Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PIK3CD	5293	broad.mit.edu	37	1	9780231	9780231	+	Silent	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:9780231C>T	uc001aqb.3	+	11	1609	c.1401C>T	c.(1399-1401)AGC>AGT	p.S467S	PIK3CD_uc010oaf.1_Silent_p.S467S|PIK3CD_uc001aqe.3_Silent_p.S432S	NM_005026	NP_005017	O00329	PK3CD_HUMAN	catalytic phosphatidylinositol 3-kinase delta	467					phosphatidylinositol-mediated signaling|protein phosphorylation	phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(4)|skin(2)|central_nervous_system(1)	7	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)		ACACGGATAGCGCCGCTGCCC	0.662													45	59	---	---	---	---	capture	Silent	SNP	9780231	9780231	PIK3CD	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11818	185
MUL1	79594	broad.mit.edu	37	1	20828674	20828674	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:20828674G>A	uc001bdi.3	-	3	374	c.217C>T	c.(217-219)CGG>TGG	p.R73W		NM_024544	NP_078820	Q969V5	MUL1_HUMAN	mitochondrial ubiquitin ligase activator of NFKB	73	Mitochondrial intermembrane (Potential).				activation of caspase activity|activation of JUN kinase activity|induction of apoptosis|mitochondrial fission|mitochondrion localization|negative regulation of cell growth|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to mitochondrial outer membrane|nucleus|peroxisome	identical protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		TTAACAGACCGCACAGCTCCT	0.388													5	247	---	---	---	---	capture	Missense_Mutation	SNP	20828674	20828674	MUL1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	9894	185
ZNF644	84146	broad.mit.edu	37	1	91404393	91404393	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91404393C>T	uc001dnw.2	-	3	2660	c.2518G>A	c.(2518-2520)GTT>ATT	p.V840I	ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron|ZNF644_uc001dny.1_Missense_Mutation_p.V840I	NM_201269	NP_958357	Q9H582	ZN644_HUMAN	zinc finger protein 644 isoform 1	840					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTTTGCAAAACGACAACAGTC	0.363													90	154	---	---	---	---	capture	Missense_Mutation	SNP	91404393	91404393	ZNF644	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17938	185
AMPD1	270	broad.mit.edu	37	1	115220069	115220069	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115220069G>A	uc001efe.1	-	10	1375	c.1291C>T	c.(1291-1293)CGC>TGC	p.R431C	AMPD1_uc001eff.1_Missense_Mutation_p.R427C	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	431					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TCAGGACTGCGGCCATAGATG	0.567													58	111	---	---	---	---	capture	Missense_Mutation	SNP	115220069	115220069	AMPD1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	585	185
PPIAL4G	644591	broad.mit.edu	37	1	143767630	143767630	+	Silent	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:143767630G>A	uc001ejt.2	-	1	252	c.219C>T	c.(217-219)ACC>ACT	p.T73T		NM_001123068	NP_001116540	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like	73	PPIase cyclophilin-type.				protein folding	cytoplasm	peptidyl-prolyl cis-trans isomerase activity				0						ACTTGTCACCGGTGCCATTAG	0.468													8	534	---	---	---	---	capture	Silent	SNP	143767630	143767630	PPIAL4G	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	12219	185
PEAR1	375033	broad.mit.edu	37	1	156879622	156879622	+	Silent	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156879622C>T	uc001fqj.1	+	12	1607	c.1491C>T	c.(1489-1491)GCC>GCT	p.A497A	PEAR1_uc001fqk.1_Silent_p.A122A	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	497	EGF-like 6.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCCAGTGTGCCCATGAGGCAG	0.662													29	73	---	---	---	---	capture	Silent	SNP	156879622	156879622	PEAR1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	11615	185
PVRL4	81607	broad.mit.edu	37	1	161049529	161049529	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161049529C>T	uc001fxo.2	-	2	589	c.290G>A	c.(289-291)CGC>CAC	p.R97H		NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	97	Ig-like V-type 1.|Extracellular (Potential).				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CTGCTCCACGCGGCCCTCGTA	0.687													31	35	---	---	---	---	capture	Missense_Mutation	SNP	161049529	161049529	PVRL4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12737	185
SIPA1L2	57568	broad.mit.edu	37	1	232561420	232561420	+	Silent	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:232561420G>A	uc001hvg.2	-	16	4703	c.4545C>T	c.(4543-4545)AAC>AAT	p.N1515N	SIPA1L2_uc001hvf.2_Silent_p.N589N	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1515					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ACAGAATGTCGTTGGGCAGGG	0.642													20	46	---	---	---	---	capture	Silent	SNP	232561420	232561420	SIPA1L2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14223	185
SIPA1L2	57568	broad.mit.edu	37	1	232626679	232626679	+	Nonsense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:232626679G>A	uc001hvg.2	-	3	1905	c.1747C>T	c.(1747-1749)CGA>TGA	p.R583*		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	583					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GAAGCCTGTCGCAAACACTGA	0.463													71	124	---	---	---	---	capture	Nonsense_Mutation	SNP	232626679	232626679	SIPA1L2	1	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	14223	185
OR2T6	254879	broad.mit.edu	37	1	248551010	248551010	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248551010T>C	uc001iei.1	+	1	101	c.101T>C	c.(100-102)GTC>GCC	p.V34A		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	34	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATTTGTGCCGTCTTCTTCATG	0.463													65	110	---	---	---	---	capture	Missense_Mutation	SNP	248551010	248551010	OR2T6	1	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	10933	185
EPC1	80314	broad.mit.edu	37	10	32580102	32580102	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:32580102T>C	uc001iwg.1	-	6	1234	c.964A>G	c.(964-966)AAA>GAA	p.K322E	EPC1_uc001iwi.3_Missense_Mutation_p.K272E|EPC1_uc009xlt.2_Missense_Mutation_p.K272E|EPC1_uc001iwh.1_Missense_Mutation_p.K322E	NM_025209	NP_079485	Q9H2F5	EPC1_HUMAN	enhancer of polycomb 1	322					histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)				TTATTAACTTTGAACTCCTTC	0.318													48	22	---	---	---	---	capture	Missense_Mutation	SNP	32580102	32580102	EPC1	10	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	5115	185
TBC1D12	23232	broad.mit.edu	37	10	96163266	96163266	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96163266C>A	uc001kjr.2	+	1	1081	c.896C>A	c.(895-897)CCC>CAC	p.P299H		NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12	299						intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)				GTGCCCTTGCCCGCCGCGGAG	0.667													8	0	---	---	---	---	capture	Missense_Mutation	SNP	96163266	96163266	TBC1D12	10	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	15489	185
C10orf129	142827	broad.mit.edu	37	10	96979715	96979715	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96979715C>T	uc001kke.2	+	9	1312	c.1187C>T	c.(1186-1188)CCT>CTT	p.P396L	C10orf129_uc009xuu.1_Missense_Mutation_p.P306L	NM_207321	NP_997204	Q6P461	ACSM6_HUMAN	acyl-coenzyme A synthetase ACSM6, mitochondrial	396					fatty acid metabolic process	mitochondrion	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		CCATTGCCACCTTATATTGTC	0.368													99	70	---	---	---	---	capture	Missense_Mutation	SNP	96979715	96979715	C10orf129	10	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	1581	185
DMBT1	1755	broad.mit.edu	37	10	124351971	124351971	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124351971G>A	uc001lgk.1	+	20	2466	c.2360G>A	c.(2359-2361)CGG>CAG	p.R787Q	DMBT1_uc001lgl.1_Missense_Mutation_p.R777Q|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Missense_Mutation_p.R787Q|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Missense_Mutation_p.R400Q	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	787	SRCR 6.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GGAAATGCCCGGTTTGGCCAG	0.622													174	77	---	---	---	---	capture	Missense_Mutation	SNP	124351971	124351971	DMBT1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4535	185
HMX3	340784	broad.mit.edu	37	10	124896723	124896723	+	Missense_Mutation	SNP	G	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124896723G>C	uc010quc.1	+	2	550	c.550G>C	c.(550-552)GAA>CAA	p.E184Q		NM_001105574	NP_001099044	A6NHT5	HMX3_HUMAN	H6 family homeobox 3	184					cell differentiation	nucleus	sequence-specific DNA binding transcription factor activity				0		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.122)|COAD - Colon adenocarcinoma(40;0.141)		CGACTCCGAGGAAAGCAAAAA	0.677													2	10	---	---	---	---	capture	Missense_Mutation	SNP	124896723	124896723	HMX3	10	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	7173	185
PAOX	196743	broad.mit.edu	37	10	135197588	135197588	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135197588C>A	uc001lmv.2	+	4	1073	c.993C>A	c.(991-993)TTC>TTA	p.F331L	PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Missense_Mutation_p.F331L|PAOX_uc001lmy.2_Intron|PAOX_uc001lmz.2_RNA|PAOX_uc001lna.2_RNA|PAOX_uc001lnb.2_Intron|PAOX_uc001lnc.2_Intron	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1	469					polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		AGGAGCCCTTCTGGGAGCCAG	0.587													4	93	---	---	---	---	capture	Missense_Mutation	SNP	135197588	135197588	PAOX	10	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	11327	185
TRIM49	57093	broad.mit.edu	37	11	89531467	89531467	+	Missense_Mutation	SNP	A	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89531467A>T	uc001pdb.2	-	8	1519	c.1190T>A	c.(1189-1191)CTT>CAT	p.L397H		NM_020358	NP_065091	P0CI25	TRI49_HUMAN	ring finger protein 18	397	B30.2/SPRY.					intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TTGCAGCATAAGTGGGGAGGT	0.428													48	104	---	---	---	---	capture	Missense_Mutation	SNP	89531467	89531467	TRIM49	11	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	16407	185
ANGPTL5	253935	broad.mit.edu	37	11	101762250	101762250	+	Silent	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:101762250C>T	uc001pgl.2	-	9	1523	c.927G>A	c.(925-927)GGG>GGA	p.G309G		NM_178127	NP_835228	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5 precursor	309	Fibrinogen C-terminal.				signal transduction	extracellular space	receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		CAGGGCGACACCCATCATTAT	0.443													71	108	---	---	---	---	capture	Silent	SNP	101762250	101762250	ANGPTL5	11	C	T	T	T	1	0	0	0	0	0	0	0	1	223	18	2	2	614	185
TSPAN9	10867	broad.mit.edu	37	12	3389625	3389625	+	Silent	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:3389625C>T	uc001qlp.2	+	6	555	c.408C>T	c.(406-408)AAC>AAT	p.N136N		NM_006675	NP_006666	O75954	TSN9_HUMAN	tetraspanin 9	136	Extracellular (Potential).					integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			GGCTGAAGAACGCCTGGAACA	0.657													10	45	---	---	---	---	capture	Silent	SNP	3389625	3389625	TSPAN9	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16537	185
PABPC3	5042	broad.mit.edu	37	13	25671151	25671151	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25671151G>A	uc001upy.2	+	1	876	c.815G>A	c.(814-816)CGG>CAG	p.R272Q		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	272					mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AAAGTGGAACGGCAGACGGAA	0.398													5	283	---	---	---	---	capture	Missense_Mutation	SNP	25671151	25671151	PABPC3	13	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11269	185
UGGT2	55757	broad.mit.edu	37	13	96530054	96530054	+	Silent	SNP	T	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:96530054T>C	uc001vmt.2	-	28	3455	c.3285A>G	c.(3283-3285)CAA>CAG	p.Q1095Q	UGGT2_uc001vmu.1_Silent_p.Q182Q	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	1095					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						TATCAAAGCATTGTCCTTCCA	0.403													125	44	---	---	---	---	capture	Silent	SNP	96530054	96530054	UGGT2	13	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	16824	185
ADPRHL1	113622	broad.mit.edu	37	13	114107590	114107590	+	Missense_Mutation	SNP	C	T	T	rs149499588		TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:114107590C>T	uc001vtq.1	-	1	250	c.163G>A	c.(163-165)GTG>ATG	p.V55M		NM_138430	NP_612439	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1 isoform 1	55					protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			TTGTCACTCACGGGCCATTCT	0.632													4	118	---	---	---	---	capture	Missense_Mutation	SNP	114107590	114107590	ADPRHL1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	332	185
PEX11A	8800	broad.mit.edu	37	15	90226620	90226620	+	Silent	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90226620C>T	uc002boi.2	-	3	827	c.732G>A	c.(730-732)CTG>CTA	p.L244L	PEX11A_uc010upy.1_RNA	NM_003847	NP_003838	O75192	PX11A_HUMAN	peroxisomal biogenesis factor 11 alpha	244	Cytoplasmic (Potential).			KLK->SLS: No effect on peroxisomal location.	cellular lipid metabolic process|peroxisome fission|signal transduction	integral to peroxisomal membrane					0	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			AACGGGTCTTCAGCTTCATCT	0.453													224	353	---	---	---	---	capture	Silent	SNP	90226620	90226620	PEX11A	15	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	11640	185
CDH5	1003	broad.mit.edu	37	16	66429972	66429972	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66429972C>T	uc002eom.3	+	8	1384	c.1228C>T	c.(1228-1230)CGC>TGC	p.R410C		NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	410	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		ATACTCCATCCGCAGGACCAG	0.493													57	102	---	---	---	---	capture	Missense_Mutation	SNP	66429972	66429972	CDH5	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3084	185
CDH15	1013	broad.mit.edu	37	16	89251737	89251737	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89251737G>A	uc002fmt.2	+	5	736	c.659G>A	c.(658-660)CGC>CAC	p.R220H	CDH15_uc010cij.1_Missense_Mutation_p.R220H	NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein	220	Cadherin 2.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		GGGCTGGACCGCGAGGTGAGG	0.706													8	11	---	---	---	---	capture	Missense_Mutation	SNP	89251737	89251737	CDH15	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3071	185
TP53	7157	broad.mit.edu	37	17	7578534	7578534	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578534C>A	uc002gim.2	-	5	590	c.396G>T	c.(394-396)AAG>AAT	p.K132N	TP53_uc002gig.1_Missense_Mutation_p.K132N|TP53_uc002gih.2_Missense_Mutation_p.K132N|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'UTR|TP53_uc010cng.1_5'UTR|TP53_uc002gii.1_5'UTR|TP53_uc010cnh.1_Missense_Mutation_p.K132N|TP53_uc010cni.1_Missense_Mutation_p.K132N|TP53_uc002gij.2_Missense_Mutation_p.K132N|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.K39N|TP53_uc002gio.2_5'UTR|TP53_uc010vug.1_Missense_Mutation_p.K93N	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	132	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		K -> T (in sporadic cancers; somatic mutation).|KM -> NL (in a sporadic cancer; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> R (in sporadic cancers; somatic mutation).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> Q (in sporadic cancers; somatic mutation).|K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.K132N(40)|p.K132R(32)|p.K132E(19)|p.K132Q(13)|p.K132M(9)|p.0?(7)|p.Y126_K132delYSPALNK(6)|p.K132T(4)|p.K132*(2)|p.N131fs*27(2)|p.K132fs*38(2)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.M133fs*16(1)|p.V73fs*9(1)|p.A129_K132delALNK(1)|p.L130_M133delLNKM(1)|p.M133fs*37(1)|p.K132_A138delKMFCQLA(1)|p.S127fs*36(1)|p.K132K(1)|p.K132W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCAAAACATCTTGTTGAGGG	0.562		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			51	14	---	---	---	---	capture	Missense_Mutation	SNP	7578534	7578534	TP53	17	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	16264	185
PHF12	57649	broad.mit.edu	37	17	27240145	27240145	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27240145T>C	uc002hdg.1	-	9	1974	c.1444A>G	c.(1444-1446)ACA>GCA	p.T482A	PHF12_uc010wbb.1_Missense_Mutation_p.T464A|PHF12_uc002hdi.1_Missense_Mutation_p.T478A|PHF12_uc002hdj.1_Missense_Mutation_p.T482A|PHF12_uc010crw.1_Missense_Mutation_p.T185A|PHF12_uc002hdh.1_Missense_Mutation_p.T265A	NM_001033561	NP_001028733	Q96QT6	PHF12_HUMAN	PHD finger protein 12 isoform 1	482	Interaction with SIN3A.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	protein binding|zinc ion binding			ovary(1)	1	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TTGTCAGCTGTTTGCAGGGAG	0.542													102	183	---	---	---	---	capture	Missense_Mutation	SNP	27240145	27240145	PHF12	17	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	11726	185
KRTAP4-11	653240	broad.mit.edu	37	17	39274087	39274087	+	Missense_Mutation	SNP	G	C	C	rs141357429	by1000genomes	TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274087G>C	uc002hvz.2	-	1	520	c.481C>G	c.(481-483)CTG>GTG	p.L161V		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	161	27.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACTGGACGCAGGcagcagcag	0.323													2	7	---	---	---	---	capture	Missense_Mutation	SNP	39274087	39274087	KRTAP4-11	17	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	8469	185
KIF18B	146909	broad.mit.edu	37	17	43005601	43005601	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43005601C>G	uc010wji.1	-	13	2179	c.2078G>C	c.(2077-2079)TGC>TCC	p.C693S	KIF18B_uc002iht.2_Missense_Mutation_p.C702S|KIF18B_uc010wjh.1_Missense_Mutation_p.C690S	NM_001080443	NP_001073912			kinesin family member 18B											ovary(2)	2		Prostate(33;0.155)				TGTGGCTGGGCAAACGCGAGG	0.647													4	44	---	---	---	---	capture	Missense_Mutation	SNP	43005601	43005601	KIF18B	17	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	8203	185
EPB41L3	23136	broad.mit.edu	37	18	5415838	5415838	+	Silent	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:5415838C>T	uc002kmt.1	-	13	2132	c.2046G>A	c.(2044-2046)CCG>CCA	p.P682P	EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Intron|EPB41L3_uc010wzf.1_Intron|EPB41L3_uc010wzg.1_Intron|EPB41L3_uc010dkr.2_Intron	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	682	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						AACTGTCACTCGGGTCATTGT	0.582													45	154	---	---	---	---	capture	Silent	SNP	5415838	5415838	EPB41L3	18	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	5109	185
TXNDC2	84203	broad.mit.edu	37	18	9886894	9886894	+	Missense_Mutation	SNP	A	G	G	rs146821851		TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:9886894A>G	uc002koi.3	+	2	867	c.418A>G	c.(418-420)AAA>GAA	p.K140E	TXNDC2_uc010wzq.1_RNA|TXNDC2_uc002koh.3_Missense_Mutation_p.K73E	NM_001098529	NP_001091999	Q86VQ3	TXND2_HUMAN	thioredoxin domain-containing 2 isoform 2	140	2.|22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation|cell redox homeostasis|glycerol ether metabolic process|multicellular organismal development|spermatogenesis	cytoplasm	electron carrier activity|nutrient reservoir activity|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity			ovary(1)|pancreas(1)	2						GTCCTCAGAAAAAGCCATCCA	0.547													5	332	---	---	---	---	capture	Missense_Mutation	SNP	9886894	9886894	TXNDC2	18	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	16679	185
NWD1	284434	broad.mit.edu	37	19	16860196	16860196	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16860196G>A	uc002neu.3	+	6	1165	c.743G>A	c.(742-744)CGC>CAC	p.R248H	NWD1_uc002net.3_Missense_Mutation_p.R113H|NWD1_uc002nev.3_Missense_Mutation_p.R42H			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;	248							ATP binding			skin(3)|ovary(2)|pancreas(2)	7						CCGTGGAGCCGCGACTTGGTG	0.597													49	21	---	---	---	---	capture	Missense_Mutation	SNP	16860196	16860196	NWD1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10688	185
MAST3	23031	broad.mit.edu	37	19	18218415	18218415	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18218415C>T	uc002nhz.3	+	2	58	c.58C>T	c.(58-60)CGC>TGC	p.R20C		NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase	20							ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						GAGCCTGCCACGCCGAGGACG	0.572													75	55	---	---	---	---	capture	Missense_Mutation	SNP	18218415	18218415	MAST3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9239	185
CD33	945	broad.mit.edu	37	19	51742917	51742917	+	Missense_Mutation	SNP	G	A	A	rs148758925	byFrequency;by1000genomes	TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51742917G>A	uc002pwa.2	+	7	1109	c.1069G>A	c.(1069-1071)GAA>AAA	p.E357K	CD33_uc010eos.1_3'UTR|CD33_uc010eot.1_Missense_Mutation_p.E230K|CD33_uc010eou.1_RNA	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	357	ITIM motif 2.|Cytoplasmic (Potential).				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	CACCTCCACCGAATACTCAGA	0.527													4	94	---	---	---	---	capture	Missense_Mutation	SNP	51742917	51742917	CD33	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2976	185
MBOAT7	79143	broad.mit.edu	37	19	54677935	54677935	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54677935C>G	uc002qdq.2	-	9	1488	c.1222G>C	c.(1222-1224)GAC>CAC	p.D408H	TMC4_uc010erf.2_5'Flank|TMC4_uc002qdo.2_5'Flank|MBOAT7_uc010erg.2_Missense_Mutation_p.D92H|MBOAT7_uc010yem.1_Missense_Mutation_p.D390H|MBOAT7_uc002qdr.2_Missense_Mutation_p.D408H|MBOAT7_uc002qds.2_Missense_Mutation_p.D335H|MBOAT7_uc010yen.1_Missense_Mutation_p.D335H	NM_024298	NP_077274	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain	408					phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CACATGTAGTCATAGGCGCGC	0.652													3	188	---	---	---	---	capture	Missense_Mutation	SNP	54677935	54677935	MBOAT7	19	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	9271	185
MYCN	4613	broad.mit.edu	37	2	16082359	16082359	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:16082359C>T	uc002rci.2	+	2	473	c.173C>T	c.(172-174)ACG>ATG	p.T58M	MYCNOS_uc002rch.1_5'Flank|MYCN_uc010yjr.1_Missense_Mutation_p.T50M	NM_005378	NP_005369	P04198	MYCN_HUMAN	v-myc myelocytomatosis viral related oncogene,	58					regulation of transcription from RNA polymerase II promoter	chromatin|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			CTGCTGCCCACGCCCCCGCTG	0.677			A		neuroblastoma								19	28	---	---	---	---	capture	Missense_Mutation	SNP	16082359	16082359	MYCN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9931	185
SCN9A	6335	broad.mit.edu	37	2	167141183	167141183	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167141183C>G	uc010fpl.2	-	12	2095	c.1754G>C	c.(1753-1755)AGG>ACG	p.R585T	uc002udp.2_Intron|SCN9A_uc002udr.1_Missense_Mutation_p.R456T|SCN9A_uc002uds.1_Missense_Mutation_p.R456T|SCN9A_uc002udt.1_Missense_Mutation_p.R456T	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	585						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	CAGTGAGCCCCTTCTGCTCTC	0.502													72	109	---	---	---	---	capture	Missense_Mutation	SNP	167141183	167141183	SCN9A	2	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	13818	185
COL6A3	1293	broad.mit.edu	37	2	238270475	238270475	+	Splice_Site	SNP	C	G	G			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238270475C>G	uc002vwl.2	-	15	6349	c.6064_splice	c.e15-1	p.D2022_splice	COL6A3_uc002vwo.2_Splice_Site_p.D1816_splice|COL6A3_uc010znj.1_Splice_Site_p.D1415_splice	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor						axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAATGTTGTCCTACCGAAAGG	0.527													67	113	---	---	---	---	capture	Splice_Site	SNP	238270475	238270475	COL6A3	2	C	G	G	G	1	0	0	0	0	0	0	1	0	312	24	5	4	3666	185
SAMHD1	25939	broad.mit.edu	37	20	35547889	35547889	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35547889G>A	uc002xgh.1	-	7	860	c.730C>T	c.(730-732)CTT>TTT	p.L244F		NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1	244	HD.				defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)				GAATTAATAAGGTGCTCAAAC	0.368													38	72	---	---	---	---	capture	Missense_Mutation	SNP	35547889	35547889	SAMHD1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	13720	185
OXSM	54995	broad.mit.edu	37	3	25832620	25832620	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:25832620A>G	uc003cdn.2	+	2	216	c.109A>G	c.(109-111)ATA>GTA	p.I37V	NGLY1_uc011awo.1_5'Flank|OXSM_uc011awp.1_5'UTR|OXSM_uc010hfh.2_Missense_Mutation_p.I37V	NM_017897	NP_060367	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial isoform 1	37					acyl-CoA metabolic process|medium-chain fatty acid biosynthetic process|short-chain fatty acid biosynthetic process	mitochondrion	3-oxoacyl-[acyl-carrier-protein] synthase activity			ovary(1)|breast(1)	2						AACTGTGCCAATATCCAGATT	0.428													140	218	---	---	---	---	capture	Missense_Mutation	SNP	25832620	25832620	OXSM	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11239	185
PIK3CA	5290	broad.mit.edu	37	3	178916882	178916882	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916882G>A	uc003fjk.2	+	2	426	c.269G>A	c.(268-270)TGT>TAT	p.C90Y		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	90	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AGACGACTTTGTGACCTTCGG	0.368		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			17	194	---	---	---	---	capture	Missense_Mutation	SNP	178916882	178916882	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	11816	185
UGT2B10	7365	broad.mit.edu	37	4	69696492	69696492	+	Silent	SNP	G	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69696492G>T	uc003hee.2	+	6	1507	c.1482G>T	c.(1480-1482)GGG>GGT	p.G494G	UGT2B10_uc011cam.1_Silent_p.G410G	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	494	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						ATGTGATTGGGTTCCTGCTGG	0.458													106	176	---	---	---	---	capture	Silent	SNP	69696492	69696492	UGT2B10	4	G	T	T	T	1	0	0	0	0	0	0	0	1	561	44	4	4	16838	185
FAM13A	10144	broad.mit.edu	37	4	89941642	89941642	+	Silent	SNP	C	T	T	rs147082682	byFrequency	TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:89941642C>T	uc003hse.1	-	3	604	c.396G>A	c.(394-396)GCG>GCA	p.A132A	FAM13A_uc003hsf.1_5'UTR|FAM13A_uc003hsh.1_5'UTR|FAM13A_uc003hsi.2_Silent_p.A132A|FAM13A_uc003hsj.2_Silent_p.A132A	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	132	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						GAGGCTGCAACGCTGAGGTGA	0.423													26	40	---	---	---	---	capture	Silent	SNP	89941642	89941642	FAM13A	4	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5406	185
PTGER4	5734	broad.mit.edu	37	5	40681502	40681502	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40681502C>T	uc003jlz.2	+	2	999	c.407C>T	c.(406-408)GCG>GTG	p.A136V		NM_000958	NP_000949	P35408	PE2R4_HUMAN	prostaglandin E receptor 4, subtype EP4	136	Helical; Name=4; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity			lung(2)	2						AAGCGATTGGCGGGCCTCACG	0.597											OREG0016588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	186	---	---	---	---	capture	Missense_Mutation	SNP	40681502	40681502	PTGER4	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12640	185
HSP90AB1	3326	broad.mit.edu	37	6	44217321	44217321	+	Splice_Site	SNP	G	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44217321G>T	uc003oxa.1	+	3	438	c.354_splice	c.e3+1	p.Q118_splice	HSP90AB1_uc011dvr.1_Splice_Site_p.Q118_splice|HSP90AB1_uc003oxb.1_Splice_Site_p.Q118_splice|HSP90AB1_uc011dvs.1_Splice_Site|HSP90AB1_uc003oxc.1_5'Flank	NM_007355	NP_031381	P08238	HS90B_HUMAN	heat shock 90kDa protein 1, beta						axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding			lung(3)|breast(1)	4	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGCTCTTCAGGTATTGCAGTT	0.403													81	129	---	---	---	---	capture	Splice_Site	SNP	44217321	44217321	HSP90AB1	6	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	7327	185
RABGEF1	27342	broad.mit.edu	37	7	66262470	66262470	+	Silent	SNP	T	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:66262470T>C	uc011kee.1	+	6	911	c.747T>C	c.(745-747)GAT>GAC	p.D249D	RABGEF1_uc003tvf.2_Silent_p.D108D|RABGEF1_uc003tvg.2_Silent_p.D43D|RABGEF1_uc010lag.2_Silent_p.D235D|RABGEF1_uc003tvh.2_Silent_p.D235D|RABGEF1_uc003tvi.2_Silent_p.D69D	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	452	VPS9.				endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						AGAAGAAAGATCTTGCCATTC	0.358													57	158	---	---	---	---	capture	Silent	SNP	66262470	66262470	RABGEF1	7	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	12861	185
TRIM50	135892	broad.mit.edu	37	7	72734159	72734159	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72734159C>T	uc010lbd.1	-	3	607	c.482G>A	c.(481-483)CGG>CAG	p.R161Q	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Missense_Mutation_p.R161Q|TRIM50_uc003txz.1_Missense_Mutation_p.R161Q	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN	tripartite motif protein 50A	161	Potential.					cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding			skin(1)	1						GATTCGGGTCCGGTTGTTCAC	0.562													109	343	---	---	---	---	capture	Missense_Mutation	SNP	72734159	72734159	TRIM50	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16409	185
BAIAP2L1	55971	broad.mit.edu	37	7	97922864	97922864	+	Missense_Mutation	SNP	G	A	A	rs140138864		TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97922864G>A	uc003upj.2	-	14	1768	c.1505C>T	c.(1504-1506)ACG>ATG	p.T502M		NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	502	Binds F-actin.			Missing: Loss ability to induce the formation of actin clusters; induce the formation of long filopodia.	filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			GCGATCATTCGTCACAGTCGG	0.547													111	287	---	---	---	---	capture	Missense_Mutation	SNP	97922864	97922864	BAIAP2L1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1291	185
RELN	5649	broad.mit.edu	37	7	103389896	103389896	+	Silent	SNP	T	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103389896T>C	uc003vca.2	-	6	793	c.633A>G	c.(631-633)CAA>CAG	p.Q211Q	RELN_uc010liz.2_Silent_p.Q211Q	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	211					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTAATTGCAGTTGGTGGTAGG	0.353													6	337	---	---	---	---	capture	Silent	SNP	103389896	103389896	RELN	7	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	13115	185
PARP12	64761	broad.mit.edu	37	7	139724367	139724367	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139724367C>T	uc003vvl.1	-	12	2973	c.2099G>A	c.(2098-2100)CGA>CAA	p.R700Q	PARP12_uc003vvk.1_Missense_Mutation_p.R486Q|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	700						nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					CGCTCACTGTCGGCTGCTGAA	0.522													32	48	---	---	---	---	capture	Missense_Mutation	SNP	139724367	139724367	PARP12	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11360	185
OR2F2	135948	broad.mit.edu	37	7	143632582	143632582	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143632582T>C	uc011ktv.1	+	1	257	c.257T>C	c.(256-258)CTT>CCT	p.L86P		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	86	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					GCACATTTTCTTGCAGAACAT	0.522													198	440	---	---	---	---	capture	Missense_Mutation	SNP	143632582	143632582	OR2F2	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	10901	185
SLC4A2	6522	broad.mit.edu	37	7	150759094	150759094	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150759094G>A	uc003wit.3	+	2	276	c.20G>A	c.(19-21)CGC>CAC	p.R7H	SLC4A2_uc011kve.1_5'Flank|SLC4A2_uc003wiu.3_5'Flank	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member	7	Cytoplasmic (Potential).|Pro-rich.			R -> L (in Ref. 1; CAA44067).	bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCCCTCGGCGCCCCGCCAAG	0.667													18	47	---	---	---	---	capture	Missense_Mutation	SNP	150759094	150759094	SLC4A2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14546	185
TRIM14	9830	broad.mit.edu	37	9	100857227	100857227	+	Missense_Mutation	SNP	C	T	T	rs149392923		TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100857227C>T	uc004ayd.2	-	4	640	c.622G>A	c.(622-624)GTC>ATC	p.V208I	TRIM14_uc004ayf.1_Missense_Mutation_p.V115I|TRIM14_uc011luz.1_5'Flank|TRIM14_uc011lva.1_5'Flank|TRIM14_uc004ayg.1_Missense_Mutation_p.V208I|TRIM14_uc004ayh.1_Missense_Mutation_p.V208I|TRIM14_uc004ayi.1_Missense_Mutation_p.V208I|TRIM14_uc004ayj.1_Missense_Mutation_p.V115I	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha	208						cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)				AAGCTCTTGACGGGCTCAAAG	0.582													4	189	---	---	---	---	capture	Missense_Mutation	SNP	100857227	100857227	TRIM14	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16372	185
C9orf163	158055	broad.mit.edu	37	9	139379109	139379109	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139379109G>A	uc004chy.2	+	1	1163	c.209G>A	c.(208-210)GGG>GAG	p.G70E	SEC16A_uc004chx.2_5'Flank|SEC16A_uc010nbo.1_5'Flank	NM_152571	NP_689784	Q8N9P6	CI163_HUMAN	hypothetical protein LOC158055	70							protein binding				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.36e-06)|Epithelial(140;5.65e-06)		GTGAGGGAGGGGGTGATATCC	0.687													17	25	---	---	---	---	capture	Missense_Mutation	SNP	139379109	139379109	C9orf163	9	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	2444	185
PRKX	5613	broad.mit.edu	37	X	3573336	3573336	+	Missense_Mutation	SNP	G	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3573336G>C	uc010nde.2	-	3	820	c.453C>G	c.(451-453)TTC>TTG	p.F151L		NM_005044	NP_005035	P51817	PRKX_HUMAN	protein kinase, X-linked	151	Protein kinase.						ATP binding|cAMP-dependent protein kinase activity			skin(2)|lung(1)	3		all_lung(23;0.000396)|Lung NSC(23;0.00123)				CTGCAGAGTAGAAGAGCCCCG	0.587													65	117	---	---	---	---	capture	Missense_Mutation	SNP	3573336	3573336	PRKX	23	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	12423	185
MSL3	10943	broad.mit.edu	37	X	11790274	11790274	+	Splice_Site	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11790274G>A	uc004cuw.2	+	11	1387	c.1282_splice	c.e11-1	p.V428_splice	MSL3_uc004cux.2_Splice_Site_p.V369_splice|MSL3_uc011mig.1_Splice_Site_p.V279_splice|MSL3_uc011mih.1_Splice_Site_p.V416_splice|MSL3_uc004cuy.2_Splice_Site_p.V262_splice	NM_078629	NP_523353	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3-like 1 isoform a						histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GCTTTTTCCAGGTCCTCTCCT	0.443													186	273	---	---	---	---	capture	Splice_Site	SNP	11790274	11790274	MSL3	23	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	9789	185
XK	7504	broad.mit.edu	37	X	37545375	37545375	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37545375C>T	uc004ddq.2	+	1	243	c.161C>T	c.(160-162)ACG>ATG	p.T54M		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	54	Helical; (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)				GTGCAGCTCACGCTTCTCTTC	0.662													13	33	---	---	---	---	capture	Missense_Mutation	SNP	37545375	37545375	XK	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17312	185
UBA1	7317	broad.mit.edu	37	X	47069360	47069360	+	Silent	SNP	G	C	C			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47069360G>C	uc004dhj.3	+	18	2188	c.2037G>C	c.(2035-2037)CTG>CTC	p.L679L	UBA1_uc004dhk.3_Silent_p.L679L|UBA1_uc004dhm.2_Silent_p.L127L	NM_153280	NP_695012	P22314	UBA1_HUMAN	ubiquitin-activating enzyme E1	679					cell death|protein modification process		ATP binding|ligase activity|protein binding|small protein activating enzyme activity			ovary(1)	1						CACTGCGGCTGGCAGGCACTC	0.607													77	120	---	---	---	---	capture	Silent	SNP	47069360	47069360	UBA1	23	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	16709	185
OTUD5	55593	broad.mit.edu	37	X	48814296	48814296	+	Silent	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48814296G>A	uc004dlu.2	-	1	598	c.537C>T	c.(535-537)GAC>GAT	p.D179D	OTUD5_uc004dlt.3_Silent_p.D179D|OTUD5_uc004dlv.2_Silent_p.D179D|OTUD5_uc011mmp.1_Intron	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN	OTU domain containing 5 isoform a	179					negative regulation of type I interferon production		cysteine-type peptidase activity			pancreas(1)	1						CCTCATACTCGTCCTCACTGT	0.677													3	10	---	---	---	---	capture	Silent	SNP	48814296	48814296	OTUD5	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11219	185
TEX11	56159	broad.mit.edu	37	X	69871358	69871358	+	Silent	SNP	G	A	A			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69871358G>A	uc004dyl.2	-	18	1632	c.1470C>T	c.(1468-1470)AAC>AAT	p.N490N	TEX11_uc004dyk.2_Silent_p.N165N|TEX11_uc004dym.2_Silent_p.N475N	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	490							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					GAGTGAAAACGTTCCTAGGGT	0.358													50	71	---	---	---	---	capture	Silent	SNP	69871358	69871358	TEX11	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15659	185
CXorf57	55086	broad.mit.edu	37	X	105855567	105855567	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105855567C>T	uc004emi.3	+	1	408	c.257C>T	c.(256-258)ACG>ATG	p.T86M	CXorf57_uc004emj.3_Missense_Mutation_p.T86M|CXorf57_uc004emh.2_Missense_Mutation_p.T86M	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	86										ovary(1)|lung(1)|breast(1)	3						CCACGCGACACGGTGCCCAAG	0.557													87	207	---	---	---	---	capture	Missense_Mutation	SNP	105855567	105855567	CXorf57	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4073	185
TMEM164	84187	broad.mit.edu	37	X	109247264	109247264	+	Nonsense_Mutation	SNP	G	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:109247264G>T	uc004eom.2	+	2	581	c.262G>T	c.(262-264)GAG>TAG	p.E88*	TMEM164_uc004eol.2_Intron|TMEM164_uc010npq.2_Nonsense_Mutation_p.E88*	NM_032227	NP_115603	Q5U3C3	TM164_HUMAN	transmembrane protein 164 isoform b	88						integral to membrane				large_intestine(1)|lung(1)|skin(1)	3						GGAAGGCAAGGAGAGCCTGAG	0.617													64	110	---	---	---	---	capture	Nonsense_Mutation	SNP	109247264	109247264	TMEM164	23	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	15962	185
TREX2	11219	broad.mit.edu	37	X	152710600	152710600	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152710600C>T	uc010nue.1	-	3	531	c.415G>A	c.(415-417)GTG>ATG	p.V139M	TREX2_uc010nud.1_Missense_Mutation_p.V97M|TREX2_uc011myp.1_Missense_Mutation_p.V97M|HAUS7_uc004fhl.2_RNA|HAUS7_uc004fhm.2_RNA	NM_080701	NP_542432	Q9BQ50	TREX2_HUMAN	three prime repair exonuclease 2	140					DNA repair	nucleus	3'-5'-exodeoxyribonuclease activity|exodeoxyribonuclease III activity|nucleic acid binding			large_intestine(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTCCGCACCACGGCGCCATCA	0.657								Editing_and_processing_nucleases					13	32	---	---	---	---	capture	Missense_Mutation	SNP	152710600	152710600	TREX2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16360	185
ATP2B3	492	broad.mit.edu	37	X	152830482	152830482	+	Missense_Mutation	SNP	A	T	T			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152830482A>T	uc004fht.1	+	19	3389	c.3263A>T	c.(3262-3264)GAA>GTA	p.E1088V	ATP2B3_uc004fhs.1_Missense_Mutation_p.E1088V|ATP2B3_uc010nuf.1_Missense_Mutation_p.E111V|ATP2B3_uc004fhu.1_Missense_Mutation_p.E11V	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	1088	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GAAGGCGAGGAAGAGATCGAC	0.662													10	23	---	---	---	---	capture	Missense_Mutation	SNP	152830482	152830482	ATP2B3	23	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	1132	185
PCF11	51585	broad.mit.edu	37	11	82878503	82878505	+	In_Frame_Del	DEL	TTG	-	-			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:82878503_82878505delTTG	uc001ozx.3	+	7	2393_2395	c.2048_2050delTTG	c.(2047-2052)CTTGTT>CTT	p.V686del	PCF11_uc010rsu.1_In_Frame_Del_p.V686del	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	686					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						GATGACTTCCTTGTTGTTGTGCA	0.330													22	56	---	---	---	---	capture_indel	In_Frame_Del	DEL	82878503	82878505	PCF11	11	TTG	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	11476	185
TIGD7	91151	broad.mit.edu	37	16	3349388	3349400	+	Frame_Shift_Del	DEL	TTCAGGTTCCTTT	-	-			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3349388_3349400delTTCAGGTTCCTTT	uc002cus.2	-	1	2001_2013	c.1215_1227delAAAGGAACCTGAA	c.(1213-1227)AAAAAGGAACCTGAAfs	p.K405fs	ZNF263_uc002cur.2_3'UTR	NM_033208	NP_149985	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	405_409					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						GAAAATCATATTCAGGTTCCTTTTTGTAAAGAA	0.329													101	382	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	3349388	3349400	TIGD7	16	TTCAGGTTCCTTT	-	-	-	1	0	1	0	1	0	0	0	0	673	52	5	5	15786	185
COIL	8161	broad.mit.edu	37	17	55028016	55028016	+	Frame_Shift_Del	DEL	T	-	-			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:55028016delT	uc002iuu.2	-	2	618	c.587delA	c.(586-588)AAGfs	p.K196fs		NM_004645	NP_004636	P38432	COIL_HUMAN	coilin	196	Lys-rich (basic).					Cajal body|nucleolus	protein C-terminus binding			ovary(1)	1	Breast(9;6.15e-08)					ATTCTTAGCCTTTTTTTTATA	0.393													7	374	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	55028016	55028016	COIL	17	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	3630	185
KIAA0802	23255	broad.mit.edu	37	18	8786006	8786020	+	In_Frame_Del	DEL	CGAGCCGCGCGGGAG	-	-			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:8786006_8786020delCGAGCCGCGCGGGAG	uc002knr.2	+	7	1946_1960	c.1804_1818delCGAGCCGCGCGGGAG	c.(1804-1818)CGAGCCGCGCGGGAGdel	p.RAARE602del	KIAA0802_uc002knq.2_In_Frame_Del_p.RAARE602del|KIAA0802_uc010dkw.1_In_Frame_Del_p.RAARE440del	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	953_957											0						CCTGCGCCTCCGAGCCGCGCGGGAGCTGCACCGCC	0.707													10	26	---	---	---	---	capture_indel	In_Frame_Del	DEL	8786006	8786020	KIAA0802	18	CGAGCCGCGCGGGAG	-	-	-	1	0	1	0	1	0	0	0	0	295	23	5	5	8116	185
MLL4	9757	broad.mit.edu	37	19	36224327	36224327	+	Frame_Shift_Del	DEL	C	-	-			TCGA-26-5136-01	TCGA-26-5136-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36224327delC	uc010eei.2	+	29	6877	c.6877delC	c.(6877-6879)CCCfs	p.P2293fs		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2293					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCCAGCACCTCCCCCATACAA	0.682													3	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	36224327	36224327	MLL4	19	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	9535	185
