Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DVL1	1855	broad.mit.edu	37	1	1275475	1275475	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1275475C>T	uc001aer.3	-	8	899	c.852G>A	c.(850-852)ATG>ATA	p.M284I	DVL1_uc002quu.2_Missense_Mutation_p.M1I|DVL1_uc009vka.2_5'UTR|DVL1_uc001aeu.1_5'UTR	NM_004421	NP_004412	O14640	DVL1_HUMAN	dishevelled 1	284	PDZ.				canonical Wnt receptor signaling pathway|dendrite morphogenesis|intracellular signal transduction|negative regulation of protein binding|negative regulation of protein kinase activity|neural tube development|neuromuscular junction development|neurotransmitter secretion|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|receptor clustering|transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, planar cell polarity pathway	cytoplasmic membrane-bounded vesicle|cytosol|plasma membrane|synapse|synaptosome	frizzled binding|identical protein binding|protein kinase binding|signal transducer activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCCCGCCCTTCATGATGGAGC	0.627													9	20	---	---	---	---	capture	Missense_Mutation	SNP	1275475	1275475	DVL1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	4790	193
AGL	178	broad.mit.edu	37	1	100382185	100382185	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:100382185G>A	uc001dsi.1	+	33	4779	c.4379G>A	c.(4378-4380)CGT>CAT	p.R1460H	AGL_uc001dsj.1_Missense_Mutation_p.R1460H|AGL_uc001dsk.1_Missense_Mutation_p.R1460H|AGL_uc001dsl.1_Missense_Mutation_p.R1460H|AGL_uc001dsm.1_Missense_Mutation_p.R1444H|AGL_uc001dsn.1_Missense_Mutation_p.R1443H	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	1460	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TATTTTCTTCGTGCAAAATTA	0.308													24	43	---	---	---	---	capture	Missense_Mutation	SNP	100382185	100382185	AGL	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	384	193
DENND2C	163259	broad.mit.edu	37	1	115143493	115143493	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115143493G>A	uc001efd.1	-	14	2606	c.1904C>T	c.(1903-1905)GCT>GTT	p.A635V	DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.A578V	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	635	DENN.									skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCGTCCAGGAGCTGGGAAAGG	0.448													46	109	---	---	---	---	capture	Missense_Mutation	SNP	115143493	115143493	DENND2C	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	4388	193
SPAG17	200162	broad.mit.edu	37	1	118598400	118598400	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118598400T>A	uc001ehk.2	-	19	2746	c.2678A>T	c.(2677-2679)AAA>ATA	p.K893I		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	893						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		AGAAGTAAGTTTGGCATTAGC	0.323													5	134	---	---	---	---	capture	Missense_Mutation	SNP	118598400	118598400	SPAG17	1	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	14871	193
FLG	2312	broad.mit.edu	37	1	152276824	152276824	+	Missense_Mutation	SNP	G	A	A	rs143278829	by1000genomes	TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152276824G>A	uc001ezu.1	-	3	10574	c.10538C>T	c.(10537-10539)GCG>GTG	p.A3513V		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3513	Ser-rich.|Filaggrin 21.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGAGCTGTCCGCCTGAGTGGA	0.562									Ichthyosis				159	279	---	---	---	---	capture	Missense_Mutation	SNP	152276824	152276824	FLG	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5867	193
FLG	2312	broad.mit.edu	37	1	152286487	152286487	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152286487C>T	uc001ezu.1	-	3	911	c.875G>A	c.(874-876)CGT>CAT	p.R292H	uc001ezv.2_RNA	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	292	Filaggrin 1.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGATCCCCTACGCTTTCTTGT	0.502									Ichthyosis				8	529	---	---	---	---	capture	Missense_Mutation	SNP	152286487	152286487	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5867	193
CRNN	49860	broad.mit.edu	37	1	152382849	152382849	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152382849C>A	uc001ezx.2	-	3	783	c.709G>T	c.(709-711)GGT>TGT	p.G237C		NM_016190	NP_057274	Q9UBG3	CRNN_HUMAN	cornulin	237	Gln-rich.				cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGGTGGCACCTGCCTGGGTC	0.582													160	291	---	---	---	---	capture	Missense_Mutation	SNP	152382849	152382849	CRNN	1	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	3857	193
CACNA1E	777	broad.mit.edu	37	1	181549749	181549749	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:181549749A>T	uc001gow.2	+	6	953	c.788A>T	c.(787-789)GAC>GTC	p.D263V	CACNA1E_uc009wxr.2_Missense_Mutation_p.D170V|CACNA1E_uc009wxs.2_Missense_Mutation_p.D170V	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	263	I.|Extracellular (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GAAGGATTTGACCCCCCTCAC	0.507													10	299	---	---	---	---	capture	Missense_Mutation	SNP	181549749	181549749	CACNA1E	1	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	2518	193
FAM107B	83641	broad.mit.edu	37	10	14564008	14564008	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:14564008G>C	uc001imx.1	-	3	384	c.139C>G	c.(139-141)CCT>GCT	p.P47A	FAM107B_uc001ina.1_Missense_Mutation_p.P222A|FAM107B_uc010qbu.1_RNA|FAM107B_uc009xjg.1_Missense_Mutation_p.P47A|FAM107B_uc001imy.1_Missense_Mutation_p.P47A|FAM107B_uc001imz.1_Missense_Mutation_p.P47A	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641	47										breast(4)	4						TTGTTCTGAGGAGCAAGACCC	0.358													47	35	---	---	---	---	capture	Missense_Mutation	SNP	14564008	14564008	FAM107B	10	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	5344	193
PARD3	56288	broad.mit.edu	37	10	34663908	34663908	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:34663908C>T	uc010qej.1	-	11	1562	c.1562G>A	c.(1561-1563)GGC>GAC	p.G521D	PARD3_uc010qek.1_Missense_Mutation_p.G521D|PARD3_uc010qel.1_Missense_Mutation_p.G521D|PARD3_uc010qem.1_Missense_Mutation_p.G521D|PARD3_uc010qen.1_Missense_Mutation_p.G521D|PARD3_uc010qeo.1_Missense_Mutation_p.G521D|PARD3_uc010qep.1_Missense_Mutation_p.G477D|PARD3_uc010qeq.1_Missense_Mutation_p.G477D|PARD3_uc001ixo.1_Missense_Mutation_p.G251D|PARD3_uc001ixp.1_Missense_Mutation_p.G386D|PARD3_uc001ixq.1_Missense_Mutation_p.G521D|PARD3_uc001ixr.1_Missense_Mutation_p.G521D|PARD3_uc001ixt.1_Missense_Mutation_p.G342D|PARD3_uc001ixu.1_Missense_Mutation_p.G477D|PARD3_uc001ixs.1_Missense_Mutation_p.G174D	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	521	PDZ 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				TTGGGATTTGCCCACTAAATC	0.388													4	135	---	---	---	---	capture	Missense_Mutation	SNP	34663908	34663908	PARD3	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11347	193
PTEN	5728	broad.mit.edu	37	10	89720676	89720676	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720676A>G	uc001kfb.2	+	9	1858	c.827A>G	c.(826-828)AAT>AGT	p.N276S		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	276	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.D268_F279>VGQNVSLLGKYI(2)|p.N276fs*15(2)|p.G165_*404del(1)|p.G165_K342del(1)|p.W274_F341del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTTTGGGTAAATACATTCTTC	0.254		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			25	26	---	---	---	---	capture	Missense_Mutation	SNP	89720676	89720676	PTEN	10	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	12633	193
DNMBP	23268	broad.mit.edu	37	10	101715528	101715528	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:101715528G>C	uc001kqj.2	-	4	1795	c.1703C>G	c.(1702-1704)ACA>AGA	p.T568R	NCRNA00093_uc001kqk.1_RNA	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	568					intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		ATCTGGCTCTGTGCCGGGCCC	0.498													4	107	---	---	---	---	capture	Missense_Mutation	SNP	101715528	101715528	DNMBP	10	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	4630	193
NELL1	4745	broad.mit.edu	37	11	21135236	21135236	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:21135236C>T	uc001mqe.2	+	13	1555	c.1402C>T	c.(1402-1404)CGT>TGT	p.R468C	NELL1_uc001mqf.2_Missense_Mutation_p.R468C|NELL1_uc009yid.2_Missense_Mutation_p.R496C|NELL1_uc010rdo.1_Missense_Mutation_p.R411C|NELL1_uc010rdp.1_Missense_Mutation_p.R228C	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	468	EGF-like 2; calcium-binding (Potential).				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						AGGATACATTCGTGTGGATGA	0.403													77	169	---	---	---	---	capture	Missense_Mutation	SNP	21135236	21135236	NELL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10240	193
OR5M8	219484	broad.mit.edu	37	11	56258155	56258155	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56258155T>A	uc001nix.1	-	1	692	c.692A>T	c.(691-693)GAG>GTG	p.E231V		NM_001005282	NP_001005282	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M,	231	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	Esophageal squamous(21;0.00352)					TTGCCTGCCCTCTGTAGAGCG	0.413													22	49	---	---	---	---	capture	Missense_Mutation	SNP	56258155	56258155	OR5M8	11	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	11080	193
MS4A4A	51338	broad.mit.edu	37	11	60075609	60075609	+	Silent	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60075609C>T	uc001noz.2	+	7	688	c.678C>T	c.(676-678)CAC>CAT	p.H226H	MS4A4A_uc001npa.2_Silent_p.H207H|MS4A4A_uc001npb.2_Silent_p.H207H|MS4A4A_uc001npc.2_Silent_p.H154H	NM_148975	NP_683876	Q96JQ5	M4A4A_HUMAN	membrane-spanning 4-domains, subfamily A, member	226	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						CACATTCTCACATGGCAGAAA	0.458													67	109	---	---	---	---	capture	Silent	SNP	60075609	60075609	MS4A4A	11	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	9772	193
CCDC87	55231	broad.mit.edu	37	11	66359836	66359836	+	Silent	SNP	G	A	A	rs17853294		TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66359836G>A	uc001oiq.3	-	1	719	c.651C>T	c.(649-651)TTC>TTT	p.F217F	CCS_uc001oir.2_5'Flank	NM_018219	NP_060689	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	217										ovary(1)|skin(1)	2						GCACTTGGGCGAAGCCAGTGC	0.592													48	80	---	---	---	---	capture	Silent	SNP	66359836	66359836	CCDC87	11	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	2835	193
OPCML	4978	broad.mit.edu	37	11	132527102	132527102	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:132527102T>A	uc001qgs.2	-	2	330	c.280A>T	c.(280-282)ACA>TCA	p.T94S	OPCML_uc001qgu.2_Missense_Mutation_p.T87S|OPCML_uc010sck.1_Missense_Mutation_p.T94S|OPCML_uc001qgt.2_Missense_Mutation_p.T94S|OPCML_uc010scl.1_Missense_Mutation_p.T53S	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	94	Ig-like C2-type 1.				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TGGGTTGGTGTATTGACCAGG	0.532													11	184	---	---	---	---	capture	Missense_Mutation	SNP	132527102	132527102	OPCML	11	T	A	A	A	1	0	0	0	0	1	0	0	0	741	57	4	4	10778	193
MVK	4598	broad.mit.edu	37	12	110023885	110023885	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110023885A>G	uc001toy.3	+	6	770	c.586A>G	c.(586-588)ATT>GTT	p.I196V	MVK_uc009zvk.2_Missense_Mutation_p.I196V|MVK_uc010sxr.1_Missense_Mutation_p.I144V|MVK_uc001toz.3_Missense_Mutation_p.I2V|MVK_uc001tpc.3_RNA	NM_001114185	NP_001107657	Q03426	KIME_HUMAN	mevalonate kinase	196					cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|peroxisome	ATP binding|identical protein binding|mevalonate kinase activity				0						GGAGAGAATGATTCACGGGAA	0.453													24	44	---	---	---	---	capture	Missense_Mutation	SNP	110023885	110023885	MVK	12	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	9905	193
FZD10	11211	broad.mit.edu	37	12	130647861	130647861	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130647861A>T	uc001uii.2	+	1	830	c.374A>T	c.(373-375)AAC>ATC	p.N125I	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	125	FZ.|Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		GAGCAGTTCAACTTCAAGTGG	0.642													85	181	---	---	---	---	capture	Missense_Mutation	SNP	130647861	130647861	FZD10	12	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	6071	193
OLFM4	10562	broad.mit.edu	37	13	53624555	53624555	+	Silent	SNP	T	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:53624555T>A	uc001vhl.2	+	5	1182	c.1182T>A	c.(1180-1182)GTT>GTA	p.V394V	OLFM4_uc001vhk.1_3'UTR	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN	olfactomedin 4 precursor	394	Olfactomedin-like.				cell adhesion	extracellular space				skin(1)	1		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GATTGTGGGTTATTTATTCAA	0.398													152	88	---	---	---	---	capture	Silent	SNP	53624555	53624555	OLFM4	13	T	A	A	A	1	0	0	0	0	0	0	0	1	782	61	4	4	10760	193
OR10G2	26534	broad.mit.edu	37	14	22102705	22102705	+	Silent	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:22102705C>T	uc010tmc.1	-	1	294	c.294G>A	c.(292-294)CCG>CCA	p.P98P		NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		AGCCACCAAACGGGATAGCCT	0.493													28	23	---	---	---	---	capture	Silent	SNP	22102705	22102705	OR10G2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	10803	193
FOXA1	3169	broad.mit.edu	37	14	38060669	38060669	+	Silent	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38060669G>A	uc001wuf.2	-	2	1632	c.1320C>T	c.(1318-1320)GGC>GGT	p.G440G	FOXA1_uc010tpz.1_Silent_p.G407G	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	440					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CCGAGGCGCTGCCTAGAGGCA	0.607													41	28	---	---	---	---	capture	Silent	SNP	38060669	38060669	FOXA1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	5933	193
ZNF839	55778	broad.mit.edu	37	14	102792551	102792551	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:102792551C>T	uc001ylo.2	+	2	520	c.170C>T	c.(169-171)CCT>CTT	p.P57L	ZNF839_uc010awk.1_Missense_Mutation_p.P173L|ZNF839_uc001ylp.2_RNA|ZNF839_uc001ylq.1_Missense_Mutation_p.P57L|ZNF839_uc001ylr.2_Missense_Mutation_p.P57L	NM_018335	NP_060805	A8K0R7	ZN839_HUMAN	zinc finger protein 839	57						intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2						TGCCAACCTCCTGCTCAGGGG	0.597													17	10	---	---	---	---	capture	Missense_Mutation	SNP	102792551	102792551	ZNF839	14	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	18064	193
ANKS4B	257629	broad.mit.edu	37	16	21261689	21261689	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21261689C>T	uc010bwp.1	+	2	845	c.802C>T	c.(802-804)CGT>TGT	p.R268C	CRYM_uc010bwq.1_Intron	NM_145865	NP_665872	Q8N8V4	ANS4B_HUMAN	harmonin-interacting ankyrin-repeat containing	268										ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0565)		CATTCTCAATCGTCCAGGTCT	0.468													36	34	---	---	---	---	capture	Missense_Mutation	SNP	21261689	21261689	ANKS4B	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	685	193
PRKCB	5579	broad.mit.edu	37	16	24185839	24185839	+	Silent	SNP	A	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24185839A>T	uc002dmd.2	+	12	1529	c.1332A>T	c.(1330-1332)GTA>GTT	p.V444V	PRKCB_uc002dme.2_Silent_p.V444V	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	444	Protein kinase.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	TTAATTTCAGATTTTACGCTG	0.383													5	77	---	---	---	---	capture	Silent	SNP	24185839	24185839	PRKCB	16	A	T	T	T	1	0	0	0	0	0	0	0	1	145	12	4	4	12404	193
CHD9	80205	broad.mit.edu	37	16	53337839	53337839	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53337839C>T	uc002ehb.2	+	30	6085	c.5921C>T	c.(5920-5922)GCT>GTT	p.A1974V	CHD9_uc002egy.2_Missense_Mutation_p.A1974V|CHD9_uc002ehc.2_Missense_Mutation_p.A1974V|CHD9_uc002ehf.2_Missense_Mutation_p.A1088V|CHD9_uc010cbw.2_Intron|CHD9_uc002ehg.1_5'UTR	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1974					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				CTTATTGGTGCTGCCAAACAC	0.468													28	95	---	---	---	---	capture	Missense_Mutation	SNP	53337839	53337839	CHD9	16	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	3298	193
SEZ6	124925	broad.mit.edu	37	17	27308674	27308674	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27308674G>A	uc002hdp.2	-	2	633	c.439C>T	c.(439-441)CCT>TCT	p.P147S	SEZ6_uc002hdm.2_RNA|SEZ6_uc010cry.1_Missense_Mutation_p.P147S|SEZ6_uc002hdq.1_Missense_Mutation_p.P22S|SEZ6_uc010crz.1_Missense_Mutation_p.P147S	NM_178860	NP_849191	Q53EL9	SEZ6_HUMAN	seizure related 6 homolog isoform 1	147	Pro-rich.|Extracellular (Potential).					integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			CGAAGCATAGGGGACTCTGAC	0.652													18	25	---	---	---	---	capture	Missense_Mutation	SNP	27308674	27308674	SEZ6	17	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	14035	193
PPM1D	8493	broad.mit.edu	37	17	58678099	58678099	+	Silent	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:58678099C>T	uc002iyt.1	+	1	546	c.324C>T	c.(322-324)GGC>GGT	p.G108G	PPM1D_uc010ddm.1_RNA	NM_003620	NP_003611	O15297	PPM1D_HUMAN	protein phosphatase 1D	108	PP2C-like.				negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			ACGGGCACGGCGGGCGGGAGG	0.692													3	20	---	---	---	---	capture	Silent	SNP	58678099	58678099	PPM1D	17	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	12238	193
SLC39A11	201266	broad.mit.edu	37	17	70644980	70644980	+	Silent	SNP	G	A	A	rs146713017		TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:70644980G>A	uc002jjb.2	-	9	1027	c.912C>T	c.(910-912)TAC>TAT	p.Y304Y	SLC39A11_uc002jja.2_Silent_p.Y297Y	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1	304	Helical; (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						CCATGACCACGTAGACCATGG	0.642													5	80	---	---	---	---	capture	Silent	SNP	70644980	70644980	SLC39A11	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14506	193
TBC1D16	125058	broad.mit.edu	37	17	77915925	77915925	+	Silent	SNP	C	T	T	rs149251119	byFrequency	TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77915925C>T	uc002jxj.2	-	11	2105	c.1989G>A	c.(1987-1989)ACG>ACA	p.T663T	TBC1D16_uc002jxh.2_Silent_p.T301T|TBC1D16_uc002jxi.2_Silent_p.T288T	NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	663						intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			GCATCTGGTCCGTGGCCAGCT	0.622													11	16	---	---	---	---	capture	Silent	SNP	77915925	77915925	TBC1D16	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15493	193
CYP2A13	1553	broad.mit.edu	37	19	41597775	41597775	+	Missense_Mutation	SNP	C	T	T	rs143140637		TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41597775C>T	uc002opt.2	+	5	802	c.793C>T	c.(793-795)CGG>TGG	p.R265W		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	265					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	CAATTCCCCACGGGACTTCAT	0.582													8	124	---	---	---	---	capture	Missense_Mutation	SNP	41597775	41597775	CYP2A13	19	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	4121	193
LHCGR	3973	broad.mit.edu	37	2	48958384	48958384	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48958384A>T	uc002rwu.3	-	2	285	c.215T>A	c.(214-216)CTT>CAT	p.L72H	GTF2A1L_uc002rwt.2_Intron|LHCGR_uc002rwv.2_RNA	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	72	Extracellular (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	GACCTCATTAAGTCCTCTGAA	0.338									Familial_Male-Limited_Precocious_Puberty				29	127	---	---	---	---	capture	Missense_Mutation	SNP	48958384	48958384	LHCGR	2	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	8682	193
TSGA10	80705	broad.mit.edu	37	2	99636771	99636771	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:99636771C>T	uc002szg.3	-	16	2417	c.1789G>A	c.(1789-1791)GAA>AAA	p.E597K	TSGA10_uc002szh.3_Missense_Mutation_p.E597K|TSGA10_uc002szi.3_Missense_Mutation_p.E597K|TSGA10_uc010fin.1_Missense_Mutation_p.E597K	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	597	Interaction with HIF1A (By similarity).				spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2						CAAAGGTGTTCTTTAAGAAGC	0.323													13	127	---	---	---	---	capture	Missense_Mutation	SNP	99636771	99636771	TSGA10	2	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	16500	193
GPD2	2820	broad.mit.edu	37	2	157439407	157439407	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:157439407G>A	uc002tzf.3	+	17	2521	c.2161G>A	c.(2161-2163)GAC>AAC	p.D721N	GPD2_uc010zch.1_Missense_Mutation_p.D494N|GPD2_uc002tzd.3_Missense_Mutation_p.D721N|GPD2_uc002tze.1_RNA	NM_001083112	NP_001076581	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2,	721					cellular lipid metabolic process	glycerol-3-phosphate dehydrogenase complex|mitochondrial inner membrane	calcium ion binding|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity			ovary(1)	1						AATTCCAGTGGACCGTAGTTG	0.443													16	77	---	---	---	---	capture	Missense_Mutation	SNP	157439407	157439407	GPD2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	6540	193
XIRP2	129446	broad.mit.edu	37	2	168098387	168098387	+	Silent	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168098387C>T	uc002udx.2	+	7	1161	c.1143C>T	c.(1141-1143)GAC>GAT	p.D381D	XIRP2_uc010fpn.2_Silent_p.D414D|XIRP2_uc010fpo.2_Silent_p.D381D|XIRP2_uc010fpp.2_Silent_p.D381D|XIRP2_uc002udy.2_Silent_p.D206D|XIRP2_uc010fpq.2_Silent_p.D159D|XIRP2_uc010fpr.2_Silent_p.D159D	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	206					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TTTATTCTGACAAAGAGATGA	0.368													75	185	---	---	---	---	capture	Silent	SNP	168098387	168098387	XIRP2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	17311	193
ALS2CR8	79800	broad.mit.edu	37	2	203846966	203846966	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:203846966T>C	uc002uzo.2	+	15	2141	c.1861T>C	c.(1861-1863)TGC>CGC	p.C621R	ALS2CR8_uc010zia.1_Missense_Mutation_p.C545R|ALS2CR8_uc010zib.1_Missense_Mutation_p.C545R|ALS2CR8_uc010zic.1_Missense_Mutation_p.C533R|ALS2CR8_uc002uzp.2_Missense_Mutation_p.C621R	NM_001104586	NP_001098056	Q8N187	AL2S8_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	621										large_intestine(1)|ovary(1)	2						AAGAGATACATGCTTAACCCA	0.418													19	127	---	---	---	---	capture	Missense_Mutation	SNP	203846966	203846966	ALS2CR8	2	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	555	193
EPHA4	2043	broad.mit.edu	37	2	222428934	222428934	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:222428934C>T	uc002vmq.2	-	3	382	c.340G>A	c.(340-342)GTC>ATC	p.V114I	EPHA4_uc002vmr.2_Missense_Mutation_p.V114I|EPHA4_uc010zlm.1_Missense_Mutation_p.V55I|EPHA4_uc010zln.1_Missense_Mutation_p.V114I	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor	114	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GTCCCCATGACGCCCGGAAGA	0.453													125	207	---	---	---	---	capture	Missense_Mutation	SNP	222428934	222428934	EPHA4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5124	193
HAO1	54363	broad.mit.edu	37	20	7915230	7915230	+	Missense_Mutation	SNP	T	G	G			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:7915230T>G	uc002wmw.1	-	2	214	c.190A>C	c.(190-192)ACT>CCT	p.T64P	HAO1_uc010gbu.2_Missense_Mutation_p.T64P	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	64	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						AAAACAGAAGTCGACAGATCT	0.458													4	177	---	---	---	---	capture	Missense_Mutation	SNP	7915230	7915230	HAO1	20	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	6878	193
CSTF1	1477	broad.mit.edu	37	20	54978729	54978729	+	Silent	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54978729G>A	uc002xxl.1	+	6	1442	c.1242G>A	c.(1240-1242)ACG>ACA	p.T414T	CSTF1_uc002xxm.1_Silent_p.T414T|CSTF1_uc002xxn.1_Silent_p.T414T|CSTF1_uc002xxo.1_Silent_p.T357T	NM_001033521	NP_001028693	Q05048	CSTF1_HUMAN	cleavage stimulation factor subunit 1	414	WD 6.				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding			central_nervous_system(1)	1			Colorectal(105;0.202)			GGTTCATGACGTGCAGCGATG	0.587													85	134	---	---	---	---	capture	Silent	SNP	54978729	54978729	CSTF1	20	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	3948	193
COL6A2	1292	broad.mit.edu	37	21	47545941	47545941	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47545941C>T	uc002zia.1	+	26	2294	c.2212C>T	c.(2212-2214)CGG>TGG	p.R738W	COL6A2_uc002zhy.1_Missense_Mutation_p.R738W|COL6A2_uc002zhz.1_Missense_Mutation_p.R738W|COL6A2_uc002zib.1_Missense_Mutation_p.R144W|COL6A2_uc002zic.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	738	VWFA 2.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCACGACCCTCGGGACGATGA	0.622													79	105	---	---	---	---	capture	Missense_Mutation	SNP	47545941	47545941	COL6A2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	3665	193
RPL32	6161	broad.mit.edu	37	3	12881707	12881707	+	Silent	SNP	G	A	A	rs144517633		TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12881707G>A	uc003bxl.2	-	1	243	c.30C>T	c.(28-30)CCC>CCT	p.P10P	RPL32_uc003bxm.2_Silent_p.P10P|RPL32_uc003bxn.2_Silent_p.P10P	NM_001007074	NP_001007075	P62910	RL32_HUMAN	ribosomal protein L32	10					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome			ovary(1)	1						TGACGATCTTGGGCTTCACAA	0.537													58	450	---	---	---	---	capture	Silent	SNP	12881707	12881707	RPL32	3	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	13474	193
CELSR3	1951	broad.mit.edu	37	3	48697393	48697393	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48697393C>T	uc003cul.2	-	1	2956	c.2675G>A	c.(2674-2676)CGT>CAT	p.R892H	CELSR3_uc003cuf.1_Missense_Mutation_p.R962H	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	892	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ATAGGTGATACGAGCATTCTC	0.363													43	43	---	---	---	---	capture	Missense_Mutation	SNP	48697393	48697393	CELSR3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3191	193
MYH15	22989	broad.mit.edu	37	3	108189636	108189636	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108189636A>G	uc003dxa.1	-	14	1409	c.1352T>C	c.(1351-1353)CTA>CCA	p.L451P		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	451	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CCGTGCCACTAGCCACTTAAA	0.458													8	84	---	---	---	---	capture	Missense_Mutation	SNP	108189636	108189636	MYH15	3	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	9944	193
PHLDB2	90102	broad.mit.edu	37	3	111604066	111604066	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111604066G>A	uc010hqa.2	+	2	1553	c.1142G>A	c.(1141-1143)AGG>AAG	p.R381K	PHLDB2_uc003dyc.2_Missense_Mutation_p.R408K|PHLDB2_uc003dyd.2_Missense_Mutation_p.R381K|PHLDB2_uc003dyg.2_Missense_Mutation_p.R381K|PHLDB2_uc003dyh.2_Missense_Mutation_p.R381K|PHLDB2_uc003dye.3_Missense_Mutation_p.R381K|PHLDB2_uc003dyf.3_Missense_Mutation_p.R381K	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	381						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						GCGACCAGGAGGAACTTCTCT	0.517													98	139	---	---	---	---	capture	Missense_Mutation	SNP	111604066	111604066	PHLDB2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11755	193
EPHB1	2047	broad.mit.edu	37	3	134920351	134920351	+	Silent	SNP	G	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:134920351G>T	uc003eqt.2	+	12	2386	c.2166G>T	c.(2164-2166)GTG>GTT	p.V722V	EPHB1_uc003equ.2_Silent_p.V283V	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	722	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TCCAGCTTGTGGGTATGCTCA	0.507													15	458	---	---	---	---	capture	Silent	SNP	134920351	134920351	EPHB1	3	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	5129	193
PRR23C	389152	broad.mit.edu	37	3	138763141	138763141	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138763141C>T	uc011bmt.1	-	1	594	c.322G>A	c.(322-324)GTC>ATC	p.V108I		NM_001134657	NP_001128129	Q6ZRP0	PR23C_HUMAN	proline rich 23C	108										skin(1)	1						CATTCGTCGACGGAGCTCAGG	0.642													13	23	---	---	---	---	capture	Missense_Mutation	SNP	138763141	138763141	PRR23C	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12491	193
MBNL1	4154	broad.mit.edu	37	3	152018056	152018056	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:152018056G>A	uc003ezm.2	+	1	863	c.74G>A	c.(73-75)GGG>GAG	p.G25E	MBNL1_uc003ezh.2_Missense_Mutation_p.G25E|MBNL1_uc003ezi.2_Missense_Mutation_p.G25E|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezl.2_Missense_Mutation_p.G25E|MBNL1_uc003ezp.2_Missense_Mutation_p.G25E|MBNL1_uc003ezn.2_Missense_Mutation_p.G25E|MBNL1_uc003ezo.2_Missense_Mutation_p.G25E|MBNL1_uc003ezg.1_RNA|MBNL1_uc003ezk.1_RNA	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	25	C3H1-type 1.				embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTCCAGAGGGGGACTTGCTCA	0.428													57	138	---	---	---	---	capture	Missense_Mutation	SNP	152018056	152018056	MBNL1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9266	193
MBNL1	4154	broad.mit.edu	37	3	152132751	152132751	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:152132751T>A	uc003ezm.2	+	2	985	c.196T>A	c.(196-198)TGC>AGC	p.C66S	MBNL1_uc003ezh.2_Missense_Mutation_p.C66S|MBNL1_uc003ezi.2_Missense_Mutation_p.C66S|MBNL1_uc003ezj.2_Missense_Mutation_p.C9S|MBNL1_uc003ezl.2_Missense_Mutation_p.C66S|MBNL1_uc003ezp.2_Missense_Mutation_p.C66S|MBNL1_uc003ezn.2_Missense_Mutation_p.C66S|MBNL1_uc003ezo.2_Missense_Mutation_p.C66S|MBNL1_uc010hvp.2_5'UTR	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	66	C3H1-type 2.				embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CAGGGAGAACTGCAAATATCT	0.393													10	234	---	---	---	---	capture	Missense_Mutation	SNP	152132751	152132751	MBNL1	3	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	9266	193
ALG3	10195	broad.mit.edu	37	3	183960423	183960423	+	Missense_Mutation	SNP	T	G	G			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183960423T>G	uc003fne.2	-	9	1227	c.1196A>C	c.(1195-1197)TAC>TCC	p.Y399S	ALG3_uc011brc.1_Missense_Mutation_p.Y364S|ALG3_uc011brd.1_Missense_Mutation_p.Y343S|ALG3_uc011bre.1_Missense_Mutation_p.Y351S	NM_005787	NP_005778	Q92685	ALG3_HUMAN	alpha-1,3-mannosyltransferase ALG3 isoform a	399					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity				0	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGTGGAAGGGTATGTGTTCCA	0.587													5	45	---	---	---	---	capture	Missense_Mutation	SNP	183960423	183960423	ALG3	3	T	G	G	G	1	0	0	0	0	1	0	0	0	741	57	4	4	520	193
FRAS1	80144	broad.mit.edu	37	4	79400664	79400664	+	Silent	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79400664G>A	uc003hlb.2	+	56	8675	c.8235G>A	c.(8233-8235)GGG>GGA	p.G2745G		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2740	Extracellular (Potential).|Calx-beta 2.				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TGATATTCGGGCCTGGTGTGA	0.483													33	66	---	---	---	---	capture	Silent	SNP	79400664	79400664	FRAS1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	5986	193
ENPEP	2028	broad.mit.edu	37	4	111474494	111474494	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:111474494C>T	uc003iab.3	+	18	2867	c.2525C>T	c.(2524-2526)ACG>ATG	p.T842M		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	842	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	CTCAAGGACACGAACCTTATT	0.353													62	179	---	---	---	---	capture	Missense_Mutation	SNP	111474494	111474494	ENPEP	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5083	193
NR3C2	4306	broad.mit.edu	37	4	149357361	149357361	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:149357361C>T	uc003ilj.3	-	2	986	c.652G>A	c.(652-654)GCC>ACC	p.A218T	NR3C2_uc003ilk.3_Missense_Mutation_p.A218T|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	218	Modulating.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	CCAAAGCTGGCTGTGGTGGAG	0.532													13	86	---	---	---	---	capture	Missense_Mutation	SNP	149357361	149357361	NR3C2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	10538	193
SOX30	11063	broad.mit.edu	37	5	157078493	157078493	+	Silent	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:157078493G>A	uc003lxb.1	-	1	936	c.594C>T	c.(592-594)GGC>GGT	p.G198G	SOX30_uc003lxc.1_Silent_p.G198G|SOX30_uc011dds.1_Intron	NM_178424	NP_848511	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30 isoform a	198					regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)|central_nervous_system(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGCCTGCCCCGCCTTGCATCG	0.657													74	70	---	---	---	---	capture	Silent	SNP	157078493	157078493	SOX30	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14844	193
DDR1	780	broad.mit.edu	37	6	30861171	30861171	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30861171C>T	uc003nrr.2	+	11	1577	c.1318C>T	c.(1318-1320)CGG>TGG	p.R440W	DDR1_uc010jse.2_Missense_Mutation_p.R440W|DDR1_uc003nrq.2_Missense_Mutation_p.R440W|DDR1_uc003nrs.2_Missense_Mutation_p.R440W|DDR1_uc003nrt.2_Missense_Mutation_p.R440W|DDR1_uc011dms.1_Missense_Mutation_p.R458W|DDR1_uc003nru.2_Missense_Mutation_p.R440W|DDR1_uc003nrv.2_Missense_Mutation_p.R440W|DDR1_uc003nrw.1_Missense_Mutation_p.R239W|DDR1_uc003nry.1_RNA|DDR1_uc003nrx.1_RNA	NM_013993	NP_054699	Q08345	DDR1_HUMAN	discoidin domain receptor family, member 1	440	Helical; (Potential).				cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)	CATGCTCTGGCGGCTGCACTG	0.697													8	19	---	---	---	---	capture	Missense_Mutation	SNP	30861171	30861171	DDR1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4295	193
THSD7A	221981	broad.mit.edu	37	7	11514021	11514021	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:11514021C>T	uc003ssf.3	-	8	2444	c.2192G>A	c.(2191-2193)GGC>GAC	p.G731D		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	731	TSP type-1 7.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TGTCTGCATGCCGACAGAGCA	0.512										HNSCC(18;0.044)			5	199	---	---	---	---	capture	Missense_Mutation	SNP	11514021	11514021	THSD7A	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15764	193
IGF2BP3	10643	broad.mit.edu	37	7	23509595	23509595	+	Silent	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23509595C>T	uc003swg.2	-	1	401	c.135G>A	c.(133-135)CCG>CCA	p.P45P	IGF2BP3_uc003swh.1_RNA	NM_006547	NP_006538	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding	45	RRM 1.				anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2						AGCTCTCGTCCGGGCAGTCCA	0.697													56	174	---	---	---	---	capture	Silent	SNP	23509595	23509595	IGF2BP3	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7500	193
GNAT3	346562	broad.mit.edu	37	7	80117947	80117947	+	Silent	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80117947G>A	uc011kgu.1	-	3	207	c.207C>T	c.(205-207)TTC>TTT	p.F69F	CD36_uc003uhc.2_Intron	NM_001102386	NP_001095856	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha	69					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|rhodopsin mediated phototransduction|sensory perception of sweet taste|sensory perception of umami taste	cytoplasm|heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						TTACTGCTTTGAACTCCATGC	0.338													7	33	---	---	---	---	capture	Silent	SNP	80117947	80117947	GNAT3	7	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	6449	193
TRRAP	8295	broad.mit.edu	37	7	98554147	98554147	+	Silent	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98554147C>T	uc003upp.2	+	42	6410	c.6201C>T	c.(6199-6201)GCC>GCT	p.A2067A	TRRAP_uc011kis.1_Silent_p.A2049A|TRRAP_uc003upr.2_Silent_p.A1766A	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	2067	Interaction with TP53.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CCACCGGAGCCATCAGTGCAG	0.512													16	218	---	---	---	---	capture	Silent	SNP	98554147	98554147	TRRAP	7	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	16484	193
TRRAP	8295	broad.mit.edu	37	7	98567836	98567836	+	Silent	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98567836C>T	uc003upp.2	+	51	7802	c.7593C>T	c.(7591-7593)CAC>CAT	p.H2531H	TRRAP_uc011kis.1_Silent_p.H2513H|TRRAP_uc003upr.2_Silent_p.H2230H	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	2531					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CCGATAGCCACGACCGTGCCG	0.632													8	114	---	---	---	---	capture	Silent	SNP	98567836	98567836	TRRAP	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16484	193
CLCN1	1180	broad.mit.edu	37	7	143043325	143043325	+	Silent	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143043325G>A	uc003wcr.1	+	18	2352	c.2265G>A	c.(2263-2265)CCG>CCA	p.P755P	CLCN1_uc011ktc.1_Silent_p.P367P	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	755	Cytoplasmic (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					AACAGCAGCCGGAAGCACCAG	0.602													7	54	---	---	---	---	capture	Silent	SNP	143043325	143043325	CLCN1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3427	193
OR6B1	135946	broad.mit.edu	37	7	143701705	143701705	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143701705A>G	uc003wdt.1	+	1	616	c.616A>G	c.(616-618)ATC>GTC	p.I206V		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	206	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					GGCACTGGTCATCTTCCTATT	0.458													96	240	---	---	---	---	capture	Missense_Mutation	SNP	143701705	143701705	OR6B1	7	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	11091	193
HR	55806	broad.mit.edu	37	8	21983183	21983183	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:21983183G>T	uc003xas.2	-	4	2133	c.1468C>A	c.(1468-1470)CTC>ATC	p.L490I	HR_uc003xat.2_Missense_Mutation_p.L490I	NM_005144	NP_005135	O43593	HAIR_HUMAN	hairless protein isoform a	490							DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		TTTGCAGGGAGAGCCAGGCAT	0.602													7	40	---	---	---	---	capture	Missense_Mutation	SNP	21983183	21983183	HR	8	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	7272	193
CYP11B2	1585	broad.mit.edu	37	8	143994857	143994857	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143994857G>A	uc003yxk.1	-	6	968	c.965C>T	c.(964-966)CCC>CTC	p.P322L		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	322					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	CATCAGCAAGGGAAACGCTGT	0.632									Familial_Hyperaldosteronism_type_I				21	75	---	---	---	---	capture	Missense_Mutation	SNP	143994857	143994857	CYP11B2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4106	193
IFNB1	3456	broad.mit.edu	37	9	21077465	21077465	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21077465C>A	uc003zok.2	-	1	479	c.404G>T	c.(403-405)GGA>GTA	p.G135V		NM_002176	NP_002167	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast precursor	135					activation of caspase activity|B cell proliferation|blood coagulation|cellular response to exogenous dsRNA|defense response to virus|induction of apoptosis|natural killer cell activation|negative regulation of cell proliferation|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of viral genome replication|negative regulation of viral transcription|negative regulation of virion penetration into host cell|positive regulation of innate immune response|positive regulation of transcription from RNA polymerase II promoter|regulation of MHC class I biosynthetic process|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding|transcription corepressor activity			ovary(1)|breast(1)|kidney(1)	3				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)	Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)	CATGAGTTTTCCCCTGGTGAA	0.443													274	103	---	---	---	---	capture	Missense_Mutation	SNP	21077465	21077465	IFNB1	9	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	7471	193
OR1J4	26219	broad.mit.edu	37	9	125281885	125281885	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125281885G>A	uc011lyw.1	+	1	466	c.466G>A	c.(466-468)GCC>ACC	p.A156T		NM_001004452	NP_001004452	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTGTACCAATGCCCTGTCTCA	0.517													158	65	---	---	---	---	capture	Missense_Mutation	SNP	125281885	125281885	OR1J4	9	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	10865	193
GTF3C4	9329	broad.mit.edu	37	9	135546145	135546145	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135546145C>T	uc010mzv.2	+	1	418	c.160C>T	c.(160-162)CGG>TGG	p.R54W	DDX31_uc004cbq.1_5'Flank|DDX31_uc010mzu.1_5'Flank|DDX31_uc004cbr.1_5'Flank|DDX31_uc004cbs.1_5'Flank|GTF3C4_uc010mzw.2_RNA	NM_012204	NP_036336	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC 4	54					transcription initiation from RNA polymerase III promoter	transcription factor TFIIIC complex	DNA binding|enzyme activator activity|histone acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		GGTGACTCGGCGGGAGCCGGC	0.567													3	0	---	---	---	---	capture	Missense_Mutation	SNP	135546145	135546145	GTF3C4	9	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	6804	193
C9orf116	138162	broad.mit.edu	37	9	138387358	138387358	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138387358G>A	uc004cft.1	-	3	390	c.326C>T	c.(325-327)ACT>ATT	p.T109I	C9orf116_uc004cfs.1_3'UTR|C9orf116_uc004cfu.1_RNA	NM_001048265	NP_001041730	Q5BN46	CI116_HUMAN	hypothetical protein LOC138162 isoform 1	109											0				OV - Ovarian serous cystadenocarcinoma(145;7.39e-08)|Epithelial(140;5.19e-07)|all cancers(34;1.04e-05)		ATCGGGGCCAGTCACGATGCT	0.478													113	40	---	---	---	---	capture	Missense_Mutation	SNP	138387358	138387358	C9orf116	9	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	2427	193
CSF2RA	1438	broad.mit.edu	37	X	1407665	1407665	+	Silent	SNP	C	T	T			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1407665C>T	uc010nct.2	+	7	679	c.357C>T	c.(355-357)ACC>ACT	p.T119T	CSF2RA_uc011mhb.1_Silent_p.T119T|CSF2RA_uc004cpq.2_Silent_p.T119T|CSF2RA_uc004cpn.2_Silent_p.T119T|CSF2RA_uc004cpo.2_Silent_p.T119T|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_5'UTR|CSF2RA_uc004cpp.2_Silent_p.T119T|CSF2RA_uc010ncv.2_Silent_p.T119T|CSF2RA_uc004cpr.2_Silent_p.T119T	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	119	Extracellular (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GGGAGGGTACCGCTGCTCAGA	0.517													155	577	---	---	---	---	capture	Silent	SNP	1407665	1407665	CSF2RA	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3899	193
CNTN5	53942	broad.mit.edu	37	11	99827702	99827703	+	Frame_Shift_Ins	INS	-	TCCTTAGTCC	TCCTTAGTCC			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:99827702_99827703insTCCTTAGTCC	uc001pga.2	+	8	1177_1178	c.838_839insTCCTTAGTCC	c.(838-840)GTCfs	p.V280fs	CNTN5_uc009ywv.1_Frame_Shift_Ins_p.V280fs|CNTN5_uc001pfz.2_Frame_Shift_Ins_p.V280fs|CNTN5_uc001pgb.2_Frame_Shift_Ins_p.V206fs	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	280	Ig-like C2-type 2.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GAATGCTAGAGTCCTTAGTCCT	0.416													9	66	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	99827702	99827703	CNTN5	11	-	TCCTTAGTCC	TCCTTAGTCC	TCCTTAGTCC	1	0	1	1	0	0	0	0	0	468	36	5	5	3609	193
PEX1	5189	broad.mit.edu	37	7	92146721	92146721	+	Frame_Shift_Del	DEL	T	-	-			TCGA-27-1834-01	TCGA-27-1834-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92146721delT	uc003uly.2	-	5	1204	c.1108delA	c.(1108-1110)ATTfs	p.I370fs	PEX1_uc011khr.1_Frame_Shift_Del_p.I162fs|PEX1_uc010ley.2_Frame_Shift_Del_p.I370fs|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_RNA	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	370					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TCTGACCTAATTTTTTTTTGA	0.353													7	467	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	92146721	92146721	PEX1	7	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	11638	193
