Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
RPE65	6121	broad.mit.edu	37	1	68904666	68904666	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:68904666T>A	uc001dei.1	-	9	1011	c.957A>T	c.(955-957)GAA>GAT	p.E319D		NM_000329	NP_000320	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein	319					visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1						ACCCATTGTCTTCATAGGTGT	0.413													25	315	---	---	---	---	capture	Missense_Mutation	SNP	68904666	68904666	RPE65	1	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	13437	191
SLC39A1	27173	broad.mit.edu	37	1	153933124	153933124	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153933124A>G	uc001fdh.2	-	4	594	c.425T>C	c.(424-426)CTG>CCG	p.L142P	CRTC2_uc010ped.1_5'Flank|SLC39A1_uc001fdi.2_Missense_Mutation_p.L142P|SLC39A1_uc001fdj.2_Missense_Mutation_p.L142P|SLC39A1_uc001fdk.2_Missense_Mutation_p.L142P|SLC39A1_uc010pee.1_Missense_Mutation_p.L40P|SLC39A1_uc001fdl.2_Missense_Mutation_p.L142P	NM_014437	NP_055252	Q9NY26	S39A1_HUMAN	solute carrier family 39 (zinc transporter),	142	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	zinc ion transmembrane transporter activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)		TGTTTCCTCCAGAGGTGACGG	0.607													3	142	---	---	---	---	capture	Missense_Mutation	SNP	153933124	153933124	SLC39A1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	14504	191
APBB1	322	broad.mit.edu	37	11	6432089	6432089	+	Missense_Mutation	SNP	A	C	C	rs150119080	byFrequency	TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6432089A>C	uc001mdb.1	-	2	589	c.489T>G	c.(487-489)GAT>GAG	p.D163E	APBB1_uc001mdc.1_Missense_Mutation_p.D163E|APBB1_uc010rah.1_Intron	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	163	Glu-rich.				apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		catcatcatcatcctcctcct	0.403													3	109	---	---	---	---	capture	Missense_Mutation	SNP	6432089	6432089	APBB1	11	A	C	C	C	1	0	0	0	0	1	0	0	0	102	8	4	4	752	191
MS4A6A	64231	broad.mit.edu	37	11	59947358	59947358	+	Silent	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59947358G>A	uc001nor.2	-	3	466	c.228C>T	c.(226-228)ACC>ACT	p.T76T	MS4A6A_uc001noq.2_Silent_p.T76T|MS4A6A_uc001nos.3_Silent_p.T104T|MS4A6A_uc009ymv.2_Silent_p.T76T|MS4A6A_uc001not.2_Silent_p.T76T|MS4A6A_uc010rla.1_Silent_p.T104T|MS4A6A_uc010rlb.1_Intron	NM_152852	NP_690591	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member	76	Extracellular (Potential).					integral to membrane	receptor activity				0						AAGTCACTTGGGTAAAATTTG	0.468													27	70	---	---	---	---	capture	Silent	SNP	59947358	59947358	MS4A6A	11	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	9774	191
MMP13	4322	broad.mit.edu	37	11	102822797	102822797	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102822797C>T	uc001phl.2	-	5	771	c.743G>A	c.(742-744)GGC>GAC	p.G248D		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	248					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		GTGGCTTTTGCCGGTGTAGGT	0.448													6	419	---	---	---	---	capture	Missense_Mutation	SNP	102822797	102822797	MMP13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9564	191
USP28	57646	broad.mit.edu	37	11	113688486	113688486	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113688486T>C	uc001poh.2	-	13	1390	c.1357A>G	c.(1357-1359)AGT>GGT	p.S453G	USP28_uc001pog.2_Missense_Mutation_p.S161G|USP28_uc010rwy.1_Missense_Mutation_p.S328G|USP28_uc001poi.2_Intron|USP28_uc001poj.3_Missense_Mutation_p.S453G	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	453					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		GGTTTTGTACTAGCAAATTCA	0.463													64	124	---	---	---	---	capture	Missense_Mutation	SNP	113688486	113688486	USP28	11	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	16940	191
CD163L1	283316	broad.mit.edu	37	12	7559406	7559406	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7559406C>T	uc001qsy.2	-	5	835	c.809G>A	c.(808-810)CGC>CAC	p.R270H	CD163L1_uc010sge.1_Missense_Mutation_p.R280H	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	270	SRCR 3.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						CCCCATACAGCGGTTAGTTCC	0.448													5	149	---	---	---	---	capture	Missense_Mutation	SNP	7559406	7559406	CD163L1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2939	191
TRPV4	59341	broad.mit.edu	37	12	110236625	110236625	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110236625G>A	uc001tpj.1	-	5	1041	c.946C>T	c.(946-948)CGC>TGC	p.R316C	TRPV4_uc001tpg.1_Missense_Mutation_p.R282C|TRPV4_uc001tph.1_Missense_Mutation_p.R269C|TRPV4_uc001tpi.1_Missense_Mutation_p.R269C|TRPV4_uc001tpk.1_Missense_Mutation_p.R316C|TRPV4_uc001tpl.1_Missense_Mutation_p.R316C	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	316	Cytoplasmic (Potential).		R -> C (in CMT2C and SPSMA).		actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GAGTCCTGGCGCCGCATGTCC	0.612													45	102	---	---	---	---	capture	Missense_Mutation	SNP	110236625	110236625	TRPV4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16481	191
AACS	65985	broad.mit.edu	37	12	125599073	125599073	+	Silent	SNP	C	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125599073C>A	uc001uhc.2	+	9	1172	c.966C>A	c.(964-966)ACC>ACA	p.T322T	AACS_uc001uhd.2_Silent_p.T322T|AACS_uc009zyh.2_RNA|AACS_uc009zyi.2_5'UTR	NM_023928	NP_076417	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	322					fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		GCAACATGACCAGCAGTGACA	0.607													18	58	---	---	---	---	capture	Silent	SNP	125599073	125599073	AACS	12	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	9	191
IPO5	3843	broad.mit.edu	37	13	98666352	98666352	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:98666352C>T	uc001vne.2	+	22	2443	c.2263C>T	c.(2263-2265)CGT>TGT	p.R755C		NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5	737					interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						TGCAAGAGTCCGTGGTCCTGA	0.438													18	137	---	---	---	---	capture	Missense_Mutation	SNP	98666352	98666352	IPO5	13	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7719	191
F10	2159	broad.mit.edu	37	13	113793675	113793675	+	Silent	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113793675C>T	uc001vsx.2	+	4	318	c.261C>T	c.(259-261)GGC>GGT	p.G87G	F10_uc010agq.1_RNA|F10_uc001vsy.2_Silent_p.G87G|F10_uc001vsz.2_Silent_p.G87G	NM_000504	NP_000495	P00742	FA10_HUMAN	coagulation factor X preproprotein	87	EGF-like 1; calcium-binding (Potential).				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of cell migration|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|phospholipid binding|protein binding|serine-type endopeptidase activity			pancreas(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Heparin(DB01109)|Menadione(DB00170)|Reteplase(DB00015)|Tenecteplase(DB00031)	TTGCAGATGGCGACCAGTGTG	0.502													14	65	---	---	---	---	capture	Silent	SNP	113793675	113793675	F10	13	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5290	191
SLC7A7	9056	broad.mit.edu	37	14	23245049	23245049	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23245049C>T	uc001wgr.3	-	6	1129	c.991G>A	c.(991-993)GCT>ACT	p.A331T	SLC7A7_uc001wgs.3_Missense_Mutation_p.A331T|SLC7A7_uc001wgt.3_Missense_Mutation_p.A331T|SLC7A7_uc001wgu.3_Missense_Mutation_p.A331T|SLC7A7_uc001wgv.3_Missense_Mutation_p.A331T	NM_003982	NP_003973	Q9UM01	YLAT1_HUMAN	solute carrier family 7 member 7	331					blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		TACCTAGAAGCAGCCACAATG	0.428													68	96	---	---	---	---	capture	Missense_Mutation	SNP	23245049	23245049	SLC7A7	14	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	14595	191
NFKBIA	4792	broad.mit.edu	37	14	35871759	35871759	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:35871759C>A	uc001wtf.3	-	5	857	c.747G>T	c.(745-747)CAG>CAT	p.Q249H	NFKBIA_uc001wte.3_Missense_Mutation_p.Q159H|NFKBIA_uc001wtg.3_Intron|NFKBIA_uc010amo.2_RNA	NM_020529	NP_065390	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene	249					anti-apoptosis|apoptosis|cellular response to cold|cytoplasmic sequestering of NF-kappaB|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of DNA binding|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|I-kappaB/NF-kappaB complex|nucleus|plasma membrane	identical protein binding|NF-kappaB binding|nuclear localization sequence binding|ubiquitin protein ligase binding			breast(2)	2	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)		GAGAATAGCCCTGGTAGGTAA	0.577													14	225	---	---	---	---	capture	Missense_Mutation	SNP	35871759	35871759	NFKBIA	14	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	10284	191
TPSD1	23430	broad.mit.edu	37	16	1306641	1306641	+	Silent	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1306641C>T	uc002clb.1	+	2	216	c.207C>T	c.(205-207)TCC>TCT	p.S69S	TPSD1_uc010brm.1_Silent_p.S7S	NM_012217	NP_036349	Q9BZJ3	TRYD_HUMAN	tryptase delta 1 precursor	69	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				GCGGGGGCTCCCTCATCCACC	0.692													39	121	---	---	---	---	capture	Silent	SNP	1306641	1306641	TPSD1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	16308	191
DNAH3	55567	broad.mit.edu	37	16	20975342	20975342	+	Silent	SNP	G	A	A	rs142743875	byFrequency;by1000genomes	TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20975342G>A	uc010vbe.1	-	53	9864	c.9864C>T	c.(9862-9864)GAC>GAT	p.D3288D	DNAH3_uc010vbd.1_Silent_p.D723D	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3288					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TCCGAGTCTCGTCAATCTGCG	0.498													50	132	---	---	---	---	capture	Silent	SNP	20975342	20975342	DNAH3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4560	191
KIAA0556	23247	broad.mit.edu	37	16	27761189	27761189	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27761189G>A	uc002dow.2	+	16	2932	c.2908G>A	c.(2908-2910)GTC>ATC	p.V970I		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	970										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						TAAAATCCCCGTCTTGCCTTA	0.557													26	50	---	---	---	---	capture	Missense_Mutation	SNP	27761189	27761189	KIAA0556	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8105	191
TRIM72	493829	broad.mit.edu	37	16	31235634	31235634	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31235634C>T	uc002ebn.1	+	7	1221	c.992C>T	c.(991-993)GCG>GTG	p.A331V	uc002ebp.1_5'Flank	NM_001008274	NP_001008275	Q6ZMU5	TRI72_HUMAN	tripartite motif-containing 72	331	B30.2/SPRY.				exocytosis|muscle organ development|muscle system process|plasma membrane repair|protein homooligomerization	cytoplasmic vesicle membrane|sarcolemma	phosphatidylserine binding|zinc ion binding				0						TTCGACAAGGCGGTGGCGGTG	0.697													13	16	---	---	---	---	capture	Missense_Mutation	SNP	31235634	31235634	TRIM72	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16428	191
SMCR8	140775	broad.mit.edu	37	17	18219935	18219935	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18219935G>A	uc002gsy.3	+	1	1342	c.832G>A	c.(832-834)GCC>ACC	p.A278T		NM_144775	NP_658988	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region,	278										central_nervous_system(1)	1						CCAGGATCAGGCCAGCCAGGC	0.517													22	64	---	---	---	---	capture	Missense_Mutation	SNP	18219935	18219935	SMCR8	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14684	191
ENPP7	339221	broad.mit.edu	37	17	77710991	77710991	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77710991G>A	uc002jxa.2	+	4	1198	c.1178G>A	c.(1177-1179)CGG>CAG	p.R393Q		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	393					negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTCATGTGCCGGCTGCTGGGC	0.647													13	52	---	---	---	---	capture	Missense_Mutation	SNP	77710991	77710991	ENPP7	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5090	191
DUS1L	64118	broad.mit.edu	37	17	80020801	80020801	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80020801C>T	uc002kdq.2	-	4	865	c.446G>A	c.(445-447)CGT>CAT	p.R149H	DUS1L_uc002kdp.2_Missense_Mutation_p.R18H|DUS1L_uc002kdr.2_Missense_Mutation_p.R149H|DUS1L_uc002kds.2_RNA|DUS1L_uc002kdt.2_RNA|DUS1L_uc010wvi.1_Missense_Mutation_p.R132H	NM_022156	NP_071439	Q6P1R4	DUS1L_HUMAN	PP3111 protein	149					tRNA processing		flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity			skin(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CGGGAAGACACGGATTTTGCA	0.602													35	101	---	---	---	---	capture	Missense_Mutation	SNP	80020801	80020801	DUS1L	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4760	191
POTEC	388468	broad.mit.edu	37	18	14513675	14513675	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14513675T>C	uc010dln.2	-	10	1973	c.1519A>G	c.(1519-1521)AAA>GAA	p.K507E	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	507	Potential.									skin(3)	3						GAATTCATTTTCTTTTCAGCC	0.284													4	115	---	---	---	---	capture	Missense_Mutation	SNP	14513675	14513675	POTEC	18	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	12164	191
POTEC	388468	broad.mit.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14513764C>T	uc010dln.2	-	10	1884	c.1430G>A	c.(1429-1431)CGG>CAG	p.R477Q	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	477										skin(3)	3						AAGTTGTTTCCGGGTATCATT	0.358													7	97	---	---	---	---	capture	Missense_Mutation	SNP	14513764	14513764	POTEC	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12164	191
ANKRD30B	374860	broad.mit.edu	37	18	14763986	14763986	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14763986C>G	uc010dlo.2	+	7	1302	c.1122C>G	c.(1120-1122)TGC>TGG	p.C374W	ANKRD30B_uc010xak.1_RNA	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	374										ovary(1)|skin(1)	2						AGACTGAATGCGTGGCAGGAG	0.363													4	12	---	---	---	---	capture	Missense_Mutation	SNP	14763986	14763986	ANKRD30B	18	C	G	G	G	1	0	0	0	0	1	0	0	0	350	27	4	4	655	191
DSEL	92126	broad.mit.edu	37	18	65181103	65181103	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:65181103T>C	uc002lke.1	-	2	1997	c.773A>G	c.(772-774)AAT>AGT	p.N258S		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	248						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				TTTCCATATATTTGCTTTAGA	0.418													64	135	---	---	---	---	capture	Missense_Mutation	SNP	65181103	65181103	DSEL	18	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	4730	191
KLK15	55554	broad.mit.edu	37	19	51330985	51330985	+	Missense_Mutation	SNP	G	A	A	rs140896741	byFrequency	TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51330985G>A	uc002ptl.2	-	2	161	c.130C>T	c.(130-132)CGC>TGC	p.R44C	KLK15_uc002ptm.2_Missense_Mutation_p.R44C|KLK15_uc002ptn.2_Missense_Mutation_p.R44C|KLK15_uc002pto.2_Missense_Mutation_p.R43C|KLK15_uc010ych.1_RNA|KLK15_uc010yci.1_Missense_Mutation_p.R43C|KLK15_uc010eod.2_RNA	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15 isoform 4	44	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)|breast(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		CAGTTAAAGCGTCCACGCTCG	0.612													19	60	---	---	---	---	capture	Missense_Mutation	SNP	51330985	51330985	KLK15	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8323	191
NRXN1	9378	broad.mit.edu	37	2	50847197	50847197	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:50847197G>A	uc010fbq.2	-	8	2880	c.1403C>T	c.(1402-1404)TCA>TTA	p.S468L	NRXN1_uc002rxb.3_Missense_Mutation_p.S100L|NRXN1_uc002rxe.3_Missense_Mutation_p.S428L|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ACTGACTGGTGACCCTGGAAG	0.463													12	30	---	---	---	---	capture	Missense_Mutation	SNP	50847197	50847197	NRXN1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	10572	191
EIF2AK3	9451	broad.mit.edu	37	2	88870441	88870441	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:88870441G>A	uc002stc.3	-	14	3138	c.2936C>T	c.(2935-2937)GCC>GTC	p.A979V		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	979	Cytoplasmic (Potential).|Protein kinase.				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						TGTGTGTCTGGCATAAGCTGG	0.488													4	218	---	---	---	---	capture	Missense_Mutation	SNP	88870441	88870441	EIF2AK3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4953	191
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289													3	18	---	---	---	---	capture	Missense_Mutation	SNP	97869931	97869931	ANKRD36	2	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	661	191
COL5A2	1290	broad.mit.edu	37	2	189918184	189918184	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189918184C>T	uc002uqk.2	-	38	2794	c.2519G>A	c.(2518-2520)GGG>GAG	p.G840E	COL5A2_uc010frx.2_Missense_Mutation_p.G416E	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	840					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCCAGTTGGCCCATTTTCACC	0.343													22	57	---	---	---	---	capture	Missense_Mutation	SNP	189918184	189918184	COL5A2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	3662	191
GLS	2744	broad.mit.edu	37	2	191769831	191769831	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:191769831A>T	uc002usf.2	+	6	1181	c.917A>T	c.(916-918)CAT>CTT	p.H306L	GLS_uc002use.2_Missense_Mutation_p.H306L	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor	306					cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GAATATGTGCATCGATATGTT	0.348													6	107	---	---	---	---	capture	Missense_Mutation	SNP	191769831	191769831	GLS	2	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	6399	191
CPS1	1373	broad.mit.edu	37	2	211441119	211441119	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:211441119A>G	uc002vee.3	+	3	418	c.286A>G	c.(286-288)ATG>GTG	p.M96V	CPS1_uc010fur.2_Missense_Mutation_p.M102V	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	96	Anthranilate phosphoribosyltransferase homolog.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		GATTCTCACAATGGCCAACCC	0.408													76	175	---	---	---	---	capture	Missense_Mutation	SNP	211441119	211441119	CPS1	2	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	3788	191
RRP1B	23076	broad.mit.edu	37	21	45113183	45113183	+	Silent	SNP	A	C	C			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45113183A>C	uc002zdk.2	+	16	2310	c.2196A>C	c.(2194-2196)TCA>TCC	p.S732S	RRP1B_uc002zdl.2_Silent_p.S265S	NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B	732					rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.178)		CCACCAGCTCACCTGCCAGCT	0.612													6	33	---	---	---	---	capture	Silent	SNP	45113183	45113183	RRP1B	21	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	13580	191
C22orf42	150297	broad.mit.edu	37	22	32546408	32546408	+	Silent	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32546408C>T	uc003amd.2	-	7	593	c.552G>A	c.(550-552)TCG>TCA	p.S184S		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	184										ovary(1)|skin(1)	2						CACTGAGATCCGATGTCATGA	0.458													55	152	---	---	---	---	capture	Silent	SNP	32546408	32546408	C22orf42	22	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2129	191
TMPRSS6	164656	broad.mit.edu	37	22	37469590	37469590	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37469590C>T	uc003aqs.1	-	13	1678	c.1564G>A	c.(1564-1566)GAA>AAA	p.E522K	TMPRSS6_uc003aqt.1_Missense_Mutation_p.E513K	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	522	LDL-receptor class A 2.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						CACTGCTCTTCGTCGCTGCCG	0.552													40	96	---	---	---	---	capture	Missense_Mutation	SNP	37469590	37469590	TMPRSS6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16134	191
KIF9	64147	broad.mit.edu	37	3	47307239	47307239	+	Silent	SNP	G	A	A	rs146278510		TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47307239G>A	uc010hjp.2	-	9	1501	c.897C>T	c.(895-897)CAC>CAT	p.H299H	KIF9_uc003cqx.2_Silent_p.H299H|KIF9_uc003cqy.2_Silent_p.H299H|KIF9_uc011bat.1_RNA|KIF9_uc011bau.1_RNA	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2	299					blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CCTTCAGAGCGTGGGTGAGCT	0.582													33	142	---	---	---	---	capture	Silent	SNP	47307239	47307239	KIF9	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8232	191
CEP135	9662	broad.mit.edu	37	4	56875926	56875926	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:56875926C>T	uc003hbi.2	+	19	2596	c.2362C>T	c.(2362-2364)CGA>TGA	p.R788*	CEP135_uc003hbj.2_Nonsense_Mutation_p.R494*	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	788	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					ATTGGTTAATCGAGATCGTGA	0.363													29	70	---	---	---	---	capture	Nonsense_Mutation	SNP	56875926	56875926	CEP135	4	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	3215	191
WDFY3	23001	broad.mit.edu	37	4	85657415	85657415	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:85657415G>A	uc003hpd.2	-	42	7231	c.6823C>T	c.(6823-6825)CGT>TGT	p.R2275C	WDFY3_uc003hpe.1_5'Flank	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	2275						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTGCTGACACGGGATAATTTG	0.373													25	85	---	---	---	---	capture	Missense_Mutation	SNP	85657415	85657415	WDFY3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17151	191
GFM2	84340	broad.mit.edu	37	5	74056813	74056813	+	Splice_Site	SNP	T	C	C			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:74056813T>C	uc003kdh.1	-	3	368	c.64_splice	c.e3-1	p.N22_splice	GFM2_uc003kdi.1_Splice_Site_p.N22_splice|GFM2_uc010izj.1_Splice_Site_p.N54_splice|GFM2_uc010izk.1_Splice_Site|GFM2_uc003kdj.1_Splice_Site_p.N22_splice|GFM2_uc010izl.1_Splice_Site_p.N22_splice	NM_032380	NP_115756	Q969S9	RRF2M_HUMAN	mitochondrial elongation factor G2 isoform 1						mitochondrial translation|ribosome disassembly	mitochondrion	GTP binding|GTPase activity				0		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		GCATATATTCTAGTAAAGAGA	0.294													3	125	---	---	---	---	capture	Splice_Site	SNP	74056813	74056813	GFM2	5	T	C	C	C	1	0	0	0	0	0	0	1	0	689	53	5	3	6282	191
PCDHA1	56147	broad.mit.edu	37	5	140167207	140167207	+	Silent	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167207G>A	uc003lhb.2	+	1	1332	c.1332G>A	c.(1330-1332)GAG>GAA	p.E444E	PCDHA1_uc003lha.2_Silent_p.E444E|PCDHA1_uc003lgz.2_Silent_p.E444E	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	444	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCCGTGGAGGTGGCCGACG	0.667													70	182	---	---	---	---	capture	Silent	SNP	140167207	140167207	PCDHA1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	11422	191
RP9	6100	broad.mit.edu	37	7	33138995	33138995	+	Silent	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:33138995G>A	uc003tdm.2	-	3	255	c.237C>T	c.(235-237)CAC>CAT	p.H79H		NM_203288	NP_976033	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9	79	PIM1-binding (By similarity).				RNA splicing	nucleus	nucleic acid binding|protein binding|zinc ion binding				0			GBM - Glioblastoma multiforme(11;0.0403)			ATTCCCTGGCGTGTTCATTGC	0.463													49	277	---	---	---	---	capture	Silent	SNP	33138995	33138995	RP9	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13427	191
CCDC146	57639	broad.mit.edu	37	7	76796979	76796979	+	Translation_Start_Site	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:76796979G>A	uc003uga.2	+	2	121	c.-6G>A	c.(-8--4)TCGTG>TCATG		CCDC146_uc003ufz.1_Translation_Start_Site	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				TTTTAGAATCGTGAAAAATGG	0.308													4	31	---	---	---	---	capture	Translation_Start_Site	SNP	76796979	76796979	CCDC146	7	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	2754	191
CROT	54677	broad.mit.edu	37	7	86998729	86998729	+	Silent	SNP	G	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86998729G>T	uc003uit.2	+	7	830	c.585G>T	c.(583-585)CTG>CTT	p.L195L	CROT_uc003uiu.2_Silent_p.L223L	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	195					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TTGTAGTGCTGTGTCGAGGCC	0.428													71	273	---	---	---	---	capture	Silent	SNP	86998729	86998729	CROT	7	G	T	T	T	1	0	0	0	0	0	0	0	1	613	48	4	4	3859	191
ATP6V0A4	50617	broad.mit.edu	37	7	138440516	138440516	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138440516G>T	uc003vuf.2	-	9	972	c.734C>A	c.(733-735)ACT>AAT	p.T245N	ATP6V0A4_uc003vug.2_Missense_Mutation_p.T245N|ATP6V0A4_uc003vuh.2_Missense_Mutation_p.T245N	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	245	Cytoplasmic (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						AGGGTAGACAGTGGCTCGAAA	0.498													13	66	---	---	---	---	capture	Missense_Mutation	SNP	138440516	138440516	ATP6V0A4	7	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	1161	191
C9orf131	138724	broad.mit.edu	37	9	35045866	35045866	+	Nonstop_Mutation	SNP	G	C	C			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35045866G>C	uc003zvw.2	+	2	3269	c.3240G>C	c.(3238-3240)TAG>TAC	p.*1080Y	C9orf131_uc003zvu.2_Nonstop_Mutation_p.*1032Y|C9orf131_uc003zvv.2_Nonstop_Mutation_p.*1007Y|C9orf131_uc003zvx.2_Nonstop_Mutation_p.*1045Y	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	1080											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CTAGTCAGTAGAGAAAAGGCT	0.483													57	176	---	---	---	---	capture	Nonstop_Mutation	SNP	35045866	35045866	C9orf131	9	G	C	C	C	1	0	0	0	0	0	0	0	0	425	33	5	4	2434	191
GPR107	57720	broad.mit.edu	37	9	132848732	132848732	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:132848732A>G	uc004bze.2	+	7	825	c.598A>G	c.(598-600)AAT>GAT	p.N200D	GPR107_uc004bzb.2_Missense_Mutation_p.N11D|GPR107_uc004bzc.3_RNA|GPR107_uc011mbx.1_Missense_Mutation_p.N200D|GPR107_uc004bzd.2_Missense_Mutation_p.N200D	NM_001136557	NP_001130029	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107 isoform 1	200						integral to membrane				upper_aerodigestive_tract(1)	1		Ovarian(14;0.000531)				TGTTCATAATAATGGTGGGGC	0.348													42	124	---	---	---	---	capture	Missense_Mutation	SNP	132848732	132848732	GPR107	9	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	6557	191
STS	412	broad.mit.edu	37	X	7194035	7194035	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:7194035G>A	uc004cry.3	+	6	1110	c.865G>A	c.(865-867)GTG>ATG	p.V289M		NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor	289	Lumenal.				female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	CTACCTCCACGTGCACACAGC	0.423									Ichthyosis				3	36	---	---	---	---	capture	Missense_Mutation	SNP	7194035	7194035	STS	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15222	191
PHF16	9767	broad.mit.edu	37	X	46918293	46918293	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:46918293G>C	uc004dgx.2	+	11	2337	c.2286G>C	c.(2284-2286)CAG>CAC	p.Q762H	PHF16_uc004dgy.2_Missense_Mutation_p.Q762H	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN	PHD finger protein 16	762					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0						CTCCATATCAGGAAAATGATG	0.483													20	65	---	---	---	---	capture	Missense_Mutation	SNP	46918293	46918293	PHF16	23	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	11730	191
SLC6A14	11254	broad.mit.edu	37	X	115582754	115582754	+	Missense_Mutation	SNP	T	G	G			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:115582754T>G	uc004eqi.2	+	8	1182	c.1078T>G	c.(1078-1080)TTT>GTT	p.F360V		NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	360	Helical; Name=7; (Potential).				cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	CACTAGCGTGTTTGCTGGATT	0.358													5	290	---	---	---	---	capture	Missense_Mutation	SNP	115582754	115582754	SLC6A14	23	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	14569	191
CDR1	1038	broad.mit.edu	37	X	139865904	139865904	+	Missense_Mutation	SNP	C	T	T	rs143948461		TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:139865904C>T	uc004fbg.1	-	1	820	c.628G>A	c.(628-630)GGA>AGA	p.G210R	uc004fbf.1_RNA	NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	210											0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CCACATCTTCCGGAAAAAATC	0.438													40	166	---	---	---	---	capture	Missense_Mutation	SNP	139865904	139865904	CDR1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3140	191
SLC38A10	124565	broad.mit.edu	37	17	79226299	79226302	+	Frame_Shift_Del	DEL	TCTT	-	-			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79226299_79226302delTCTT	uc002jzz.1	-	13	2013_2016	c.1638_1641delAAGA	c.(1636-1641)GAAAGAfs	p.E546fs	SLC38A10_uc002jzy.1_Frame_Shift_Del_p.E464fs|SLC38A10_uc002kab.2_Frame_Shift_Del_p.E546fs	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	546_547					amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTTGTTTCTCTCTTTCTGAGTCGG	0.618													63	215	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	79226299	79226302	SLC38A10	17	TCTT	-	-	-	1	0	1	0	1	0	0	0	0	699	54	5	5	14494	191
CNTNAP3	79937	broad.mit.edu	37	9	39099958	39099959	+	Frame_Shift_Ins	INS	-	C	C			TCGA-27-1832-01	TCGA-27-1832-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:39099958_39099959insC	uc004abi.2	-	18	3183_3184	c.2944_2945insG	c.(2944-2946)GTCfs	p.V982fs	CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_RNA|CNTNAP3_uc004abk.1_Frame_Shift_Ins_p.V982fs	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	982	EGF-like 2.|Extracellular (Potential).				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GTCACAGGTGACCCCCCTGCGT	0.535													9	31	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	39099958	39099959	CNTNAP3	9	-	C	C	C	1	0	1	1	0	0	0	0	0	130	10	5	5	3613	191
