Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
UBR4	23352	broad.mit.edu	37	1	19504071	19504071	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19504071T>C	uc001bbi.2	-	19	2525	c.2521A>G	c.(2521-2523)AGC>GGC	p.S841G	UBR4_uc001bbm.1_Missense_Mutation_p.S52G	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	841					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ATGTTGACGCTCAACTCCTGG	0.507													3	136	---	---	---	---	capture	Missense_Mutation	SNP	19504071	19504071	UBR4	1	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	16786	187
ZNF643	65243	broad.mit.edu	37	1	40919923	40919923	+	Missense_Mutation	SNP	G	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40919923G>T	uc001cfn.1	+	2	473	c.176G>T	c.(175-177)AGT>ATT	p.S59I	ZNF643_uc001cfl.1_Intron|ZNF643_uc001cfm.1_5'UTR	NM_023070	NP_075558	Q9UJL9	ZN643_HUMAN	zinc finger protein 643	59					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.25e-18)			AGTTTAGAGAGTAGAGTGACC	0.493													9	13	---	---	---	---	capture	Missense_Mutation	SNP	40919923	40919923	ZNF643	1	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	17937	187
HRNR	388697	broad.mit.edu	37	1	152192865	152192865	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152192865C>T	uc001ezt.1	-	3	1316	c.1240G>A	c.(1240-1242)GGC>AGC	p.G414S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	414	4.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTGTTGGCCGCGGCCTGAA	0.632													32	59	---	---	---	---	capture	Missense_Mutation	SNP	152192865	152192865	HRNR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7284	187
FLG	2312	broad.mit.edu	37	1	152283171	152283171	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152283171G>C	uc001ezu.1	-	3	4227	c.4191C>G	c.(4189-4191)AAC>AAG	p.N1397K	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1397	Ser-rich.|Filaggrin 8.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCCTCACTGTTAGTGACCT	0.567									Ichthyosis				5	507	---	---	---	---	capture	Missense_Mutation	SNP	152283171	152283171	FLG	1	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	5867	187
LCE1C	353133	broad.mit.edu	37	1	152777634	152777634	+	Silent	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152777634G>A	uc001fap.1	-	2	372	c.321C>T	c.(319-321)GGC>GGT	p.G107G		NM_178351	NP_848128	Q5T751	LCE1C_HUMAN	late cornified envelope 1C	107	Gly-rich.				keratinization						0	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CACTCCCCCCGCCACAGCAGC	0.662													37	41	---	---	---	---	capture	Silent	SNP	152777634	152777634	LCE1C	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8581	187
DMBT1	1755	broad.mit.edu	37	10	124376759	124376759	+	Missense_Mutation	SNP	C	G	G			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124376759C>G	uc001lgk.1	+	37	4593	c.4487C>G	c.(4486-4488)TCT>TGT	p.S1496C	DMBT1_uc001lgl.1_Missense_Mutation_p.S1486C|DMBT1_uc001lgm.1_Missense_Mutation_p.S868C|DMBT1_uc009xzz.1_Missense_Mutation_p.S1496C|DMBT1_uc010qtx.1_Missense_Mutation_p.S347C|DMBT1_uc009yab.1_Missense_Mutation_p.S199C	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1496					epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGGCCAACCTCTCGTGCATCA	0.448													54	196	---	---	---	---	capture	Missense_Mutation	SNP	124376759	124376759	DMBT1	10	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	4535	187
CKAP5	9793	broad.mit.edu	37	11	46783673	46783673	+	Silent	SNP	T	C	C			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46783673T>C	uc001ndi.1	-	32	4208	c.4098A>G	c.(4096-4098)AAA>AAG	p.K1366K	CKAP5_uc009ylg.1_Silent_p.K1252K|CKAP5_uc001ndj.1_Silent_p.K1366K|CKAP5_uc001ndh.1_Silent_p.K295K	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	1366	HEAT 10.				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						CCTTTAAGGCTTTTCCTGGGG	0.478													3	40	---	---	---	---	capture	Silent	SNP	46783673	46783673	CKAP5	11	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	3410	187
OR8K3	219473	broad.mit.edu	37	11	56085805	56085805	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56085805C>T	uc010rjf.1	+	1	23	c.23C>T	c.(22-24)ACG>ATG	p.T8M		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					AATCTAACAACGGTGAATGAA	0.413													35	74	---	---	---	---	capture	Missense_Mutation	SNP	56085805	56085805	OR8K3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11148	187
MS4A3	932	broad.mit.edu	37	11	59828705	59828705	+	Silent	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59828705G>A	uc001nom.2	+	2	200	c.72G>A	c.(70-72)GCG>GCA	p.A24A	MS4A3_uc001non.2_Silent_p.A24A|MS4A3_uc001noo.2_Intron	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	24	Cytoplasmic (Potential).			A -> T (in Ref. 1; AAA62319).		endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				GCAGTGAGGCGGGACCAGAAG	0.493													23	53	---	---	---	---	capture	Silent	SNP	59828705	59828705	MS4A3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9771	187
SIPA1	6494	broad.mit.edu	37	11	65417064	65417064	+	Missense_Mutation	SNP	A	C	C			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65417064A>C	uc001ofb.2	+	11	2725	c.2558A>C	c.(2557-2559)AAC>ACC	p.N853T	SIPA1_uc010rom.1_Missense_Mutation_p.N751T|SIPA1_uc001ofd.2_Missense_Mutation_p.N853T	NM_006747	NP_006738	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated protein	853					cell proliferation|cytoskeleton organization|intracellular signal transduction|negative regulation of cell adhesion|negative regulation of cell cycle|negative regulation of cell growth	cytosol|endomembrane system|membrane|perinuclear region of cytoplasm	Rap GTPase activator activity				0						GTCCTGCCCAACACCACCCCG	0.642													30	70	---	---	---	---	capture	Missense_Mutation	SNP	65417064	65417064	SIPA1	11	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	14221	187
MMP3	4314	broad.mit.edu	37	11	102709964	102709964	+	Missense_Mutation	SNP	G	A	A	rs147533686	by1000genomes	TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102709964G>A	uc001phj.1	-	7	1011	c.946C>T	c.(946-948)CGC>TGC	p.R316C		NM_002422	NP_002413	P08254	MMP3_HUMAN	matrix metalloproteinase 3 preproprotein	316	Hemopexin-like 1.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	p.R316C(1)		lung(1)|kidney(1)	2		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)|Simvastatin(DB00641)	AGGGATTTGCGCCAAAAGTGC	0.403													24	73	---	---	---	---	capture	Missense_Mutation	SNP	102709964	102709964	MMP3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9578	187
MANSC1	54682	broad.mit.edu	37	12	12483054	12483054	+	Silent	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:12483054G>A	uc001rai.1	-	4	1461	c.1203C>T	c.(1201-1203)CTC>CTT	p.L401L	MANSC1_uc010shm.1_Silent_p.L335L|MANSC1_uc001raj.1_Silent_p.L367L|MANSC1_uc009zht.1_Silent_p.L320L	NM_018050	NP_060520	Q9H8J5	MANS1_HUMAN	MANSC domain containing 1 precursor	401	Helical; (Potential).					integral to membrane					0		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		CCAGGAGGACGAGGCCTATCA	0.488													18	38	---	---	---	---	capture	Silent	SNP	12483054	12483054	MANSC1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	9138	187
C14orf39	317761	broad.mit.edu	37	14	60945101	60945101	+	Missense_Mutation	SNP	C	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:60945101C>A	uc001xez.3	-	5	350	c.240G>T	c.(238-240)AAG>AAT	p.K80N	C14orf39_uc010apo.2_Intron	NM_174978	NP_777638	Q08AQ4	Q08AQ4_HUMAN	hypothetical protein LOC317761	80										ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		CACATGTTGGCTTCCAGCTAT	0.259													11	29	---	---	---	---	capture	Missense_Mutation	SNP	60945101	60945101	C14orf39	14	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	1758	187
ZFP36L1	677	broad.mit.edu	37	14	69256954	69256954	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:69256954G>A	uc001xkh.1	-	2	443	c.313C>T	c.(313-315)CCC>TCC	p.P105S	ZFP36L1_uc001xki.1_Missense_Mutation_p.P105S	NM_004926	NP_004917	Q07352	TISB_HUMAN	butyrate response factor 1	105					regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CCGCCCCCGGGCTGCTTCTGG	0.672											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	53	---	---	---	---	capture	Missense_Mutation	SNP	69256954	69256954	ZFP36L1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17526	187
ACAN	176	broad.mit.edu	37	15	89386651	89386651	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89386651C>T	uc010upo.1	+	6	1197	c.823C>T	c.(823-825)CGG>TGG	p.R275W	ACAN_uc002bmx.2_Missense_Mutation_p.R275W|ACAN_uc010upp.1_Missense_Mutation_p.R275W|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	275					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TGAGTGCCGGCGGCTGGGTGC	0.642													6	18	---	---	---	---	capture	Missense_Mutation	SNP	89386651	89386651	ACAN	15	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	117	187
AMDHD2	51005	broad.mit.edu	37	16	2580611	2580611	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2580611C>T	uc010uwc.1	+	11	1733	c.1636C>T	c.(1636-1638)CGC>TGC	p.R546C	AMDHD2_uc010uwd.1_Missense_Mutation_p.R310C|CEMP1_uc002cqr.2_Missense_Mutation_p.R155H	NM_001145815	NP_001139287	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2 isoform 2	Error:Variant_position_missing_in_Q9Y303_after_alignment					N-acetylglucosamine metabolic process		N-acetylglucosamine-6-phosphate deacetylase activity			skin(2)|large_intestine(1)|breast(1)	4						AGGAGGTACGCGCCTGGCTCT	0.567													29	67	---	---	---	---	capture	Missense_Mutation	SNP	2580611	2580611	AMDHD2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	568	187
ATXN2L	11273	broad.mit.edu	37	16	28847275	28847275	+	Missense_Mutation	SNP	A	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28847275A>T	uc002drc.2	+	22	3085	c.2917A>T	c.(2917-2919)ACA>TCA	p.T973S	uc010vct.1_Intron|ATXN2L_uc002drb.2_Missense_Mutation_p.T973S|ATXN2L_uc002dqy.2_Missense_Mutation_p.T973S|ATXN2L_uc002dra.2_Missense_Mutation_p.T973S|ATXN2L_uc002dqz.2_Missense_Mutation_p.T973S|ATXN2L_uc010vdb.1_Missense_Mutation_p.T979S|ATXN2L_uc002dre.2_Missense_Mutation_p.T973S|ATXN2L_uc002drf.2_Missense_Mutation_p.T382S|ATXN2L_uc002drg.2_Missense_Mutation_p.T256S	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	973						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AACTGGAATCACAGCAGCCCC	0.622													20	88	---	---	---	---	capture	Missense_Mutation	SNP	28847275	28847275	ATXN2L	16	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	1203	187
MYH8	4626	broad.mit.edu	37	17	10304645	10304645	+	Nonsense_Mutation	SNP	T	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10304645T>A	uc002gmm.2	-	24	3150	c.3055A>T	c.(3055-3057)AAA>TAA	p.K1019*	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1019	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						ATGTTGACTTTGTCCTCCTCT	0.438									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				42	138	---	---	---	---	capture	Nonsense_Mutation	SNP	10304645	10304645	MYH8	17	T	A	A	A	1	0	0	0	0	0	1	0	0	819	63	5	4	9951	187
NLE1	54475	broad.mit.edu	37	17	33463392	33463392	+	Missense_Mutation	SNP	A	G	G			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33463392A>G	uc002hiy.1	-	8	981	c.953T>C	c.(952-954)CTC>CCC	p.L318P	NLE1_uc010ctn.1_Missense_Mutation_p.L26P|NLE1_uc002hiz.1_Missense_Mutation_p.L26P	NM_018096	NP_060566	Q9NVX2	NLE1_HUMAN	Notchless gene homolog isoform a	318						nucleolus				breast(3)|ovary(1)	4		Ovarian(249;0.17)				GGATCCTTGGAGGTCTTGGGG	0.567													4	275	---	---	---	---	capture	Missense_Mutation	SNP	33463392	33463392	NLE1	17	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10367	187
EPX	8288	broad.mit.edu	37	17	56270743	56270743	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56270743G>A	uc002ivq.2	+	3	268	c.182G>A	c.(181-183)CGG>CAG	p.R61Q		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein	61					hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2						ATCAAGCAGCGGCTTCGCAGC	0.612													24	103	---	---	---	---	capture	Missense_Mutation	SNP	56270743	56270743	EPX	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5155	187
XAB2	56949	broad.mit.edu	37	19	7687257	7687257	+	Missense_Mutation	SNP	A	G	G			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7687257A>G	uc002mgx.2	-	12	1603	c.1577T>C	c.(1576-1578)ATG>ACG	p.M526T		NM_020196	NP_064581	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	526	HAT 10.				transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding			central_nervous_system(2)|breast(1)|skin(1)	4						CTCCAGGAACATGGCATAGTT	0.607								Direct_reversal_of_damage|NER					42	132	---	---	---	---	capture	Missense_Mutation	SNP	7687257	7687257	XAB2	19	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	17299	187
NDUFA3	4696	broad.mit.edu	37	19	54609317	54609317	+	Silent	SNP	A	C	C			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54609317A>C	uc002qde.2	+	3	189	c.162A>C	c.(160-162)CCA>CCC	p.P54P	NDUFA3_uc002qdf.2_RNA	NM_004542	NP_004533	O95167	NDUA3_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	54					mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)				NADH(DB00157)	ACAACTACCCAGGTGAGTGGG	0.577													17	50	---	---	---	---	capture	Silent	SNP	54609317	54609317	NDUFA3	19	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	10172	187
ZNF497	162968	broad.mit.edu	37	19	58868065	58868065	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58868065C>T	uc002qsh.1	-	3	1126	c.937G>A	c.(937-939)GAG>AAG	p.E313K	A1BG_uc002qsf.1_Intron|ZNF497_uc002qsi.1_Missense_Mutation_p.E313K|uc002qsj.1_5'Flank|uc002qsk.1_5'Flank	NM_198458	NP_940860	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	313	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(2)	2		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)		TGCGAGCTCTCGCGGAAAGCC	0.701													6	7	---	---	---	---	capture	Missense_Mutation	SNP	58868065	58868065	ZNF497	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17825	187
ARHGAP15	55843	broad.mit.edu	37	2	144381721	144381721	+	Silent	SNP	C	T	T	rs138120208		TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:144381721C>T	uc002tvm.3	+	12	1174	c.1023C>T	c.(1021-1023)GAC>GAT	p.D341D	ARHGAP15_uc002tvn.2_Silent_p.D107D	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	341	Rho-GAP.				regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)		TGAATTTGGACGACAGCCAGT	0.448													18	46	---	---	---	---	capture	Silent	SNP	144381721	144381721	ARHGAP15	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	859	187
ZDBF2	57683	broad.mit.edu	37	2	207174442	207174442	+	Silent	SNP	G	A	A	rs140337696	by1000genomes	TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207174442G>A	uc002vbp.2	+	5	5440	c.5190G>A	c.(5188-5190)TCG>TCA	p.S1730S		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1730							nucleic acid binding|zinc ion binding			ovary(3)	3						AAAAACGTTCGAAGCTAAAAC	0.458													17	36	---	---	---	---	capture	Silent	SNP	207174442	207174442	ZDBF2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	17479	187
NTSR1	4923	broad.mit.edu	37	20	61340986	61340986	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61340986G>A	uc002ydf.2	+	1	798	c.427G>A	c.(427-429)GGC>AGC	p.G143S		NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1	143	Helical; Name=3; (Potential).					endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			CGGCTGCCGCGGCTACTACTT	0.677													18	62	---	---	---	---	capture	Missense_Mutation	SNP	61340986	61340986	NTSR1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10617	187
EP300	2033	broad.mit.edu	37	22	41556657	41556657	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41556657G>A	uc003azl.3	+	20	3997	c.3602G>A	c.(3601-3603)TGT>TAT	p.C1201Y		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1201					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding	p.Y1198_L1243del(1)		haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						TATCATTTCTGTGAGAAGTGT	0.488			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				20	51	---	---	---	---	capture	Missense_Mutation	SNP	41556657	41556657	EP300	22	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5103	187
ITGA9	3680	broad.mit.edu	37	3	37555330	37555330	+	Missense_Mutation	SNP	C	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:37555330C>A	uc003chd.2	+	9	1027	c.974C>A	c.(973-975)GCC>GAC	p.A325D	ITGA9_uc003chc.2_Missense_Mutation_p.A325D	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	325	Extracellular (Potential).|FG-GAP 5.				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		CTGGTGGGGGCCCCCATGTTT	0.547													28	71	---	---	---	---	capture	Missense_Mutation	SNP	37555330	37555330	ITGA9	3	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	7806	187
NBEAL2	23218	broad.mit.edu	37	3	47040321	47040321	+	Silent	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47040321C>T	uc003cqp.2	+	23	3515	c.3336C>T	c.(3334-3336)GTC>GTT	p.V1112V	NBEAL2_uc010hjm.1_Silent_p.V673V	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1112							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		ACGTGCAGGTCACGCAGACCA	0.672											OREG0015546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	9	---	---	---	---	capture	Silent	SNP	47040321	47040321	NBEAL2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	10096	187
NLGN1	22871	broad.mit.edu	37	3	173525621	173525621	+	Silent	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:173525621C>T	uc003fio.1	+	4	1068	c.645C>T	c.(643-645)CTC>CTT	p.L215L	NLGN1_uc010hww.1_Silent_p.L255L|NLGN1_uc003fip.1_Silent_p.L215L	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	232	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TTGGAGTACTCGGTAAGAAGA	0.323													14	48	---	---	---	---	capture	Silent	SNP	173525621	173525621	NLGN1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	10368	187
CLNK	116449	broad.mit.edu	37	4	10522452	10522452	+	Silent	SNP	A	G	G			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:10522452A>G	uc003gmo.3	-	15	872	c.735T>C	c.(733-735)TCT>TCC	p.S245S		NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer	245	Poly-Ser.				immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						TCGTGAATGAAGAACTATAAG	0.363													7	6	---	---	---	---	capture	Silent	SNP	10522452	10522452	CLNK	4	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	3512	187
SLC30A9	10463	broad.mit.edu	37	4	42080309	42080309	+	Silent	SNP	A	G	G			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:42080309A>G	uc003gwl.2	+	17	1775	c.1629A>G	c.(1627-1629)GGA>GGG	p.G543G	SLC30A9_uc011byx.1_Silent_p.G303G	NM_006345	NP_006336	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter),	543					nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3						ATACTTTAGGAGCTGAAGTAG	0.239													3	70	---	---	---	---	capture	Silent	SNP	42080309	42080309	SLC30A9	4	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	14454	187
SMR3B	10879	broad.mit.edu	37	4	71255517	71255517	+	Silent	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71255517C>T	uc011cas.1	+	3	273	c.192C>T	c.(190-192)CCC>CCT	p.P64P	SMR3B_uc003hfh.2_Silent_p.P64P	NM_006685	NP_006676	P02814	SMR3B_HUMAN	submaxillary gland androgen regulated protein 3	64	Poly-Pro.|Pro-rich.					extracellular space				skin(1)	1		all_hematologic(202;0.196)				CTCCTCCTCCCGCACCCTATG	0.602													25	75	---	---	---	---	capture	Silent	SNP	71255517	71255517	SMR3B	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14704	187
IRX1	79192	broad.mit.edu	37	5	3599499	3599499	+	Missense_Mutation	SNP	T	G	G			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:3599499T>G	uc003jde.2	+	2	489	c.437T>G	c.(436-438)CTC>CGC	p.L146R		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	146	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						AAGGCCTGGCTCAACGAGCAC	0.637													13	59	---	---	---	---	capture	Missense_Mutation	SNP	3599499	3599499	IRX1	5	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	7766	187
MAP3K1	4214	broad.mit.edu	37	5	56176540	56176540	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56176540G>A	uc003jqw.3	+	12	2591	c.2090G>A	c.(2089-2091)CGC>CAC	p.R697H		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	697					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GTTTTTAGCCGCACAAGTCAG	0.398													3	41	---	---	---	---	capture	Missense_Mutation	SNP	56176540	56176540	MAP3K1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9157	187
CMYA5	202333	broad.mit.edu	37	5	79029879	79029879	+	Missense_Mutation	SNP	G	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79029879G>T	uc003kgc.2	+	2	5363	c.5291G>T	c.(5290-5292)GGA>GTA	p.G1764V		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1764						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTTAAAAAGGGAGGAAATCAA	0.413													24	70	---	---	---	---	capture	Missense_Mutation	SNP	79029879	79029879	CMYA5	5	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	3555	187
FAM81B	153643	broad.mit.edu	37	5	94749823	94749823	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94749823G>A	uc003kla.1	+	4	512	c.466G>A	c.(466-468)GCC>ACC	p.A156T	FAM81B_uc010jbe.1_5'UTR	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	156										ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		GGAATCGCTCGCCAGGAAGTT	0.458													21	45	---	---	---	---	capture	Missense_Mutation	SNP	94749823	94749823	FAM81B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5575	187
GABRA6	2559	broad.mit.edu	37	5	161128647	161128647	+	Silent	SNP	C	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161128647C>A	uc003lyu.2	+	9	1568	c.1230C>A	c.(1228-1230)GCC>GCA	p.A410A	GABRA6_uc003lyv.2_Silent_p.A181A	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	410	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TCTCGCCAGCCTTTGGAGGCA	0.468										TCGA Ovarian(5;0.080)			15	51	---	---	---	---	capture	Silent	SNP	161128647	161128647	GABRA6	5	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	6107	187
CAP2	10486	broad.mit.edu	37	6	17543298	17543298	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17543298G>A	uc003ncb.2	+	11	1376	c.1133G>A	c.(1132-1134)TGT>TAT	p.C378Y	CAP2_uc010jpk.1_RNA|CAP2_uc011dja.1_Missense_Mutation_p.C352Y|CAP2_uc011djb.1_Missense_Mutation_p.C314Y|CAP2_uc011djc.1_Missense_Mutation_p.C266Y|CAP2_uc011djd.1_Missense_Mutation_p.C118Y	NM_006366	NP_006357	P40123	CAP2_HUMAN	adenylyl cyclase-associated protein 2	378	C-CAP/cofactor C-like.				activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			ACAGACAACTGTAAAAAACTC	0.403													58	141	---	---	---	---	capture	Missense_Mutation	SNP	17543298	17543298	CAP2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	2596	187
ROS1	6098	broad.mit.edu	37	6	117638305	117638305	+	Splice_Site	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117638305C>T	uc003pxp.1	-	38	6334	c.6135_splice	c.e38+1	p.T2045_splice	ROS1_uc011ebi.1_Splice_Site	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CAACTGCCTACCGTTGCCATC	0.403			T	GOPC|ROS1	glioblastoma|NSCLC								38	98	---	---	---	---	capture	Splice_Site	SNP	117638305	117638305	ROS1	6	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	13423	187
DAGLB	221955	broad.mit.edu	37	7	6449599	6449599	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6449599G>A	uc003sqa.2	-	15	2058	c.1888C>T	c.(1888-1890)CTC>TTC	p.L630F	DAGLB_uc003spy.2_Missense_Mutation_p.L176F|DAGLB_uc003spz.2_Missense_Mutation_p.L327F|DAGLB_uc011jwt.1_Missense_Mutation_p.L444F|DAGLB_uc011jwu.1_Missense_Mutation_p.L501F|DAGLB_uc003sqb.2_Missense_Mutation_p.L349F|DAGLB_uc003sqc.2_Missense_Mutation_p.L349F|DAGLB_uc011jwv.1_RNA|DAGLB_uc003sqd.3_Missense_Mutation_p.L589F	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1	630	Cytoplasmic (Potential).				lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GGACCTATGAGTATTTTGCTG	0.577													33	116	---	---	---	---	capture	Missense_Mutation	SNP	6449599	6449599	DAGLB	7	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	4186	187
FBXO24	26261	broad.mit.edu	37	7	100198322	100198322	+	Missense_Mutation	SNP	A	G	G			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100198322A>G	uc003uvm.1	+	10	1836	c.1543A>G	c.(1543-1545)ATG>GTG	p.M515V	FBXO24_uc003uvn.1_Missense_Mutation_p.M153V|uc011kjy.1_Intron|FBXO24_uc011kjz.1_Missense_Mutation_p.M553V|FBXO24_uc011kka.1_Missense_Mutation_p.M503V|PCOLCE_uc011kkb.1_5'Flank|PCOLCE_uc003uvo.2_5'Flank|PCOLCE_uc010lhb.1_5'Flank	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1	515						ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CCCCGGGGGGATGGCCCAGGC	0.662													3	83	---	---	---	---	capture	Missense_Mutation	SNP	100198322	100198322	FBXO24	7	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	5681	187
NOM1	64434	broad.mit.edu	37	7	156743012	156743012	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:156743012G>A	uc003wmy.2	+	1	596	c.581G>A	c.(580-582)GGT>GAT	p.G194D		NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	194	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.				RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CGTTGCCTCGGTTTGAACAAG	0.617													21	172	---	---	---	---	capture	Missense_Mutation	SNP	156743012	156743012	NOM1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	10437	187
CYP11B1	1584	broad.mit.edu	37	8	143960555	143960555	+	Silent	SNP	G	A	A	rs5284		TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143960555G>A	uc003yxi.2	-	2	295	c.288C>T	c.(286-288)GAC>GAT	p.D96D	CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Silent_p.D96D|CYP11B1_uc010mey.2_Silent_p.D141D	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	96					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	GCTTCTCCACGTCCTCCGGCA	0.627									Familial_Hyperaldosteronism_type_I				35	56	---	---	---	---	capture	Silent	SNP	143960555	143960555	CYP11B1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4105	187
CACNA1B	774	broad.mit.edu	37	9	140809200	140809200	+	Silent	SNP	C	T	T			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140809200C>T	uc004cog.2	+	5	862	c.717C>T	c.(715-717)ATC>ATT	p.I239I		NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	239	Helical; Name=S5 of repeat I; (Potential).|I.				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TGTTTGCCATCATTGGCCTGG	0.567													7	26	---	---	---	---	capture	Silent	SNP	140809200	140809200	CACNA1B	9	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	2515	187
OR10R2	343406	broad.mit.edu	37	1	158449884	158449884	+	Frame_Shift_Del	DEL	A	-	-			TCGA-26-6173-01	TCGA-26-6173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158449884delA	uc010pik.1	+	1	217	c.217delA	c.(217-219)AAAfs	p.K73fs	uc001fso.1_RNA	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R,	73	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)					CCACCTGGATAAAAGCCTCCA	0.418													33	183	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	158449884	158449884	OR10R2	1	A	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	10821	187
