Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
COL16A1	1307	broad.mit.edu	37	1	32163660	32163660	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32163660C>T	uc001btk.1	-	6	869	c.504G>A	c.(502-504)TGG>TGA	p.W168*	COL16A1_uc001btj.1_5'UTR|COL16A1_uc001btl.3_Nonsense_Mutation_p.W168*	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	168	TSP N-terminal.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TCAGCTTGTGCCAACGCAAGT	0.642													4	132	---	---	---	---	capture	Nonsense_Mutation	SNP	32163660	32163660	COL16A1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	3638	189
FGGY	55277	broad.mit.edu	37	1	59805657	59805657	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:59805657C>T	uc001czi.3	+	3	441	c.229C>T	c.(229-231)CAA>TAA	p.Q77*	FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_RNA|FGGY_uc009wac.2_Nonsense_Mutation_p.Q77*|FGGY_uc001czj.3_Nonsense_Mutation_p.Q77*|FGGY_uc001czk.3_5'UTR|FGGY_uc001czl.3_Intron	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	77					carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					TGATTTAAACCAAATTCGAGG	0.363													3	41	---	---	---	---	capture	Nonsense_Mutation	SNP	59805657	59805657	FGGY	1	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	5817	189
MSH4	4438	broad.mit.edu	37	1	76349367	76349367	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:76349367A>T	uc001dhd.1	+	15	2009	c.1968A>T	c.(1966-1968)AAA>AAT	p.K656N		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	656					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						TTCTTGAAAAAATATCTGCGG	0.313								MMR					44	78	---	---	---	---	capture	Missense_Mutation	SNP	76349367	76349367	MSH4	1	A	T	T	T	1	0	0	0	0	1	0	0	0	11	1	4	4	9782	189
SYCP1	6847	broad.mit.edu	37	1	115487554	115487554	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115487554G>A	uc001efr.2	+	25	2314	c.2105G>A	c.(2104-2106)CGA>CAA	p.R702Q	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.R702Q|SYCP1_uc009wgw.2_Missense_Mutation_p.R702Q	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	702	Potential.				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTGATAAGCGATGTCAACAT	0.254													10	18	---	---	---	---	capture	Missense_Mutation	SNP	115487554	115487554	SYCP1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15319	189
PTGFRN	5738	broad.mit.edu	37	1	117484643	117484643	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117484643G>T	uc001egv.1	+	2	493	c.356G>T	c.(355-357)TGT>TTT	p.C119F		NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator	119	Extracellular (Potential).|Ig-like C2-type 1.					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CACTACAAATGTTCAACCCCC	0.483													41	89	---	---	---	---	capture	Missense_Mutation	SNP	117484643	117484643	PTGFRN	1	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	12645	189
PRG4	10216	broad.mit.edu	37	1	186276526	186276526	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186276526G>A	uc001gru.3	+	7	1726	c.1675G>A	c.(1675-1677)GAG>AAG	p.E559K	PRG4_uc001grt.3_Missense_Mutation_p.E518K|PRG4_uc009wyl.2_Missense_Mutation_p.E466K|PRG4_uc009wym.2_Missense_Mutation_p.E425K|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	559	28.|59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CACCACCAAGGAGCCTGCACC	0.637													5	78	---	---	---	---	capture	Missense_Mutation	SNP	186276526	186276526	PRG4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12377	189
CR2	1380	broad.mit.edu	37	1	207649599	207649599	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207649599C>T	uc001hfw.2	+	14	2654	c.2560C>T	c.(2560-2562)CCG>TCG	p.P854S	CR2_uc001hfv.2_Missense_Mutation_p.P913S|CR2_uc009xch.2_Intron	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	854	Sushi 14.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						GTGTCCACCTCCGCCTAAGAC	0.493													37	103	---	---	---	---	capture	Missense_Mutation	SNP	207649599	207649599	CR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	3807	189
ANK3	288	broad.mit.edu	37	10	61836046	61836046	+	Silent	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:61836046C>T	uc001jky.2	-	37	4785	c.4593G>A	c.(4591-4593)ACG>ACA	p.T1531T	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1531	Ser-rich.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						AAGCTGATGGCGTATTAGAGG	0.443													59	57	---	---	---	---	capture	Silent	SNP	61836046	61836046	ANK3	10	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	619	189
TLL2	7093	broad.mit.edu	37	10	98157009	98157009	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98157009G>A	uc001kml.1	-	11	1544	c.1318C>T	c.(1318-1320)CGG>TGG	p.R440W	TLL2_uc009xvf.1_Missense_Mutation_p.R418W	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	440	CUB 1.				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		ACCCAGAGCCGGCTGTCCGTG	0.587													27	34	---	---	---	---	capture	Missense_Mutation	SNP	98157009	98157009	TLL2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	15831	189
RAG1	5896	broad.mit.edu	37	11	36596877	36596877	+	Silent	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36596877C>T	uc001mwu.3	+	2	2147	c.2023C>T	c.(2023-2025)CTG>TTG	p.L675L	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	675					histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				GACTGCCATCCTGAGTCCTCT	0.498									Familial_Hemophagocytic_Lymphohistiocytosis				3	80	---	---	---	---	capture	Silent	SNP	36596877	36596877	RAG1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	12898	189
FOLH1	2346	broad.mit.edu	37	11	49186293	49186293	+	Silent	SNP	C	T	T	rs141224157	by1000genomes	TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:49186293C>T	uc001ngy.2	-	13	1665	c.1404G>A	c.(1402-1404)CCG>CCA	p.P468P	FOLH1_uc001ngz.2_Silent_p.P468P|FOLH1_uc009yly.2_Silent_p.P453P|FOLH1_uc009ylz.2_Silent_p.P453P|FOLH1_uc009yma.2_Silent_p.P160P	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	468	NAALADase.|Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	TGTACATCAGCGGTGTACAAT	0.284													3	31	---	---	---	---	capture	Silent	SNP	49186293	49186293	FOLH1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5923	189
VWF	7450	broad.mit.edu	37	12	6127888	6127888	+	Nonsense_Mutation	SNP	G	A	A	rs61750112		TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6127888G>A	uc001qnn.1	-	28	4946	c.4696C>T	c.(4696-4698)CGA>TGA	p.R1566*	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1566	VWFA 2.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CGGATCTCTCGCACCCGCTGC	0.473													23	113	---	---	---	---	capture	Nonsense_Mutation	SNP	6127888	6127888	VWF	12	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	17128	189
CD163L1	283316	broad.mit.edu	37	12	7528295	7528295	+	Splice_Site	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7528295C>T	uc001qsy.2	-	10	2712	c.2686_splice	c.e10+1	p.R896_splice	CD163L1_uc010sge.1_Splice_Site_p.R906_splice	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1							extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						AAAAATCTCACGGGAACAGAC	0.468													41	106	---	---	---	---	capture	Splice_Site	SNP	7528295	7528295	CD163L1	12	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	2939	189
KRT8	3856	broad.mit.edu	37	12	53294405	53294405	+	Silent	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53294405G>A	uc001sbd.2	-	4	760	c.657C>T	c.(655-657)GAC>GAT	p.D219D	KRT8_uc009zmj.2_Silent_p.D219D|KRT8_uc009zmk.1_Silent_p.D247D|KRT8_uc009zml.1_Silent_p.D219D|KRT8_uc009zmm.1_Silent_p.D219D	NM_002273	NP_002264	P05787	K2C8_HUMAN	keratin 8	219	Coil 1B.|Rod.				cytoskeleton organization|interspecies interaction between organisms	cytoplasm|keratin filament|nuclear matrix|nucleoplasm	protein binding|structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.108)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGTTGATCTCGTCGGTCAGCC	0.572													25	70	---	---	---	---	capture	Silent	SNP	53294405	53294405	KRT8	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8413	189
IRAK3	11213	broad.mit.edu	37	12	66597512	66597512	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66597512G>A	uc001sth.2	+	2	257	c.155G>A	c.(154-156)TGG>TAG	p.W52*	IRAK3_uc010ssy.1_Intron	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3	52	Death.				interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		TCAAGCAGCTGGCTGGATGTT	0.363													38	66	---	---	---	---	capture	Nonsense_Mutation	SNP	66597512	66597512	IRAK3	12	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	7747	189
SBNO1	55206	broad.mit.edu	37	12	123794321	123794321	+	Silent	SNP	C	T	T	rs145298684	by1000genomes	TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123794321C>T	uc010tap.1	-	25	3378	c.3378G>A	c.(3376-3378)GCG>GCA	p.A1126A	SBNO1_uc009zxv.2_RNA|SBNO1_uc010tao.1_Silent_p.A1125A|SBNO1_uc010taq.1_Silent_p.A77A|SBNO1_uc001ues.1_Silent_p.A77A	NM_018183	NP_060653	A3KN83	SBNO1_HUMAN	sno, strawberry notch homolog 1	1126							ATP binding|DNA binding|hydrolase activity			breast(5)|skin(2)|ovary(1)|kidney(1)	9	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TAAGTGTGTCCGCAAAATACT	0.358													78	220	---	---	---	---	capture	Silent	SNP	123794321	123794321	SBNO1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13754	189
CLCN7	1186	broad.mit.edu	37	16	1498997	1498997	+	Silent	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1498997G>A	uc002clv.2	-	19	1877	c.1767C>T	c.(1765-1767)ACC>ACT	p.T589T	CLCN7_uc010brq.1_5'Flank|CLCN7_uc002clu.2_Silent_p.T37T|CLCN7_uc002clw.2_Silent_p.T565T	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	589	Helical; (By similarity).					integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				CGATCTTGGCGGTCATGAGCA	0.632													20	42	---	---	---	---	capture	Silent	SNP	1498997	1498997	CLCN7	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3433	189
CLCN7	1186	broad.mit.edu	37	16	1510943	1510943	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1510943G>A	uc002clv.2	-	5	468	c.358C>T	c.(358-360)CGG>TGG	p.R120W	CLCN7_uc002clw.2_Missense_Mutation_p.R96W	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	120	Cytoplasmic (By similarity).					integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				TCCACCGTCCGGAAGGCCTGC	0.682													3	74	---	---	---	---	capture	Missense_Mutation	SNP	1510943	1510943	CLCN7	16	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	3433	189
ZNF19	7567	broad.mit.edu	37	16	71509676	71509676	+	Silent	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71509676G>A	uc010cgc.1	-	6	1280	c.774C>T	c.(772-774)TCC>TCT	p.S258S	ZNF23_uc002fai.2_Intron|ZNF19_uc002fak.1_Silent_p.S246S|ZNF19_uc002fal.1_Silent_p.S246S|ZNF19_uc002fam.1_Silent_p.S258S	NM_006961	NP_008892	P17023	ZNF19_HUMAN	zinc finger protein 19	258	C2H2-type 4.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		TAACAAACTCGGAACTACTCG	0.438													23	123	---	---	---	---	capture	Silent	SNP	71509676	71509676	ZNF19	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17635	189
CHST6	4166	broad.mit.edu	37	16	75513068	75513068	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75513068C>T	uc002fef.2	-	3	839	c.659G>A	c.(658-660)CGT>CAT	p.R220H	CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Missense_Mutation_p.R220H	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	220	Lumenal (Potential).				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						GCCGTTGTCACGCGCCAGAGC	0.721													28	49	---	---	---	---	capture	Missense_Mutation	SNP	75513068	75513068	CHST6	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3373	189
SLC38A8	146167	broad.mit.edu	37	16	84066963	84066963	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84066963G>A	uc002fhg.1	-	3	500	c.500C>T	c.(499-501)CCG>CTG	p.P167L		NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	167	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane					0						GATCTCCCGCGGGGCAGACAG	0.652													17	317	---	---	---	---	capture	Missense_Mutation	SNP	84066963	84066963	SLC38A8	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14502	189
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	T	T	rs11540652		TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577538C>T	uc002gim.2	-	7	937	c.743G>A	c.(742-744)CGG>CAG	p.R248Q	TP53_uc002gig.1_Missense_Mutation_p.R248Q|TP53_uc002gih.2_Missense_Mutation_p.R248Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116Q|TP53_uc010cng.1_Missense_Mutation_p.R116Q|TP53_uc002gii.1_Missense_Mutation_p.R116Q|TP53_uc010cnh.1_Missense_Mutation_p.R248Q|TP53_uc010cni.1_Missense_Mutation_p.R248Q|TP53_uc002gij.2_Missense_Mutation_p.R248Q|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155Q|TP53_uc002gio.2_Missense_Mutation_p.R116Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GATGGGCCTCCGGTTCATGCC	0.572	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			52	37	---	---	---	---	capture	Missense_Mutation	SNP	7577538	7577538	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	189
MSL1	339287	broad.mit.edu	37	17	38285515	38285515	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38285515G>A	uc002hub.2	+	3	426	c.407G>A	c.(406-408)AGT>AAT	p.S136N	MSL1_uc002hua.3_Missense_Mutation_p.S74N|MSL1_uc002huc.2_Missense_Mutation_p.S74N|MSL1_uc002hud.2_5'Flank	NM_001012241	NP_001012241	Q68DK7	MSL1_HUMAN	hampin	337					histone H4-K16 acetylation	MSL complex					0						CCATTTGGAAGTACAGAAAGA	0.333													5	149	---	---	---	---	capture	Missense_Mutation	SNP	38285515	38285515	MSL1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	9787	189
IFI35	3430	broad.mit.edu	37	17	41166266	41166266	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41166266G>A	uc010whj.1	+	7	1013	c.817G>A	c.(817-819)GTA>ATA	p.V273I		NM_005533	NP_005524	P80217	IN35_HUMAN	interferon-induced protein 35	271				EVEALTVVPQGQQGLAVFTSESG -> GRGPDSRTPRTAGP SSLHL (in Ref. 1; no nucleotide entry).	response to virus|type I interferon-mediated signaling pathway	nucleus	protein binding			ovary(1)	1		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		CCTGACAGTCGTACCCCAAGG	0.632													57	36	---	---	---	---	capture	Missense_Mutation	SNP	41166266	41166266	IFI35	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7441	189
ACE	1636	broad.mit.edu	37	17	61566027	61566027	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61566027C>T	uc002jau.1	+	16	2346	c.2324C>T	c.(2323-2325)GCC>GTC	p.A775V	ACE_uc002jav.1_Missense_Mutation_p.A201V|ACE_uc010ddv.1_Missense_Mutation_p.A2V|ACE_uc010wpj.1_Missense_Mutation_p.A201V|ACE_uc002jaw.1_RNA|ACE_uc010wpk.1_Missense_Mutation_p.A85V	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	775	Extracellular (Potential).|Peptidase M2 2.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	AATGTGATGGCCACGTCCCGG	0.542													5	190	---	---	---	---	capture	Missense_Mutation	SNP	61566027	61566027	ACE	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	136	189
DSG3	1830	broad.mit.edu	37	18	29054117	29054117	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29054117C>T	uc002kws.2	+	15	2244	c.2135C>T	c.(2134-2136)GCG>GTG	p.A712V	DSG3_uc002kwt.2_5'UTR	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	712	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AGAGGCACAGCGGTGGAAGGC	0.443													28	103	---	---	---	---	capture	Missense_Mutation	SNP	29054117	29054117	DSG3	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4733	189
ATP5A1	498	broad.mit.edu	37	18	43667414	43667414	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43667414C>A	uc002lbr.1	-	7	934	c.844G>T	c.(844-846)GCT>TCT	p.A282S	ATP5A1_uc010dnl.1_Missense_Mutation_p.A232S|ATP5A1_uc002lbs.1_Missense_Mutation_p.A232S|ATP5A1_uc002lbt.1_Missense_Mutation_p.A282S	NM_004046	NP_004037	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1	282					ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0						AGTGGGGCAGCATCCGAGGCC	0.423													4	84	---	---	---	---	capture	Missense_Mutation	SNP	43667414	43667414	ATP5A1	18	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	1138	189
MUC16	94025	broad.mit.edu	37	19	9054252	9054252	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9054252G>A	uc002mkp.2	-	4	31574	c.31370C>T	c.(31369-31371)TCG>TTG	p.S10457L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10459	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACTGGCAGGCGAAGTGGATGT	0.448													7	22	---	---	---	---	capture	Missense_Mutation	SNP	9054252	9054252	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9883	189
C19orf50	79036	broad.mit.edu	37	19	18675766	18675766	+	Silent	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18675766C>T	uc002njo.2	+	3	331	c.189C>T	c.(187-189)TTC>TTT	p.F63F	C19orf50_uc002njp.2_RNA|C19orf50_uc002njq.2_Silent_p.F63F	NM_024069	NP_076974	Q9BQD3	CS050_HUMAN	hypothetical protein LOC79036	63							protein binding				0						GCGAACGCTTCCTGCACCACA	0.582													5	307	---	---	---	---	capture	Silent	SNP	18675766	18675766	C19orf50	19	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	1915	189
ZNF429	353088	broad.mit.edu	37	19	21712573	21712573	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:21712573C>A	uc002nqd.1	+	2	254	c.117C>A	c.(115-117)AAC>AAA	p.N39K	ZNF429_uc010ecu.1_Missense_Mutation_p.N39K	NM_001001415	NP_001001415	Q86V71	ZN429_HUMAN	zinc finger protein 429	39	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ACTACAGAAACTTGGTCTTCC	0.378													39	170	---	---	---	---	capture	Missense_Mutation	SNP	21712573	21712573	ZNF429	19	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	17782	189
TMEM149	79713	broad.mit.edu	37	19	36230669	36230669	+	Silent	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36230669G>A	uc002obc.2	-	4	764	c.663C>T	c.(661-663)GGC>GGT	p.G221G	TMEM149_uc002obb.2_Intron|TMEM149_uc002obd.3_Silent_p.G221G|TMEM149_uc010xsy.1_RNA|TMEM149_uc010eej.2_Silent_p.G301G	NM_024660	NP_078936	Q9H665	IGFR1_HUMAN	transmembrane protein 149 precursor	221	Cytoplasmic (Potential).					integral to membrane|plasma membrane	protein binding|receptor activity				0	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCTCCAGGGCGCCTGGGGAGG	0.642													84	188	---	---	---	---	capture	Silent	SNP	36230669	36230669	TMEM149	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	15946	189
CPT1C	126129	broad.mit.edu	37	19	50208532	50208532	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50208532C>T	uc002ppj.2	+	9	1146	c.941C>T	c.(940-942)ACG>ATG	p.T314M	CPT1C_uc002ppl.3_Missense_Mutation_p.T280M|CPT1C_uc002ppi.2_Missense_Mutation_p.T231M|CPT1C_uc002ppk.2_Missense_Mutation_p.T303M|CPT1C_uc010eng.2_Missense_Mutation_p.T314M|CPT1C_uc010enh.2_Missense_Mutation_p.T314M|CPT1C_uc010ybc.1_Missense_Mutation_p.T185M|CPT1C_uc010eni.1_5'Flank	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	314	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		TTCAACACCACGCGGATTCCA	0.448													8	252	---	---	---	---	capture	Missense_Mutation	SNP	50208532	50208532	CPT1C	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3798	189
SOS1	6654	broad.mit.edu	37	2	39262448	39262448	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:39262448T>C	uc002rrk.3	-	8	1020	c.979A>G	c.(979-981)ATA>GTA	p.I327V	SOS1_uc010ynr.1_RNA|SOS1_uc002rrj.3_5'UTR|SOS1_uc002rrl.2_Missense_Mutation_p.I59V	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	327	DH.				apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				CCTTCGCCTATTGACTGGAAA	0.338									Noonan_syndrome				17	48	---	---	---	---	capture	Missense_Mutation	SNP	39262448	39262448	SOS1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	14828	189
SLC4A5	57835	broad.mit.edu	37	2	74462257	74462257	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74462257G>C	uc002sko.1	-	17	2406	c.2404C>G	c.(2404-2406)CCC>GCC	p.P802A	SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.P802A|SLC4A5_uc010ffc.1_Missense_Mutation_p.P802A|SLC4A5_uc002skp.1_Intron|SLC4A5_uc002sks.1_Intron	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a	802	Cytoplasmic (Potential).					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						TGCAGCTTGGGAGTTTCTAGG	0.547													8	62	---	---	---	---	capture	Missense_Mutation	SNP	74462257	74462257	SLC4A5	2	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	14549	189
LRP2	4036	broad.mit.edu	37	2	170092415	170092415	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170092415G>A	uc002ues.2	-	29	5068	c.4855C>T	c.(4855-4857)CTT>TTT	p.L1619F		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1619	LDL-receptor class B 13.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ATGTAATCAAGATAGGAGTCC	0.453													4	89	---	---	---	---	capture	Missense_Mutation	SNP	170092415	170092415	LRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	8872	189
TTN	7273	broad.mit.edu	37	2	179410964	179410964	+	Silent	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179410964G>A	uc010zfg.1	-	291	87614	c.87390C>T	c.(87388-87390)GCC>GCT	p.A29130A	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.A22825A|TTN_uc010zfi.1_Silent_p.A22758A|TTN_uc010zfj.1_Silent_p.A22633A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30057							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGACAGACACGGCCTTGGTCC	0.428													17	468	---	---	---	---	capture	Silent	SNP	179410964	179410964	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16617	189
TTN	7273	broad.mit.edu	37	2	179462736	179462736	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179462736T>A	uc010zfg.1	-	242	49681	c.49457A>T	c.(49456-49458)AAG>ATG	p.K16486M	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K10181M|TTN_uc010zfi.1_Missense_Mutation_p.K10114M|TTN_uc010zfj.1_Missense_Mutation_p.K9989M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17413							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCTCCTTCCTTTAATCCTGT	0.383													32	281	---	---	---	---	capture	Missense_Mutation	SNP	179462736	179462736	TTN	2	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	16617	189
MAP2	4133	broad.mit.edu	37	2	210518141	210518141	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:210518141G>C	uc002vde.1	+	4	495	c.247G>C	c.(247-249)GAC>CAC	p.D83H	MAP2_uc002vdc.1_Missense_Mutation_p.D83H|MAP2_uc002vdd.1_Missense_Mutation_p.D83H|MAP2_uc002vdf.1_Missense_Mutation_p.D83H|MAP2_uc002vdg.1_Missense_Mutation_p.D83H|MAP2_uc002vdh.1_Missense_Mutation_p.D83H|MAP2_uc002vdi.1_Missense_Mutation_p.D83H	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	83					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	GACCTCAGCTGACAGAGAAAC	0.463													5	144	---	---	---	---	capture	Missense_Mutation	SNP	210518141	210518141	MAP2	2	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	9149	189
XKR7	343702	broad.mit.edu	37	20	30584473	30584473	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30584473C>T	uc002wxe.2	+	3	1127	c.953C>T	c.(952-954)GCG>GTG	p.A318V		NM_001011718	NP_001011718	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related	318	Helical; (Potential).					integral to membrane				ovary(1)|breast(1)|skin(1)	3			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CTGGCCTTCGCGCTCTTCGCC	0.637													22	63	---	---	---	---	capture	Missense_Mutation	SNP	30584473	30584473	XKR7	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17317	189
JPH2	57158	broad.mit.edu	37	20	42788430	42788430	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42788430C>T	uc002xli.1	-	2	1870	c.997G>A	c.(997-999)GAC>AAC	p.D333N		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	333	MORN 8.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CGGTGGCCGTCGGGCAGCGTG	0.662													6	18	---	---	---	---	capture	Missense_Mutation	SNP	42788430	42788430	JPH2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7884	189
PCBP3	54039	broad.mit.edu	37	21	47349908	47349908	+	Silent	SNP	C	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47349908C>A	uc002zhq.1	+	10	920	c.795C>A	c.(793-795)CCC>CCA	p.P265P	PCBP3_uc010gqb.2_Silent_p.P265P|PCBP3_uc002zhp.1_Silent_p.P265P|PCBP3_uc002zhs.1_Silent_p.P239P|PCBP3_uc002zhr.1_Silent_p.P264P|PCBP3_uc002zht.1_Silent_p.P255P	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1	265					mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CCGCTTTCCCCGGTACGTACC	0.567													37	130	---	---	---	---	capture	Silent	SNP	47349908	47349908	PCBP3	21	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	11405	189
ST3GAL6	10402	broad.mit.edu	37	3	98506930	98506930	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98506930C>T	uc003dsz.2	+	7	718	c.482C>T	c.(481-483)ACA>ATA	p.T161I	ST3GAL6_uc003dsy.2_Missense_Mutation_p.T75I|ST3GAL6_uc003dta.2_Missense_Mutation_p.T43I|ST3GAL6_uc003dtb.2_Missense_Mutation_p.T17I|ST3GAL6_uc003dtc.2_Missense_Mutation_p.T161I|ST3GAL6_uc010hpd.2_Missense_Mutation_p.T214I	NM_006100	NP_006091	Q9Y274	SIA10_HUMAN	alpha2,3-sialyltransferase VI	161	Lumenal (Potential).				amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity			ovary(1)	1						GGGAGAAGGACAACCTTCCGA	0.378													38	90	---	---	---	---	capture	Missense_Mutation	SNP	98506930	98506930	ST3GAL6	3	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	15109	189
MYLK	4638	broad.mit.edu	37	3	123457797	123457797	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123457797G>A	uc003ego.2	-	7	817	c.535C>T	c.(535-537)CGA>TGA	p.R179*	MYLK_uc011bjw.1_Nonsense_Mutation_p.R179*|MYLK_uc003egp.2_Nonsense_Mutation_p.R179*|MYLK_uc003egq.2_Nonsense_Mutation_p.R179*|MYLK_uc003egr.2_Nonsense_Mutation_p.R179*|MYLK_uc003egs.2_Nonsense_Mutation_p.R3*|MYLK_uc010hrs.1_Nonsense_Mutation_p.R179*	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	179	Ig-like C2-type 2.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CAGGAGAATCGTCCCATCTGT	0.562													20	35	---	---	---	---	capture	Nonsense_Mutation	SNP	123457797	123457797	MYLK	3	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	9966	189
DCUN1D4	23142	broad.mit.edu	37	4	52765498	52765498	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:52765498C>G	uc003gze.2	+	8	702	c.569C>G	c.(568-570)TCT>TGT	p.S190C	DCUN1D4_uc003gzf.2_Missense_Mutation_p.S190C|DCUN1D4_uc011bzn.1_Missense_Mutation_p.S130C|DCUN1D4_uc003gzg.2_RNA|DCUN1D4_uc003gzh.2_RNA|DCUN1D4_uc011bzo.1_Missense_Mutation_p.S234C	NM_001040402	NP_001035492	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain	190	DCUN1.									ovary(2)	2			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			TTAAATGATTCTACAAACTTT	0.348													8	54	---	---	---	---	capture	Missense_Mutation	SNP	52765498	52765498	DCUN1D4	4	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	4275	189
EPHA5	2044	broad.mit.edu	37	4	66233108	66233108	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:66233108C>T	uc003hcy.2	-	10	2084	c.1891G>A	c.(1891-1893)GAA>AAA	p.E631K	EPHA5_uc003hcx.2_Missense_Mutation_p.E563K|EPHA5_uc003hcz.2_Missense_Mutation_p.E609K|EPHA5_uc011cah.1_Missense_Mutation_p.E632K|EPHA5_uc011cai.1_Missense_Mutation_p.E610K|EPHA5_uc003hda.2_Missense_Mutation_p.E632K	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	631	Cytoplasmic (Potential).				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						TTTTCCTCTTCTGGATCTTGT	0.358										TSP Lung(17;0.13)			16	74	---	---	---	---	capture	Missense_Mutation	SNP	66233108	66233108	EPHA5	4	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	5125	189
SULT1B1	27284	broad.mit.edu	37	4	70596362	70596362	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70596362A>G	uc003hen.2	-	7	933	c.635T>C	c.(634-636)CTA>CCA	p.L212P		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	212	PAPS (By similarity).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						GTTCTTCTCTAGAAATCTAAT	0.338													26	41	---	---	---	---	capture	Missense_Mutation	SNP	70596362	70596362	SULT1B1	4	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	15264	189
SULT1B1	27284	broad.mit.edu	37	4	70596383	70596383	+	Missense_Mutation	SNP	A	C	C			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70596383A>C	uc003hen.2	-	7	912	c.614T>G	c.(613-615)ATC>AGC	p.I205S		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	205	PAPS (By similarity).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						GATCTTCTTGATTTCCTCCTT	0.328													21	39	---	---	---	---	capture	Missense_Mutation	SNP	70596383	70596383	SULT1B1	4	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	15264	189
C4orf35	85438	broad.mit.edu	37	4	71201006	71201006	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71201006G>A	uc003hff.2	+	1	336	c.250G>A	c.(250-252)GAC>AAC	p.D84N		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	84						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				TATGGGGACCGACTTTATTAA	0.363													41	101	---	---	---	---	capture	Missense_Mutation	SNP	71201006	71201006	C4orf35	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2243	189
TACR3	6870	broad.mit.edu	37	4	104510963	104510963	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:104510963C>T	uc003hxe.1	-	5	1417	c.1274G>A	c.(1273-1275)CGG>CAG	p.R425Q		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	425	Cytoplasmic (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TCTTTTCTTCCGACTGGACCT	0.502													137	283	---	---	---	---	capture	Missense_Mutation	SNP	104510963	104510963	TACR3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15395	189
NDST3	9348	broad.mit.edu	37	4	119064755	119064755	+	Silent	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:119064755C>T	uc003ibx.2	+	6	1858	c.1455C>T	c.(1453-1455)TTC>TTT	p.F485F	NDST3_uc011cgf.1_Silent_p.F404F	NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	485	Lumenal (Potential).|Heparan sulfate N-deacetylase 3.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						ACACCATTTTCTACAAAGAAT	0.383													5	114	---	---	---	---	capture	Silent	SNP	119064755	119064755	NDST3	4	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	10164	189
DNAH5	1767	broad.mit.edu	37	5	13841162	13841162	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13841162T>A	uc003jfd.2	-	34	5604	c.5562A>T	c.(5560-5562)AAA>AAT	p.K1854N		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1854	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCTGCATGATTTTTTTATCAA	0.398									Kartagener_syndrome				52	103	---	---	---	---	capture	Missense_Mutation	SNP	13841162	13841162	DNAH5	5	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	4561	189
MCCC2	64087	broad.mit.edu	37	5	70945048	70945048	+	Silent	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:70945048C>T	uc003kbs.3	+	14	1479	c.1341C>T	c.(1339-1341)GCC>GCT	p.A447A	MCCC2_uc003kbt.3_RNA	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	447	Carboxyltransferase.				leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	CCTATGGAGCCGGAAACTATG	0.463													4	161	---	---	---	---	capture	Silent	SNP	70945048	70945048	MCCC2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9288	189
SLC22A5	6584	broad.mit.edu	37	5	131729366	131729366	+	Splice_Site	SNP	A	G	G			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131729366A>G	uc003kww.3	+	9	1715	c.1451_splice	c.e9-2	p.G484_splice	SLC22A5_uc003kwx.3_Splice_Site_p.G508_splice|SLC22A5_uc010jdr.1_Splice_Site_p.G104_splice	NM_003060	NP_003051	O76082	S22A5_HUMAN	solute carrier family 22 member 5						positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity				0		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	GCTTTGCCATAGGTGCCTACG	0.562													5	402	---	---	---	---	capture	Splice_Site	SNP	131729366	131729366	SLC22A5	5	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	14349	189
MAT2B	27430	broad.mit.edu	37	5	162945327	162945327	+	Silent	SNP	T	G	G			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:162945327T>G	uc003lzk.2	+	7	1071	c.963T>G	c.(961-963)CCT>CCG	p.P321P	MAT2B_uc003lzj.2_Silent_p.P310P|MAT2B_uc003lzl.1_3'UTR|MAT2B_uc003lzm.2_Silent_p.P61P	NM_013283	NP_037415	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta isoform	321					extracellular polysaccharide biosynthetic process|methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol|methionine adenosyltransferase complex|nucleus	dTDP-4-dehydrorhamnose reductase activity|methionine adenosyltransferase regulator activity|protein binding			upper_aerodigestive_tract(1)	1	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CACTTTGGCCTTTCCTCATTG	0.388													11	134	---	---	---	---	capture	Silent	SNP	162945327	162945327	MAT2B	5	T	G	G	G	1	0	0	0	0	0	0	0	1	717	56	4	4	9244	189
PKHD1	5314	broad.mit.edu	37	6	51941121	51941121	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51941121G>A	uc003pah.1	-	6	677	c.401C>T	c.(400-402)GCG>GTG	p.A134V	PKHD1_uc003pai.2_Missense_Mutation_p.A134V	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	134	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GGGTGTCTGCGCCTTGGAAAA	0.393													30	67	---	---	---	---	capture	Missense_Mutation	SNP	51941121	51941121	PKHD1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11874	189
IBTK	25998	broad.mit.edu	37	6	82924066	82924066	+	Silent	SNP	A	C	C			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:82924066A>C	uc003pjl.1	-	12	2609	c.2082T>G	c.(2080-2082)GTT>GTG	p.V694V	IBTK_uc011dyv.1_Silent_p.V694V|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Silent_p.V388V|IBTK_uc003pjm.2_Silent_p.V694V	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	694					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		GCCTCTCACTAACTGTTTGAG	0.338													65	148	---	---	---	---	capture	Silent	SNP	82924066	82924066	IBTK	6	A	C	C	C	1	0	0	0	0	0	0	0	1	158	13	4	4	7401	189
SESN1	27244	broad.mit.edu	37	6	109319765	109319765	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109319765C>T	uc003pst.3	-	5	838	c.746G>A	c.(745-747)GGC>GAC	p.G249D	SESN1_uc003psu.2_Missense_Mutation_p.G308D	NM_014454	NP_055269	Q9Y6P5	SESN1_HUMAN	sestrin 1	249					cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		ACTGTGATTGCCATTTGTAAT	0.398													22	197	---	---	---	---	capture	Missense_Mutation	SNP	109319765	109319765	SESN1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14017	189
ZNF804B	219578	broad.mit.edu	37	7	88966247	88966247	+	Silent	SNP	A	G	G			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:88966247A>G	uc011khi.1	+	4	4489	c.3951A>G	c.(3949-3951)GTA>GTG	p.V1317V		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1317						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TCCAACCAGTATTCCAAGGTC	0.413										HNSCC(36;0.09)			16	377	---	---	---	---	capture	Silent	SNP	88966247	88966247	ZNF804B	7	A	G	G	G	1	0	0	0	0	0	0	0	1	197	16	3	3	18047	189
PPP1R3A	5506	broad.mit.edu	37	7	113518248	113518248	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113518248G>T	uc010ljy.1	-	4	2930	c.2899C>A	c.(2899-2901)CCT>ACT	p.P967T		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	967					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						TCAGGATAAGGGTGCTTCTCA	0.383													11	269	---	---	---	---	capture	Missense_Mutation	SNP	113518248	113518248	PPP1R3A	7	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	12272	189
PLXNA4	91584	broad.mit.edu	37	7	131866156	131866156	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131866156G>A	uc003vra.3	-	18	3705	c.3476C>T	c.(3475-3477)ACG>ATG	p.T1159M		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1159	IPT/TIG 4.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						GATGATGGGCGTGCCAGGCTT	0.582													89	378	---	---	---	---	capture	Missense_Mutation	SNP	131866156	131866156	PLXNA4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12025	189
GIMAP8	155038	broad.mit.edu	37	7	150171329	150171329	+	Silent	SNP	G	A	A			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150171329G>A	uc003whj.2	+	4	1242	c.912G>A	c.(910-912)CCG>CCA	p.P304P		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	304						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		TTGATGCTCCGGACATCTCAT	0.458													45	192	---	---	---	---	capture	Silent	SNP	150171329	150171329	GIMAP8	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6324	189
TEX15	56154	broad.mit.edu	37	8	30702861	30702861	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30702861C>T	uc003xil.2	-	1	3673	c.3673G>A	c.(3673-3675)GCT>ACT	p.A1225T		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1225										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ACTTCATTAGCGTCACAACTG	0.299													24	50	---	---	---	---	capture	Missense_Mutation	SNP	30702861	30702861	TEX15	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15664	189
FAM135B	51059	broad.mit.edu	37	8	139209806	139209806	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:139209806A>G	uc003yuy.2	-	8	947	c.776T>C	c.(775-777)TTC>TCC	p.F259S	FAM135B_uc003yux.2_Missense_Mutation_p.F160S|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	259										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GATCACCAGGAAGTGGAGACG	0.612										HNSCC(54;0.14)			6	86	---	---	---	---	capture	Missense_Mutation	SNP	139209806	139209806	FAM135B	8	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	5403	189
ZNF79	7633	broad.mit.edu	37	9	130206381	130206381	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130206381G>C	uc004bqw.3	+	5	816	c.402G>C	c.(400-402)GAG>GAC	p.E134D	ZNF79_uc011maf.1_Missense_Mutation_p.E110D|ZNF79_uc011mag.1_Missense_Mutation_p.E110D	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	134					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						CATGTGTAGAGATGCCCCCTG	0.502													8	207	---	---	---	---	capture	Missense_Mutation	SNP	130206381	130206381	ZNF79	9	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	18037	189
ZCCHC5	203430	broad.mit.edu	37	X	77913028	77913028	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1830-01	TCGA-27-1830-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77913028A>G	uc004edc.1	-	2	1186	c.890T>C	c.(889-891)ATC>ACC	p.I297T		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	297							nucleic acid binding|zinc ion binding			ovary(1)	1						GGGGCTTTGGATATCCAGTAA	0.483													16	4	---	---	---	---	capture	Missense_Mutation	SNP	77913028	77913028	ZCCHC5	23	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	17471	189
