	p.A1074G	CHD8_uc001war.1_Missense_Mutation_p.A970G|CHD8_uc001wav.1_Missense_Mutation_p.A516G	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1353					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		ACATGCCTTAGCAAAGGTGGA	0.353													25	126	---	---	---	---	capture	Missense_Mutation	SNP	21870120	21870120	CHD8	14	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	3297	180
NYNRIN	57523	broad.mit.edu	37	14	24878580	24878580	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24878580G>A	uc001wpf.3	+	4	1898	c.1580G>A	c.(1579-1581)GGG>GAG	p.G527E		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	527					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						GTGGCTCAAGGGGGGCTGACA	0.567													5	54	---	---	---	---	capture	Missense_Mutation	SNP	24878580	24878580	NYNRIN	14	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10701	180
FRMD6	122786	broad.mit.edu	37	14	52194629	52194629	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:52194629G>A	uc001wzd.2	+	14	2036	c.1751G>A	c.(1750-1752)TGC>TAC	p.C584Y	FRMD6_uc001wzb.2_Missense_Mutation_p.C576Y|FRMD6_uc001wzc.2_Missense_Mutation_p.C576Y|FRMD6_uc001wze.2_Missense_Mutation_p.C507Y|FRMD6_uc001wzf.2_Missense_Mutation_p.C277Y|FRMD6_uc001wzg.2_Missense_Mutation_p.C226Y	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6	584						cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					GGCCTCTATTGCAACAGTTGC	0.468													4	15	---	---	---	---	capture	Missense_Mutation	SNP	52194629	52194629	FRMD6	14	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	5997	180
SYNE2	23224	broad.mit.edu	37	14	64540771	64540771	+	Silent	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64540771T>C	uc001xgm.2	+	53	11013	c.10783T>C	c.(10783-10785)TTG>CTG	p.L3595L	SYNE2_uc001xgl.2_Silent_p.L3595L|SYNE2_uc010apy.2_5'Flank|SYNE2_uc010apw.1_Silent_p.L301L|SYNE2_uc010apx.1_5'UTR	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3595	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GATAATTGCTTTGAAGAATTT	0.358													3	120	---	---	---	---	capture	Silent	SNP	64540771	64540771	SYNE2	14	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	15334	180
TUBGCP5	114791	broad.mit.edu	37	15	22835924	22835924	+	Missense_Mutation	SNP	G	T	T	rs143778036		TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:22835924G>T	uc001yur.3	+	2	285	c.155G>T	c.(154-156)CGT>CTT	p.R52L	TUBGCP5_uc001yuq.2_Missense_Mutation_p.R52L	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	52					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		AGATTTCATCGTTTCTTGGAT	0.368													10	127	---	---	---	---	capture	Missense_Mutation	SNP	22835924	22835924	TUBGCP5	15	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	16651	180
KCTD19	146212	broad.mit.edu	37	16	67331487	67331487	+	Missense_Mutation	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67331487T>C	uc002esu.2	-	7	1117	c.1066A>G	c.(1066-1068)AGG>GGG	p.R356G	KCTD19_uc002est.2_Missense_Mutation_p.R128G|KCTD19_uc010vjj.1_Missense_Mutation_p.R99G	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN	potassium channel tetramerisation domain	356						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GTGATGTCCCTTTTGTCTAGG	0.517													3	67	---	---	---	---	capture	Missense_Mutation	SNP	67331487	67331487	KCTD19	16	T	C	C	C	1	0	0	0	0	1	0	0	0	726	56	3	3	8028	180
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	A	A	rs121913343		TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577121G>A	uc002gim.2	-	8	1011	c.817C>T	c.(817-819)CGT>TGT	p.R273C	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141C|TP53_uc010cng.1_Missense_Mutation_p.R141C|TP53_uc002gii.1_Missense_Mutation_p.R141C|TP53_uc010cnh.1_Missense_Mutation_p.R273C|TP53_uc010cni.1_Missense_Mutation_p.R273C|TP53_uc002gij.2_Missense_Mutation_p.R273C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(467)|p.R273C(396)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCACAAACACGCACCTCAAAG	0.542	R273C(SH10TC_STOMACH)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(RH30_SOFT_TISSUE)|R273C(PANC0213_PANCREAS)|R273C(SJRH30_SOFT_TISSUE)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(TT2609C02_THYROID)|R273C(MFE319_ENDOMETRIUM)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(NCIH1048_LUNG)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			16	11	---	---	---	---	capture	Missense_Mutation	SNP	7577121	7577121	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16264	180
DNAH9	1770	broad.mit.edu	37	17	11696846	11696846	+	Silent	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11696846T>C	uc002gne.2	+	42	8156	c.8088T>C	c.(8086-8088)TGT>TGC	p.C2696C	DNAH9_uc010coo.2_Silent_p.C1990C	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2696					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGTGGAATGTGTGAAATCCA	0.388													34	27	---	---	---	---	capture	Silent	SNP	11696846	11696846	DNAH9	17	T	C	C	C	1	0	0	0	0	0	0	0	1	764	59	3	3	4564	180
BPTF	2186	broad.mit.edu	37	17	65862640	65862640	+	Silent	SNP	A	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65862640A>G	uc002jgf.2	+	3	1558	c.1497A>G	c.(1495-1497)CAA>CAG	p.Q499Q	BPTF_uc002jge.2_Silent_p.Q499Q|BPTF_uc010wqm.1_Silent_p.Q499Q	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	499					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CAAAGGTCCAACTTGCAGAAT	0.343													3	63	---	---	---	---	capture	Silent	SNP	65862640	65862640	BPTF	17	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	1483	180
MIB1	57534	broad.mit.edu	37	18	19321653	19321653	+	Missense_Mutation	SNP	G	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19321653G>C	uc002ktq.2	+	1	109	c.109G>C	c.(109-111)GGC>CGC	p.G37R	MIB1_uc002ktp.2_Intron	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1	37	MIB/HERC2 1.				Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			GGGCCATGTGGGCACCGTCCG	0.677													4	17	---	---	---	---	capture	Missense_Mutation	SNP	19321653	19321653	MIB1	18	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	9478	180
SOCS6	9306	broad.mit.edu	37	18	67992496	67992496	+	Missense_Mutation	SNP	A	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:67992496A>G	uc002lkr.1	+	2	908	c.592A>G	c.(592-594)AAT>GAT	p.N198D	SOCS6_uc010dqq.2_Missense_Mutation_p.N198D	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	198					defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GGCTTCTCATAATGGAGACCT	0.512													11	74	---	---	---	---	capture	Missense_Mutation	SNP	67992496	67992496	SOCS6	18	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	14810	180
LMNB2	84823	broad.mit.edu	37	19	2444529	2444529	+	Missense_Mutation	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2444529T>C	uc002lvy.2	-	2	301	c.214A>G	c.(214-216)ATC>GTC	p.I72V	LMNB2_uc002lwa.1_Missense_Mutation_p.I92V	NM_032737	NP_116126	Q03252	LMNB2_HUMAN	lamin B2	72	Rod.|Linker 1.					nuclear inner membrane	structural molecule activity			large_intestine(1)|ovary(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCGCCTTGATGCCACTCACC	0.642													11	45	---	---	---	---	capture	Missense_Mutation	SNP	2444529	2444529	LMNB2	19	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	8770	180
PGLS	25796	broad.mit.edu	37	19	17626983	17626983	+	Missense_Mutation	SNP	C	T	T	rs143569199		TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17626983C>T	uc002ngw.2	+	2	340	c.290C>T	c.(289-291)ACG>ATG	p.T97M		NM_012088	NP_036220	O95336	6PGL_HUMAN	6-phosphogluconolactonase	97						cytosol	6-phosphogluconolactonase activity				0						TGGCTGCAGACGCATCTTCTC	0.433													18	25	---	---	---	---	capture	Missense_Mutation	SNP	17626983	17626983	PGLS	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11695	180
ZNF233	353355	broad.mit.edu	37	19	44778066	44778066	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44778066G>A	uc002oyz.1	+	5	1380	c.1253G>A	c.(1252-1254)AGA>AAA	p.R418K	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF233_uc002oyy.1_Missense_Mutation_p.R233K	NM_181756	NP_861421	A6NK53	ZN233_HUMAN	zinc finger protein 233	418	C2H2-type 5; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2		Prostate(69;0.0435)|all_neural(266;0.226)				GCCCATCAGAGAGGTCACTCT	0.418													9	54	---	---	---	---	capture	Missense_Mutation	SNP	44778066	44778066	ZNF233	19	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	17666	180
PEG3	5178	broad.mit.edu	37	19	57328400	57328400	+	Silent	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57328400G>A	uc002qnu.2	-	7	1761	c.1410C>T	c.(1408-1410)CAC>CAT	p.H470H	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Silent_p.H441H|PEG3_uc002qnv.2_Silent_p.H470H|PEG3_uc002qnw.2_Silent_p.H346H|PEG3_uc002qnx.2_Silent_p.H344H|PEG3_uc010etr.2_Silent_p.H470H	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	470	C2H2-type 1.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GCATGATCTGGTGCTCAACAA	0.458													59	27	---	---	---	---	capture	Silent	SNP	57328400	57328400	PEG3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	11623	180
TTC27	55622	broad.mit.edu	37	2	33036261	33036261	+	Missense_Mutation	SNP	G	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:33036261G>C	uc002rom.2	+	17	2400	c.2169G>C	c.(2167-2169)CAG>CAC	p.Q723H	TTC27_uc010ymx.1_Missense_Mutation_p.Q673H|TTC27_uc002ron.2_RNA	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	723							protein binding			central_nervous_system(1)	1						GAAATGGGCAGAGTGAAAAGC	0.428													4	21	---	---	---	---	capture	Missense_Mutation	SNP	33036261	33036261	TTC27	2	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	16577	180
INO80B	83444	broad.mit.edu	37	2	74684891	74684891	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74684891G>A	uc002slg.2	+	5	1016	c.971G>A	c.(970-972)CGC>CAC	p.R324H	INO80B_uc002slf.1_3'UTR|INO80B_uc010yrr.1_Missense_Mutation_p.R296H|WBP1_uc002slh.1_Intron|INO80B_uc002sli.1_RNA|INO80B_uc010yrs.1_Missense_Mutation_p.R342H|WBP1_uc002slj.1_5'Flank|WBP1_uc002slk.1_5'Flank|WBP1_uc002sll.1_5'Flank	NM_031288	NP_112578	Q9C086	IN80B_HUMAN	high mobility group AT-hook 1-like 4	324	HIT-type.				DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|nucleolus	metal ion binding|protein binding			pancreas(1)	1						GCTTGCTCCCGCACAGGCCAG	0.697													3	44	---	---	---	---	capture	Missense_Mutation	SNP	74684891	74684891	INO80B	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7670	180
KIF5C	3800	broad.mit.edu	37	2	149857246	149857246	+	Missense_Mutation	SNP	G	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:149857246G>C	uc010zbu.1	+	21	2691	c.2323G>C	c.(2323-2325)GAT>CAT	p.D775H	KIF5C_uc002tws.1_RNA|KIF5C_uc002twu.1_Missense_Mutation_p.D57H	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	775					microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		ATTGCTCAACGATAAAAGGGA	0.423													32	66	---	---	---	---	capture	Missense_Mutation	SNP	149857246	149857246	KIF5C	2	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	8229	180
COQ10B	80219	broad.mit.edu	37	2	198318368	198318368	+	Silent	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198318368G>A	uc002uuh.1	+	1	138	c.84G>A	c.(82-84)CAG>CAA	p.Q28Q	COQ10B_uc010fsl.1_5'Flank	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor	28						mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCGGGGCGCAGGCGCCCGTGC	0.627													26	61	---	---	---	---	capture	Silent	SNP	198318368	198318368	COQ10B	2	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	3709	180
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma 								22	27	---	---	---	---	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	180
ACOT8	10005	broad.mit.edu	37	20	44477248	44477248	+	Missense_Mutation	SNP	C	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44477248C>T	uc002xqa.1	-	3	410	c.329G>A	c.(328-330)CGC>CAC	p.R110H	ACOT8_uc010zxe.1_Missense_Mutation_p.R110H|ACOT8_uc002xqc.1_Missense_Mutation_p.R57H|ACOT8_uc010zxf.1_Intron	NM_005469	NP_005460	O14734	ACOT8_HUMAN	peroxisomal acyl-CoA thioesterase 1 isoform a	110					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|interspecies interaction between organisms|peroxisome organization	peroxisomal matrix	acetyl-CoA hydrolase activity|acyl-CoA thioesterase activity|carboxylesterase activity|choloyl-CoA hydrolase activity|protein binding			skin(1)	1		Myeloproliferative disorder(115;0.0122)				CTTCACAGAGCGCACCGAGAA	0.627													22	115	---	---	---	---	capture	Missense_Mutation	SNP	44477248	44477248	ACOT8	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	156	180
SMARCC1	6599	broad.mit.edu	37	3	47755965	47755965	+	Silent	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47755965G>A	uc003crq.2	-	8	850	c.732C>T	c.(730-732)GTC>GTT	p.V244V	SMARCC1_uc011bbd.1_Silent_p.V135V	NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated	244					chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		CATTACTATGGACCCAAGTAT	0.274													7	53	---	---	---	---	capture	Silent	SNP	47755965	47755965	SMARCC1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	14667	180
ITIH1	3697	broad.mit.edu	37	3	52822082	52822082	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52822082G>A	uc003dfs.2	+	17	2029	c.2005G>A	c.(2005-2007)GTG>ATG	p.V669M	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Missense_Mutation_p.V270M|ITIH1_uc010hmo.1_Missense_Mutation_p.V223M|ITIH1_uc003dfu.2_Missense_Mutation_p.V35M	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	669	Hyaluronan-binding.				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		AGTGACCGGCGGTGAGTCCTT	0.607													20	87	---	---	---	---	capture	Missense_Mutation	SNP	52822082	52822082	ITIH1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7826	180
DZIP1L	199221	broad.mit.edu	37	3	137799416	137799416	+	Silent	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137799416T>C	uc003erq.2	-	10	1644	c.1281A>G	c.(1279-1281)CCA>CCG	p.P427P	DZIP1L_uc003err.1_Silent_p.P427P	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like	427						intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						CACCTTCCTCTGGAGAGTCCT	0.522													33	37	---	---	---	---	capture	Silent	SNP	137799416	137799416	DZIP1L	3	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	4819	180
ZBTB38	253461	broad.mit.edu	37	3	141162963	141162963	+	Missense_Mutation	SNP	A	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:141162963A>G	uc003etw.2	+	8	2715	c.1733A>G	c.(1732-1734)TAT>TGT	p.Y578C	ZBTB38_uc010hun.2_Missense_Mutation_p.Y575C|ZBTB38_uc010huo.2_Missense_Mutation_p.Y578C|ZBTB38_uc003ety.2_Missense_Mutation_p.Y578C|ZBTB38_uc010hup.2_Missense_Mutation_p.Y579C	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	578					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AGAGCCCCTTATAAGAGCTAC	0.408													10	75	---	---	---	---	capture	Missense_Mutation	SNP	141162963	141162963	ZBTB38	3	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	17419	180
TRIML1	339976	broad.mit.edu	37	4	189068016	189068016	+	Silent	SNP	C	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189068016C>T	uc003izm.1	+	6	1012	c.897C>T	c.(895-897)CTC>CTT	p.L299L	TRIML1_uc003izn.1_Silent_p.L23L	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	299	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		ATGCCTATCTCGTGTTGTCGG	0.512													16	193	---	---	---	---	capture	Silent	SNP	189068016	189068016	TRIML1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	16433	180
CNOT8	9337	broad.mit.edu	37	5	154250226	154250226	+	Missense_Mutation	SNP	A	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154250226A>G	uc003lvu.2	+	5	796	c.317A>G	c.(316-318)GAC>GGC	p.D106G	CNOT8_uc011ddf.1_5'UTR|CNOT8_uc011ddg.1_5'UTR|CNOT8_uc011ddh.1_Intron|CNOT8_uc003lvv.2_Missense_Mutation_p.D106G|CNOT8_uc010jig.2_5'UTR|CNOT8_uc010jif.2_5'UTR|CNOT8_uc003lvw.2_Missense_Mutation_p.D106G|CNOT8_uc011ddi.1_5'UTR|CNOT8_uc011ddj.1_Intron	NM_004779	NP_004770	Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8	106					negative regulation of cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTTAGAGAGGACATGTACTCC	0.393								Direct_reversal_of_damage					3	81	---	---	---	---	capture	Missense_Mutation	SNP	154250226	154250226	CNOT8	5	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	3590	180
HIST1H1T	3010	broad.mit.edu	37	6	26107726	26107726	+	Missense_Mutation	SNP	T	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26107726T>A	uc003ngj.2	-	1	639	c.596A>T	c.(595-597)AAT>ATT	p.N199I		NM_005323	NP_005314	P22492	H1T_HUMAN	histone cluster 1, H1t	199					cell differentiation|multicellular organismal development|nucleosome assembly|spermatogenesis	nucleosome	DNA binding			ovary(2)	2						CTTTCTAACATTAACTTCATG	0.448													11	135	---	---	---	---	capture	Missense_Mutation	SNP	26107726	26107726	HIST1H1T	6	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	7052	180
NCOA7	135112	broad.mit.edu	37	6	126210501	126210501	+	Missense_Mutation	SNP	A	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:126210501A>T	uc010kes.2	+	11	1750	c.1301A>T	c.(1300-1302)GAC>GTC	p.D434V	NCOA7_uc003qae.3_Missense_Mutation_p.D434V|NCOA7_uc003qah.2_Missense_Mutation_p.D423V|NCOA7_uc003qai.2_Missense_Mutation_p.D434V|NCOA7_uc010ket.2_Missense_Mutation_p.D319V	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1	434					cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		CACAAAAAAGACACCTTGAAG	0.423													5	21	---	---	---	---	capture	Missense_Mutation	SNP	126210501	126210501	NCOA7	6	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	10141	180
TNRC18	84629	broad.mit.edu	37	7	5354614	5354614	+	Splice_Site	SNP	C	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5354614C>A	uc003soi.3	-	26	7376	c.7027_splice	c.e26+1	p.D2343_splice		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGCCAACCTACCACCCTTGGC	0.672													6	8	---	---	---	---	capture	Splice_Site	SNP	5354614	5354614	TNRC18	7	C	A	A	A	1	0	0	0	0	0	0	1	0	234	18	5	4	16222	180
OGDH	4967	broad.mit.edu	37	7	44747273	44747273	+	Silent	SNP	A	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44747273A>G	uc003tln.2	+	22	2998	c.2889A>G	c.(2887-2889)CAA>CAG	p.Q963Q	OGDH_uc011kbx.1_Silent_p.Q959Q|OGDH_uc011kby.1_Silent_p.Q813Q|OGDH_uc003tlp.2_Silent_p.Q974Q|OGDH_uc011kbz.1_Silent_p.Q758Q	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	963					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	ACAAGAACCAAGGCTACTATG	0.592													7	109	---	---	---	---	capture	Silent	SNP	44747273	44747273	OGDH	7	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	10744	180
ERLIN2	11160	broad.mit.edu	37	8	37611537	37611537	+	Silent	SNP	T	C	C			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:37611537T>C	uc003xke.3	+	12	1039	c.924T>C	c.(922-924)TCT>TCC	p.S308S		NM_007175	NP_009106	O94905	ERLN2_HUMAN	ER lipid raft associated 2 isoform 1	308	Interaction with ERLIN1.|Lumenal (Potential).				ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	protein binding				0		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TCATGGACTCTGCGGGCAGTG	0.463													8	78	---	---	---	---	capture	Silent	SNP	37611537	37611537	ERLIN2	8	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	5188	180
LAPTM4B	55353	broad.mit.edu	37	8	98863639	98863639	+	Silent	SNP	G	A	A	rs147233429		TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:98863639G>A	uc003yia.2	+	7	1047	c.891G>A	c.(889-891)CCG>CCA	p.P297P	LAPTM4B_uc010mbg.2_Silent_p.P129P	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4	350					transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			TGCTACCCCCGTATGATGATG	0.527													3	33	---	---	---	---	capture	Silent	SNP	98863639	98863639	LAPTM4B	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	8545	180
C9orf79	286234	broad.mit.edu	37	9	90499950	90499950	+	Missense_Mutation	SNP	A	G	G			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90499950A>G	uc004app.3	+	4	583	c.548A>G	c.(547-549)GAT>GGT	p.D183G	C9orf79_uc004apo.1_Intron	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	183	Pro-rich.					integral to membrane				ovary(3)	3						TGCATGCAAGATCCGTCTCCT	0.627													15	121	---	---	---	---	capture	Missense_Mutation	SNP	90499950	90499950	C9orf79	9	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	2473	180
KDM5C	8242	broad.mit.edu	37	X	53223866	53223866	+	Missense_Mutation	SNP	G	A	A			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53223866G>A	uc004drz.2	-	23	4026	c.3493C>T	c.(3493-3495)CGT>TGT	p.R1165C	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.R1098C|KDM5C_uc004dsa.2_Missense_Mutation_p.R1164C|uc004dsb.1_RNA	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	1165					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						TTGGTGCGACGCAGCTGCAGG	0.612			N|F|S		clear cell renal carcinoma								6	9	---	---	---	---	capture	Missense_Mutation	SNP	53223866	53223866	KDM5C	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8057	180
AK1	203	broad.mit.edu	37	9	130630690	130630691	+	Frame_Shift_Ins	INS	-	T	T			TCGA-26-1442-01	TCGA-26-1442-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130630690_130630691insT	uc004bsm.3	-	6	578_579	c.425_426insA	c.(424-426)AATfs	p.N142fs		NM_000476	NP_000467	P00568	KAD1_HUMAN	adenylate kinase 1	142					ATP metabolic process|nucleobase, nucleoside and nucleotide interconversion	cytosol	adenylate kinase activity|ATP binding|protein binding				0						TGGTCTCCTCATTGTCGTCCAC	0.574													16	29	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	130630690	130630691	AK1	9	-	T	T	T	1	0	1	1	0	0	0	0	0	102	8	5	5	439	180
