Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GALE	2582	broad.mit.edu	37	1	24123528	24123528	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24123528G>A	uc009vqo.1	-	6	848	c.638C>T	c.(637-639)TCC>TTC	p.S213F	GALE_uc001bhv.1_Missense_Mutation_p.S213F|GALE_uc001bhw.1_Missense_Mutation_p.S213F|GALE_uc001bhx.1_Missense_Mutation_p.S213F|GALE_uc009vqp.1_Missense_Mutation_p.S213F|GALE_uc001bhy.1_Missense_Mutation_p.S213F|GALE_uc001bhz.1_Missense_Mutation_p.S139F|GALE_uc001bia.2_Missense_Mutation_p.S5F	NM_001127621	NP_001121093	Q14376	GALE_HUMAN	UDP-galactose-4-epimerase	213					galactose catabolic process	cytosol	coenzyme binding|protein homodimerization activity|UDP-glucose 4-epimerase activity				0		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		CCTTACCTGGGAGACATAAGG	0.587													15	22	---	---	---	---	capture	Missense_Mutation	SNP	24123528	24123528	GALE	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	6142	183
MFSD2A	84879	broad.mit.edu	37	1	40431623	40431623	+	Silent	SNP	T	C	C			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40431623T>C	uc001cev.2	+	6	871	c.690T>C	c.(688-690)AAT>AAC	p.N230N	MFSD2A_uc010ojb.1_Silent_p.N180N|MFSD2A_uc001ceu.2_Silent_p.N217N|MFSD2A_uc010ojc.1_Silent_p.N61N|MFSD2A_uc009vvy.2_RNA|MFSD2A_uc001cex.2_5'Flank	NM_001136493	NP_001129965	Q8NA29	MFS2A_HUMAN	major facilitator superfamily domain containing	230					transmembrane transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)|pancreas(1)	2						AGGACCTCAATAGCTCTACAG	0.572													50	91	---	---	---	---	capture	Silent	SNP	40431623	40431623	MFSD2A	1	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	9442	183
CYP4Z1	199974	broad.mit.edu	37	1	47583502	47583502	+	Missense_Mutation	SNP	C	T	T	rs145758676		TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47583502C>T	uc001cqu.1	+	12	1417	c.1414C>T	c.(1414-1416)CGC>TGC	p.R472C		NM_178134	NP_835235	Q86W10	CP4Z1_HUMAN	cytochrome P450 4Z1	472	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1						AACTCTGCTCCGCTTCAAGCT	0.468													53	65	---	---	---	---	capture	Missense_Mutation	SNP	47583502	47583502	CYP4Z1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4154	183
ERCC6	2074	broad.mit.edu	37	10	50690803	50690803	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50690803A>G	uc001jhs.3	-	10	2253	c.2099T>C	c.(2098-2100)TTG>TCG	p.L700S	ERCC6_uc010qgr.1_Missense_Mutation_p.L70S|ERCC6_uc001jhr.3_Missense_Mutation_p.L100S	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	700					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						AAACACAGGCAACGTGCCTAA	0.483								Direct_reversal_of_damage|NER					3	93	---	---	---	---	capture	Missense_Mutation	SNP	50690803	50690803	ERCC6	10	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	5172	183
NOC3L	64318	broad.mit.edu	37	10	96099659	96099659	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96099659A>G	uc001kjq.1	-	17	1887	c.1799T>C	c.(1798-1800)GTT>GCT	p.V600A		NM_022451	NP_071896	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog	600						nuclear speck|nucleolus	binding			ovary(1)	1		Colorectal(252;0.0897)				TACAATCTCAACACCTTCATT	0.433													51	6	---	---	---	---	capture	Missense_Mutation	SNP	96099659	96099659	NOC3L	10	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	10421	183
OR4A16	81327	broad.mit.edu	37	11	55111268	55111268	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55111268G>T	uc010rie.1	+	1	592	c.592G>T	c.(592-594)GTT>TTT	p.V198F		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	198	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						ACTCACTGTGGTTGCCAATGG	0.428													155	206	---	---	---	---	capture	Missense_Mutation	SNP	55111268	55111268	OR4A16	11	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	10945	183
OR5I1	10798	broad.mit.edu	37	11	55703585	55703585	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55703585C>A	uc010ris.1	-	1	292	c.292G>T	c.(292-294)GGG>TGG	p.G98W		NM_006637	NP_006628	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AGGGCACACCCATAATAGGAA	0.428													29	42	---	---	---	---	capture	Missense_Mutation	SNP	55703585	55703585	OR5I1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	11068	183
OR8K3	219473	broad.mit.edu	37	11	56085869	56085869	+	Silent	SNP	A	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56085869A>G	uc010rjf.1	+	1	87	c.87A>G	c.(85-87)GCA>GCG	p.A29A		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	29	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					CATTATTTGCATTGTTCCTCA	0.433													6	280	---	---	---	---	capture	Silent	SNP	56085869	56085869	OR8K3	11	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	11148	183
C11orf2	738	broad.mit.edu	37	11	64876151	64876151	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64876151C>T	uc001ocr.1	+	5	1248	c.1208C>T	c.(1207-1209)GCC>GTC	p.A403V	C11orf2_uc001ocs.1_Missense_Mutation_p.A279V	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	403					lipid transport|protein transport	Golgi apparatus|integral to membrane					0						GAACGAGTGGCCCGCGAGCGC	0.761													11	4	---	---	---	---	capture	Missense_Mutation	SNP	64876151	64876151	C11orf2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1620	183
OR8D4	338662	broad.mit.edu	37	11	123777373	123777373	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123777373C>A	uc010saa.1	+	1	235	c.235C>A	c.(235-237)CCT>ACT	p.P79T		NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D,	79	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		TGTCATTACCCCTAAAATGCT	0.358													241	293	---	---	---	---	capture	Missense_Mutation	SNP	123777373	123777373	OR8D4	11	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	11137	183
VSIG2	23584	broad.mit.edu	37	11	124618351	124618351	+	Silent	SNP	G	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124618351G>A	uc001qas.2	-	6	862	c.786C>T	c.(784-786)TGC>TGT	p.C262C	VSIG2_uc001qat.2_Silent_p.C262C	NM_014312	NP_055127	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	262	Helical; (Potential).					integral to plasma membrane|membrane fraction				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		ACCTGACCAGGCAGAACGCAG	0.617													72	96	---	---	---	---	capture	Silent	SNP	124618351	124618351	VSIG2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	17106	183
CD163L1	283316	broad.mit.edu	37	12	7527492	7527492	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7527492C>A	uc001qsy.2	-	12	3055	c.3029G>T	c.(3028-3030)TGC>TTC	p.C1010F	CD163L1_uc010sge.1_Missense_Mutation_p.C1020F	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1010	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						ATTTGCGAGGCATGGAAACAG	0.463											OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	26	47	---	---	---	---	capture	Missense_Mutation	SNP	7527492	7527492	CD163L1	12	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	2939	183
SFRS2IP	9169	broad.mit.edu	37	12	46357935	46357935	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:46357935C>T	uc001rox.2	-	2	303	c.16G>A	c.(16-18)GTA>ATA	p.V6I	SFRS2IP_uc001roy.1_Missense_Mutation_p.V70I|SFRS2IP_uc009zki.1_RNA|SFRS2IP_uc001roz.2_Missense_Mutation_p.V6I	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	6					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		AGGGTACATACAGTTTTCTTC	0.279													17	36	---	---	---	---	capture	Missense_Mutation	SNP	46357935	46357935	SFRS2IP	12	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	14070	183
GRIP1	23426	broad.mit.edu	37	12	66773075	66773075	+	Missense_Mutation	SNP	C	T	T	rs145115262	by1000genomes	TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66773075C>T	uc001stk.2	-	19	2691	c.2450G>A	c.(2449-2451)CGG>CAG	p.R817Q	GRIP1_uc010sta.1_Missense_Mutation_p.R761Q|GRIP1_uc001stj.2_Missense_Mutation_p.R599Q|GRIP1_uc001stl.1_Missense_Mutation_p.R709Q|GRIP1_uc001stm.2_Missense_Mutation_p.R817Q	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	869					androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GGCTGTGGACCGGTCCCAGTC	0.517													134	193	---	---	---	---	capture	Missense_Mutation	SNP	66773075	66773075	GRIP1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6720	183
LRRC43	254050	broad.mit.edu	37	12	122672375	122672375	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122672375C>T	uc009zxm.2	+	4	675	c.650C>T	c.(649-651)ACC>ATC	p.T217I	LRRC43_uc001ubw.3_Missense_Mutation_p.T32I|LRRC43_uc009zxn.2_5'Flank|LRRC43_uc009zxl.1_RNA	NM_001098519	NP_001091989	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43 isoform 1	217											0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		CTCTACGTCACCGCTAATCAC	0.562													60	103	---	---	---	---	capture	Missense_Mutation	SNP	122672375	122672375	LRRC43	12	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	8916	183
NBEA	26960	broad.mit.edu	37	13	35685025	35685025	+	Missense_Mutation	SNP	G	C	C			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:35685025G>C	uc001uvb.2	+	14	2118	c.1912G>C	c.(1912-1914)GGA>CGA	p.G638R		NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	638						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ACGCAGAGTAGGAACAGTATT	0.368													43	69	---	---	---	---	capture	Missense_Mutation	SNP	35685025	35685025	NBEA	13	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	10094	183
OR4K2	390431	broad.mit.edu	37	14	20344857	20344857	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20344857T>C	uc001vwh.1	+	1	431	c.431T>C	c.(430-432)CTC>CCC	p.L144P		NM_001005501	NP_001005501	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K,	144	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTGTTGCTCTCGTGGTGGCT	0.463													175	277	---	---	---	---	capture	Missense_Mutation	SNP	20344857	20344857	OR4K2	14	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10976	183
PCNX	22990	broad.mit.edu	37	14	71540387	71540387	+	Nonsense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:71540387C>T	uc001xmo.2	+	27	5424	c.4978C>T	c.(4978-4980)CGA>TGA	p.R1660*	PCNX_uc010are.1_Nonsense_Mutation_p.R1549*|PCNX_uc010arf.1_Nonsense_Mutation_p.R448*	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1660						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		ATTTAGCCAGCGATGGCTAGC	0.438													102	27	---	---	---	---	capture	Nonsense_Mutation	SNP	71540387	71540387	PCNX	14	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	11494	183
EML5	161436	broad.mit.edu	37	14	89168805	89168805	+	Silent	SNP	G	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:89168805G>A	uc001xxg.2	-	15	2409	c.2223C>T	c.(2221-2223)TAC>TAT	p.Y741Y	EML5_uc001xxh.1_Translation_Start_Site	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	741	WD 11.					cytoplasm|microtubule				ovary(3)	3						CTGTTGCCACGTAGTCTTTCA	0.368													32	6	---	---	---	---	capture	Silent	SNP	89168805	89168805	EML5	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5055	183
AQR	9716	broad.mit.edu	37	15	35168164	35168164	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:35168164A>G	uc001ziv.2	-	28	3390	c.3209T>C	c.(3208-3210)ATA>ACA	p.I1070T		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	1070						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AAAAGTTTCTATCTCCAGAAT	0.358													5	212	---	---	---	---	capture	Missense_Mutation	SNP	35168164	35168164	AQR	15	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	828	183
AQR	9716	broad.mit.edu	37	15	35168175	35168175	+	Silent	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:35168175C>T	uc001ziv.2	-	28	3379	c.3198G>A	c.(3196-3198)CAG>CAA	p.Q1066Q		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	1066						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TCTCCAGAATCTGAGCAGCCT	0.353													5	195	---	---	---	---	capture	Silent	SNP	35168175	35168175	AQR	15	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	828	183
NOX5	79400	broad.mit.edu	37	15	69324094	69324094	+	Nonsense_Mutation	SNP	G	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:69324094G>T	uc002ars.1	+	4	582	c.562G>T	c.(562-564)GAG>TAG	p.E188*	NOX5_uc002arp.1_Nonsense_Mutation_p.E170*|NOX5_uc002arq.1_Nonsense_Mutation_p.E142*|NOX5_uc010bid.1_Nonsense_Mutation_p.E153*|NOX5_uc002arr.1_Nonsense_Mutation_p.E160*|NOX5_uc010bie.1_5'UTR|NOX5_uc010bif.1_RNA	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	188	Cytoplasmic (Potential).|4 (Potential).|EF-hand 4.				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						CATCACCTTCGAGGAGCTCCG	0.677													4	29	---	---	---	---	capture	Nonsense_Mutation	SNP	69324094	69324094	NOX5	15	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	10466	183
PAPD5	64282	broad.mit.edu	37	16	50263117	50263117	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50263117C>G	uc010vgo.1	+	13	2010	c.1975C>G	c.(1975-1977)CAA>GAA	p.Q659E	PAPD5_uc010cbi.2_Intron|PAPD5_uc002efz.2_Missense_Mutation_p.Q403E|PAPD5_uc002ega.2_Missense_Mutation_p.Q450E	NM_001040284	NP_001035374	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5 isoform a	533					cell division|DNA replication|histone mRNA catabolic process|mitosis	cytoplasm|nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding				0		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		AGGTACAACTCAAACAAGCCA	0.433													55	47	---	---	---	---	capture	Missense_Mutation	SNP	50263117	50263117	PAPD5	16	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	11329	183
INPP5K	51763	broad.mit.edu	37	17	1419767	1419767	+	Silent	SNP	C	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1419767C>G	uc002fsr.2	-	1	416	c.27G>C	c.(25-27)CCG>CCC	p.P9P	INPP5K_uc002fss.2_5'UTR|INPP5K_uc002fsq.2_5'UTR|INPP5K_uc010cjr.2_5'UTR|INPP5K_uc010vql.1_5'UTR|INPP5K_uc010vqm.1_Silent_p.P9P|INPP5K_uc010cjs.2_Silent_p.P9P	NM_016532	NP_057616	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K isoform	9					actin cytoskeleton organization	cytosol|endoplasmic reticulum|membrane fraction|neuron projection|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol bisphosphate phosphatase activity|inositol bisphosphate phosphatase activity|inositol trisphosphate phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|lipid phosphatase activity|protein binding				0						TCCTGCCTTTCGGCCCGCTCA	0.756													10	10	---	---	---	---	capture	Silent	SNP	1419767	1419767	INPP5K	17	C	G	G	G	1	0	0	0	0	0	0	0	1	392	31	4	4	7683	183
PHF12	57649	broad.mit.edu	37	17	27233967	27233967	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27233967T>C	uc002hdg.1	-	14	3117	c.2587A>G	c.(2587-2589)ACG>GCG	p.T863A	PHF12_uc010wbb.1_Missense_Mutation_p.T845A	NM_001033561	NP_001028733	Q96QT6	PHF12_HUMAN	PHD finger protein 12 isoform 1	863	FHA.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	protein binding|zinc ion binding			ovary(1)	1	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TTGTCCACCGTTGTCCCATGC	0.507													153	183	---	---	---	---	capture	Missense_Mutation	SNP	27233967	27233967	PHF12	17	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	11726	183
DSG3	1830	broad.mit.edu	37	18	29052357	29052357	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29052357G>A	uc002kws.2	+	13	2117	c.2008G>A	c.(2008-2010)GGA>AGA	p.G670R	DSG3_uc002kwt.2_5'Flank	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	670	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TCATCAGTGGGGAATTGAAGG	0.428													52	67	---	---	---	---	capture	Missense_Mutation	SNP	29052357	29052357	DSG3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4733	183
S1PR4	8698	broad.mit.edu	37	19	3179828	3179828	+	Silent	SNP	C	T	T	rs147906636	byFrequency	TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3179828C>T	uc002lxg.2	+	1	1063	c.1038C>T	c.(1036-1038)TCC>TCT	p.S346S		NM_003775	NP_003766	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4 precursor	346	Cytoplasmic (By similarity).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			lung(1)|skin(1)	2						AGGCTCACTCCGGAGCTTCCA	0.687													92	107	---	---	---	---	capture	Silent	SNP	3179828	3179828	S1PR4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13688	183
TYK2	7297	broad.mit.edu	37	19	10463654	10463654	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10463654C>T	uc002moc.3	-	22	3526	c.3148G>A	c.(3148-3150)GAA>AAA	p.E1050K	TYK2_uc010dxe.2_Missense_Mutation_p.E865K	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	1050	Protein kinase 2.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TCGTGGCCTTCGGGCACGGCC	0.652													26	44	---	---	---	---	capture	Missense_Mutation	SNP	10463654	10463654	TYK2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16692	183
ZNF540	163255	broad.mit.edu	37	19	38103690	38103690	+	Silent	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38103690C>T	uc002ogq.2	+	5	1841	c.1509C>T	c.(1507-1509)ACC>ACT	p.T503T	ZNF540_uc002ogu.2_Silent_p.T503T|ZNF540_uc010efq.2_Silent_p.T471T	NM_152606	NP_689819	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	503	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTGGGAAGACCTTTAGATTTG	0.393													90	136	---	---	---	---	capture	Silent	SNP	38103690	38103690	ZNF540	19	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	17854	183
CD33	945	broad.mit.edu	37	19	51728575	51728575	+	Missense_Mutation	SNP	A	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51728575A>T	uc002pwa.2	+	2	179	c.139A>T	c.(139-141)ATA>TTA	p.I47L	CD33_uc010eos.1_Missense_Mutation_p.I47L|CD33_uc010eot.1_Intron|CD33_uc010eou.1_5'Flank	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	47	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	CTTCCATCCCATACCCTACTA	0.532													68	98	---	---	---	---	capture	Missense_Mutation	SNP	51728575	51728575	CD33	19	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	2976	183
ROCK2	9475	broad.mit.edu	37	2	11332301	11332301	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:11332301C>T	uc002rbd.1	-	32	4585	c.4136G>A	c.(4135-4137)AGT>AAT	p.S1379N		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein	1379					axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		AAGCTGTCGACTTGGCCGTCT	0.368													123	186	---	---	---	---	capture	Missense_Mutation	SNP	11332301	11332301	ROCK2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	13410	183
ITSN2	50618	broad.mit.edu	37	2	24526701	24526701	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:24526701G>A	uc002rfe.2	-	9	1082	c.824C>T	c.(823-825)TCA>TTA	p.S275L	ITSN2_uc002rff.2_Missense_Mutation_p.S275L|ITSN2_uc002rfg.2_Missense_Mutation_p.S275L|ITSN2_uc010eyd.2_Missense_Mutation_p.S300L	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	275	EH 2.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAAAGATTTGACTGAAGAAG	0.318													50	70	---	---	---	---	capture	Missense_Mutation	SNP	24526701	24526701	ITSN2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	7850	183
EIF2AK2	5610	broad.mit.edu	37	2	37376027	37376027	+	Translation_Start_Site	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37376027C>T	uc010ynh.1	-	2	514	c.-43G>A	c.(-45--41)GCGTG>GCATG		EIF2AK2_uc010fab.1_5'Flank|EIF2AK2_uc010yng.1_5'Flank|EIF2AK2_uc010fac.2_Translation_Start_Site|EIF2AK2_uc010fad.2_Translation_Start_Site	NM_002759	NP_002750	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha						evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity			ovary(2)|lung(2)|pancreas(1)	5		all_hematologic(82;0.248)				CCAAAATGCACGCAGATAATC	0.433													50	42	---	---	---	---	capture	Translation_Start_Site	SNP	37376027	37376027	EIF2AK2	2	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	4952	183
ZNF638	27332	broad.mit.edu	37	2	71577393	71577393	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71577393C>A	uc002shx.2	+	2	1628	c.1309C>A	c.(1309-1311)CAT>AAT	p.H437N	ZNF638_uc010fec.2_Missense_Mutation_p.H543N|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_Missense_Mutation_p.H437N|ZNF638_uc002shy.2_Missense_Mutation_p.H437N|ZNF638_uc002shz.2_Missense_Mutation_p.H437N|ZNF638_uc002sia.2_Missense_Mutation_p.H437N|ZNF638_uc002sib.1_Missense_Mutation_p.H437N	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	437					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						AGAATGTAGTCATTTGAAGGT	0.358													103	140	---	---	---	---	capture	Missense_Mutation	SNP	71577393	71577393	ZNF638	2	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	17933	183
ADRA2B	151	broad.mit.edu	37	2	96781837	96781837	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96781837C>T	uc002svi.2	-	1	52	c.52G>A	c.(52-54)GCC>ACC	p.A18T		NM_000682	NP_000673	P18089	ADA2B_HUMAN	alpha-2B-adrenergic receptor	18	Helical; Name=1; (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation	integral to plasma membrane	alpha2-adrenergic receptor activity|epinephrine binding|protein binding			ovary(2)|lung(1)	3					Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	AAGGTGATGGCCGCCGCTATG	0.662													10	8	---	---	---	---	capture	Missense_Mutation	SNP	96781837	96781837	ADRA2B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	338	183
WIPF1	7456	broad.mit.edu	37	2	175432647	175432647	+	Silent	SNP	A	C	C	rs34236584		TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:175432647A>C	uc002uiy.2	-	7	1616	c.1284T>G	c.(1282-1284)CCT>CCG	p.P428P	uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Silent_p.P428P|WIPF1_uc010fqt.1_Silent_p.P428P|WIPF1_uc002uiz.2_Silent_p.P428P|WIPF1_uc002ujb.1_Silent_p.P428P	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	428	Pro-rich.				actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2						GAGGTGGGGGAGGTGCCCCAG	0.587													73	98	---	---	---	---	capture	Silent	SNP	175432647	175432647	WIPF1	2	A	C	C	C	1	0	0	0	0	0	0	0	1	132	11	4	4	17248	183
ISM1	140862	broad.mit.edu	37	20	13260546	13260546	+	Splice_Site	SNP	G	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13260546G>T	uc010gce.1	+	3	649	c.643_splice	c.e3+1	p.D215_splice	TASP1_uc010zri.1_Intron	NM_080826	NP_543016	B1AKI9	ISM1_HUMAN	isthmin 1 homolog precursor							extracellular region					0						CCAGAATATGGTGAGTTTACC	0.498													3	78	---	---	---	---	capture	Splice_Site	SNP	13260546	13260546	ISM1	20	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	7783	183
CSTF1	1477	broad.mit.edu	37	20	54974411	54974411	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54974411C>T	uc002xxl.1	+	5	1234	c.1034C>T	c.(1033-1035)ACG>ATG	p.T345M	CSTF1_uc002xxm.1_Missense_Mutation_p.T345M|CSTF1_uc002xxn.1_Missense_Mutation_p.T345M|CSTF1_uc002xxo.1_Missense_Mutation_p.T288M	NM_001033521	NP_001028693	Q05048	CSTF1_HUMAN	cleavage stimulation factor subunit 1	345					mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding			central_nervous_system(1)	1			Colorectal(105;0.202)			GTCAGATACACGGGTATGTGA	0.244													78	101	---	---	---	---	capture	Missense_Mutation	SNP	54974411	54974411	CSTF1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3948	183
CXADR	1525	broad.mit.edu	37	21	18933791	18933791	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:18933791T>C	uc002yki.2	+	6	948	c.830T>C	c.(829-831)ATC>ACC	p.I277T	CXADR_uc002ykh.1_Intron|CXADR_uc010gld.1_Intron|CXADR_uc010gle.1_Intron|CXADR_uc002ykj.1_Missense_Mutation_p.I250T	NM_001338	NP_001329	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	277	Cytoplasmic (Potential).				blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		CATCACGATATCAGGTAATTA	0.363													30	41	---	---	---	---	capture	Missense_Mutation	SNP	18933791	18933791	CXADR	21	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	4036	183
KIF15	56992	broad.mit.edu	37	3	44882590	44882590	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:44882590C>G	uc003cnx.3	+	29	3594	c.3445C>G	c.(3445-3447)CAA>GAA	p.Q1149E	KIF15_uc010hiq.2_Missense_Mutation_p.Q1052E|KIF15_uc010hir.2_Missense_Mutation_p.Q197E	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15	1149	Potential.				blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		ACCTCACTTTCAAACACATTT	0.333													43	61	---	---	---	---	capture	Missense_Mutation	SNP	44882590	44882590	KIF15	3	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	8199	183
SETD2	29072	broad.mit.edu	37	3	47147485	47147485	+	Splice_Site	SNP	A	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47147485A>G	uc003cqs.2	-	6	4892	c.4839_splice	c.e6+1	p.E1613_splice	SETD2_uc003cqv.2_Splice_Site_p.E1602_splice	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CAAGCTGCTTACCTCATCATT	0.338			N|F|S|Mis		clear cell renal carcinoma								107	173	---	---	---	---	capture	Splice_Site	SNP	47147485	47147485	SETD2	3	A	G	G	G	1	0	0	0	0	0	0	1	0	182	14	5	3	14024	183
UQCRC1	7384	broad.mit.edu	37	3	48641675	48641675	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48641675T>C	uc003cub.1	-	5	662	c.617A>G	c.(616-618)GAG>GGG	p.E206G	UQCRC1_uc003cua.1_Missense_Mutation_p.E91G|UQCRC1_uc003cuc.1_Missense_Mutation_p.E206G|UQCRC1_uc003cud.1_Missense_Mutation_p.E206G	NM_003365	NP_003356	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I	206					aerobic respiration|proteolysis		metalloendopeptidase activity|ubiquinol-cytochrome-c reductase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	Atovaquone(DB01117)	CCTGACATTCTCACTGGGCCC	0.552													105	161	---	---	---	---	capture	Missense_Mutation	SNP	48641675	48641675	UQCRC1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	16901	183
MECOM	2122	broad.mit.edu	37	3	168810761	168810761	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:168810761C>T	uc003ffi.3	-	13	2854	c.2585G>A	c.(2584-2586)AGG>AAG	p.R862K	MECOM_uc010hwk.1_Missense_Mutation_p.R876K|MECOM_uc003ffj.3_Missense_Mutation_p.R927K|MECOM_uc011bpi.1_Missense_Mutation_p.R854K|MECOM_uc003ffn.3_Missense_Mutation_p.R862K|MECOM_uc003ffk.2_Missense_Mutation_p.R853K|MECOM_uc003ffl.2_Missense_Mutation_p.R1013K|MECOM_uc011bpj.1_Missense_Mutation_p.R1050K|MECOM_uc011bpk.1_Missense_Mutation_p.R852K	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	862					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CTCCACATTCCTGGGAGATTG	0.403													60	80	---	---	---	---	capture	Missense_Mutation	SNP	168810761	168810761	MECOM	3	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	9335	183
SAMD7	344658	broad.mit.edu	37	3	169656173	169656173	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169656173A>G	uc003fgd.2	+	9	1487	c.1220A>G	c.(1219-1221)GAT>GGT	p.D407G	SAMD7_uc003fge.2_Missense_Mutation_p.D407G|SAMD7_uc011bpo.1_Missense_Mutation_p.D308G	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	407										skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			CAAGCATTTGATCAACCAGCA	0.348													63	85	---	---	---	---	capture	Missense_Mutation	SNP	169656173	169656173	SAMD7	3	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	13716	183
ENAM	10117	broad.mit.edu	37	4	71509712	71509712	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71509712C>A	uc011caw.1	+	9	2850	c.2569C>A	c.(2569-2571)CCA>ACA	p.P857T		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	857					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			ACCAAGTTACCCATCAGGTCA	0.448													48	80	---	---	---	---	capture	Missense_Mutation	SNP	71509712	71509712	ENAM	4	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	5067	183
PTPN13	5783	broad.mit.edu	37	4	87728883	87728883	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:87728883G>A	uc003hpz.2	+	45	7396	c.6916G>A	c.(6916-6918)GCC>ACC	p.A2306T	PTPN13_uc003hpy.2_Missense_Mutation_p.A2311T|PTPN13_uc003hqa.2_Missense_Mutation_p.A2287T|PTPN13_uc003hqb.2_Missense_Mutation_p.A2115T	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	2306	Tyrosine-protein phosphatase.					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CACAGTGATAGCCATGATGAC	0.453													100	162	---	---	---	---	capture	Missense_Mutation	SNP	87728883	87728883	PTPN13	4	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	12677	183
ADH1A	124	broad.mit.edu	37	4	100205753	100205753	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100205753G>T	uc003hur.1	-	5	441	c.370C>A	c.(370-372)CTG>ATG	p.L124M	uc003hum.1_Intron|ADH1A_uc011ceg.1_Missense_Mutation_p.L124M|ADH1A_uc010ilf.1_Translation_Start_Site	NM_000667	NP_000658	P07327	ADH1A_HUMAN	class I alcohol dehydrogenase, alpha subunit	124					ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Fomepizole(DB01213)|NADH(DB00157)	CCATCCTGCAGGGTCCCCTGA	0.517													41	60	---	---	---	---	capture	Missense_Mutation	SNP	100205753	100205753	ADH1A	4	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	307	183
PRMT10	90826	broad.mit.edu	37	4	148589774	148589774	+	Missense_Mutation	SNP	C	A	A	rs147339843	byFrequency	TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:148589774C>A	uc003ilc.2	-	6	1011	c.869G>T	c.(868-870)TGT>TTT	p.C290F	PRMT10_uc003ild.2_Missense_Mutation_p.C177F	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10	290						cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2						ATACTTTTCACAATTAGCACT	0.299													35	60	---	---	---	---	capture	Missense_Mutation	SNP	148589774	148589774	PRMT10	4	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12432	183
FGA	2243	broad.mit.edu	37	4	155508053	155508053	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155508053C>G	uc003iod.1	-	5	586	c.528G>C	c.(526-528)AAG>AAC	p.K176N	FGA_uc003ioe.1_Missense_Mutation_p.K176N|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	176	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	AAGATCGGATCTTAATATCAA	0.393													72	100	---	---	---	---	capture	Missense_Mutation	SNP	155508053	155508053	FGA	4	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	5776	183
NIPBL	25836	broad.mit.edu	37	5	37064969	37064969	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:37064969C>T	uc003jkl.3	+	47	8889	c.8390C>T	c.(8389-8391)GCC>GTC	p.A2797V	NIPBL_uc003jkk.3_3'UTR|NIPBL_uc003jkn.2_3'UTR	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	2797					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCCCTGTATGCCGCCAAGGAT	0.358													4	154	---	---	---	---	capture	Missense_Mutation	SNP	37064969	37064969	NIPBL	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10335	183
PCDHA7	56141	broad.mit.edu	37	5	140215867	140215867	+	Silent	SNP	G	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140215867G>A	uc003lhq.2	+	1	1899	c.1899G>A	c.(1897-1899)ACG>ACA	p.T633T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Silent_p.T633T	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	633	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGATCAGCACGACACGAGCCC	0.647													53	68	---	---	---	---	capture	Silent	SNP	140215867	140215867	PCDHA7	5	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	11432	183
TRIM15	89870	broad.mit.edu	37	6	30131441	30131441	+	Translation_Start_Site	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30131441C>T	uc010jrx.2	+	1	459	c.-20C>T	c.(-22--18)GACGG>GATGG		TRIM10_uc003npn.2_5'Flank|TRIM10_uc003npo.3_5'Flank	NM_033229	NP_150232	Q9C019	TRI15_HUMAN	tripartite motif protein 15						mesodermal cell fate determination	intracellular	zinc ion binding				0						CCGGAGTGGACGGGCTGGGGA	0.602													15	35	---	---	---	---	capture	Translation_Start_Site	SNP	30131441	30131441	TRIM15	6	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	16373	183
HSPA1L	3305	broad.mit.edu	37	6	31778907	31778907	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31778907C>A	uc003nxh.2	-	2	1026	c.843G>T	c.(841-843)CAG>CAT	p.Q281H	HSPA1L_uc010jte.2_Missense_Mutation_p.Q281H	NM_005527	NP_005518	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	281					response to unfolded protein		ATP binding			ovary(3)|pleura(1)|kidney(1)|skin(1)	6						CTAGGTTGGCCTGGGTGCTGG	0.522													93	111	---	---	---	---	capture	Missense_Mutation	SNP	31778907	31778907	HSPA1L	6	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	7335	183
PKHD1	5314	broad.mit.edu	37	6	51484145	51484145	+	Missense_Mutation	SNP	G	C	C			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51484145G>C	uc003pah.1	-	67	12235	c.11959C>G	c.(11959-11961)CCT>GCT	p.P3987A		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3987	Cytoplasmic (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGCTGAGCAGGAGCACCTGGA	0.572													72	136	---	---	---	---	capture	Missense_Mutation	SNP	51484145	51484145	PKHD1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	11874	183
MTHFD1L	25902	broad.mit.edu	37	6	151281413	151281413	+	Silent	SNP	G	A	A	rs146093887	by1000genomes	TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151281413G>A	uc003qob.2	+	18	2074	c.1806G>A	c.(1804-1806)GCG>GCA	p.A602A	MTHFD1L_uc011een.1_RNA|MTHFD1L_uc011eeo.1_Silent_p.A603A|MTHFD1L_uc003qoc.2_Silent_p.A550A	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+	602	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TGGTTCAGGCGCAGTTTGACA	0.612													40	74	---	---	---	---	capture	Silent	SNP	151281413	151281413	MTHFD1L	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9838	183
PCLO	27445	broad.mit.edu	37	7	82785272	82785272	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82785272G>T	uc003uhx.2	-	2	974	c.685C>A	c.(685-687)CCG>ACG	p.P229T	PCLO_uc003uhv.2_Missense_Mutation_p.P229T	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	229	Gln-rich.|Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGCTGAAGCGGATCCCTACCA	0.463													29	36	---	---	---	---	capture	Missense_Mutation	SNP	82785272	82785272	PCLO	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	11486	183
TFPI2	7980	broad.mit.edu	37	7	93519537	93519537	+	Silent	SNP	G	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93519537G>A	uc003umy.1	-	2	258	c.183C>T	c.(181-183)TGC>TGT	p.C61C	GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_Silent_p.C61C|TFPI2_uc003una.1_Silent_p.C50C|TFPI2_uc003unb.1_Silent_p.C61C|TFPI2_uc010lfg.1_Intron	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2 precursor	61	BPTI/Kunitz inhibitor 1.				blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			GGAACTGGCGGCAGCTCTGCG	0.577													3	73	---	---	---	---	capture	Silent	SNP	93519537	93519537	TFPI2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	15694	183
MOGAT3	346606	broad.mit.edu	37	7	100841600	100841600	+	Silent	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100841600C>T	uc003uyc.2	-	5	707	c.540G>A	c.(538-540)CAG>CAA	p.Q180Q	MOGAT3_uc010lhr.2_Silent_p.Q180Q	NM_178176	NP_835470	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	180					glycerol metabolic process|lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity|diacylglycerol O-acyltransferase activity			ovary(2)	2	Lung NSC(181;0.168)|all_lung(186;0.215)					CGAGCTGGGGCTGGGACAGGA	0.657													41	49	---	---	---	---	capture	Silent	SNP	100841600	100841600	MOGAT3	7	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	9608	183
KCNU1	157855	broad.mit.edu	37	8	36661576	36661576	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:36661576C>G	uc010lvw.2	+	3	434	c.347C>G	c.(346-348)TCT>TGT	p.S116C	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	116	Helical; Name=Segment S1; (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AGCATTGGGTCTCTTATAATC	0.358													5	5	---	---	---	---	capture	Missense_Mutation	SNP	36661576	36661576	KCNU1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	8015	183
SNX16	64089	broad.mit.edu	37	8	82714627	82714627	+	Missense_Mutation	SNP	T	A	A			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:82714627T>A	uc011lft.1	-	8	1433	c.926A>T	c.(925-927)GAT>GTT	p.D309V	SNX16_uc003ycn.2_Missense_Mutation_p.D309V|SNX16_uc003yco.2_Missense_Mutation_p.D280V	NM_022133	NP_071416	P57768	SNX16_HUMAN	sorting nexin 16 isoform a	309				LDEE -> WMR (in Ref. 1; AAG25676).	cell communication|early endosome to late endosome transport|endosome to lysosome transport|protein targeting to lysosome	early endosome membrane|extrinsic to endosome membrane|late endosome membrane|lysosome	identical protein binding|phosphatidylinositol binding			ovary(1)|pancreas(1)	2						AGATTCTTCATCCAGGACATC	0.343													30	48	---	---	---	---	capture	Missense_Mutation	SNP	82714627	82714627	SNX16	8	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	14779	183
TAF1L	138474	broad.mit.edu	37	9	32635178	32635178	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32635178A>G	uc003zrg.1	-	1	490	c.400T>C	c.(400-402)TAC>CAC	p.Y134H	uc003zrh.1_Intron	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	134					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCCGAGTGGTAAAGGGGCTGC	0.478													82	143	---	---	---	---	capture	Missense_Mutation	SNP	32635178	32635178	TAF1L	9	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	15411	183
PIGO	84720	broad.mit.edu	37	9	35090223	35090223	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35090223C>T	uc003zwd.2	-	9	3305	c.2909G>A	c.(2908-2910)CGG>CAG	p.R970Q	PIGO_uc003zwc.1_3'UTR|PIGO_uc003zwe.2_Missense_Mutation_p.R553Q|PIGO_uc003zwf.2_Missense_Mutation_p.R553Q|PIGO_uc003zwg.1_3'UTR	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	970					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity			large_intestine(1)|ovary(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CTGTCTCTTCCGCAGCCCTTG	0.607													46	77	---	---	---	---	capture	Missense_Mutation	SNP	35090223	35090223	PIGO	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11797	183
NR4A3	8013	broad.mit.edu	37	9	102590645	102590645	+	Silent	SNP	T	C	C			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:102590645T>C	uc004baf.1	+	3	1050	c.321T>C	c.(319-321)CAT>CAC	p.H107H	NR4A3_uc004bae.2_Silent_p.H107H|NR4A3_uc004bag.1_Silent_p.H107H|NR4A3_uc004bai.2_Silent_p.H118H	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	107	Poly-His.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				accaccaccatcaccaGCAGC	0.493			T	EWSR1	extraskeletal myxoid chondrosarcoma								4	78	---	---	---	---	capture	Silent	SNP	102590645	102590645	NR4A3	9	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	10541	183
ITGA10	8515	broad.mit.edu	37	1	145534987	145534988	+	Frame_Shift_Ins	INS	-	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145534987_145534988insG	uc001eoa.2	+	15	1966_1967	c.1890_1891insG	c.(1888-1893)GCTGTGfs	p.A630fs	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Frame_Shift_Ins_p.A499fs|ITGA10_uc009wiw.2_Frame_Shift_Ins_p.A487fs|ITGA10_uc010oyw.1_Frame_Shift_Ins_p.A575fs	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	630_631	Extracellular (Potential).|FG-GAP 7.				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCGATGTGGCTGTGGGTGCCCA	0.490													7	296	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	145534987	145534988	ITGA10	1	-	G	G	G	1	0	1	1	0	0	0	0	0	704	55	5	5	7796	183
IRS2	8660	broad.mit.edu	37	13	110434967	110434968	+	Frame_Shift_Ins	INS	-	G	G			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:110434967_110434968insG	uc001vqv.2	-	1	3947_3948	c.3433_3434insC	c.(3433-3435)CGCfs	p.R1145fs		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1145					fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			ACTGTGGCGGCGGCGGCCCCCC	0.723													3	5	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	110434967	110434968	IRS2	13	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	7764	183
FAM113A	64773	broad.mit.edu	37	20	2819125	2819125	+	Splice_Site	DEL	C	-	-			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2819125delC	uc002wgz.1	-	6	1092	c.595_splice	c.e6-1	p.L199_splice	FAM113A_uc002whb.1_Intron|FAM113A_uc002wha.1_Intron|FAM113A_uc010zqa.1_Splice_Site_p.L46_splice|FAM113A_uc002whc.1_Splice_Site_p.L148_splice|VPS16_uc002whe.2_5'Flank|VPS16_uc002whf.2_5'Flank|VPS16_uc002whd.2_5'Flank	NM_022760	NP_073597	Q9H1Q7	F113A_HUMAN	hypothetical protein LOC64773								hydrolase activity|protein binding			ovary(2)	2						GGGGCTGGAGCTAAGTGAGAA	0.572													57	69	---	---	---	---	capture_indel	Splice_Site	DEL	2819125	2819125	FAM113A	20	C	-	-	-	1	0	1	0	1	0	0	1	0	364	28	5	5	5355	183
PDGFRA	5156	broad.mit.edu	37	4	55133888	55133899	+	In_Frame_Del	DEL	GGAAAAGATTCA	-	-			TCGA-26-5134-01	TCGA-26-5134-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55133888_55133899delGGAAAAGATTCA	uc003han.3	+	7	1432_1443	c.1101_1112delGGAAAAGATTCA	c.(1099-1113)GTGGAAAAGATTCAG>GTG	p.EKIQ368del	PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_In_Frame_Del_p.EKIQ262del|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	368_371	Ig-like C2-type 4.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CCACTGATGTGGAAAAGATTCAGGAAATAAGG	0.448			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			278	261	---	---	---	---	capture_indel	In_Frame_Del	DEL	55133888	55133899	PDGFRA	4	GGAAAAGATTCA	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	11564	183
