Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PLEKHO1	51177	broad.mit.edu	37	1	150131552	150131552	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150131552C>T	uc001ett.2	+	6	1342	c.1064C>T	c.(1063-1065)ACG>ATG	p.T355M	PLEKHO1_uc001etr.2_Missense_Mutation_p.T183M|PLEKHO1_uc001ets.2_Missense_Mutation_p.T172M|PLEKHO1_uc001etu.2_Missense_Mutation_p.T183M	NM_016274	NP_057358	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O	355	Negative regulator of AP-1 activity.					cytoplasm|nucleus|plasma membrane				lung(1)	1	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGCTGGAGACGGAACGGCTG	0.607													25	30	---	---	---	---	capture	Missense_Mutation	SNP	150131552	150131552	PLEKHO1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11987	194
TCHH	7062	broad.mit.edu	37	1	152083688	152083688	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152083688C>G	uc001ezp.2	-	2	2005	c.2005G>C	c.(2005-2007)GAG>CAG	p.E669Q	TCHH_uc009wne.1_Missense_Mutation_p.E669Q	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	669	9 X 28 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCGCTGCTCGAGCCTCTCT	0.662													27	42	---	---	---	---	capture	Missense_Mutation	SNP	152083688	152083688	TCHH	1	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	15585	194
NUP210L	91181	broad.mit.edu	37	1	154110601	154110601	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154110601C>A	uc001fdw.2	-	6	903	c.831G>T	c.(829-831)ATG>ATT	p.M277I	NUP210L_uc009woq.2_5'Flank|NUP210L_uc010peh.1_Missense_Mutation_p.M277I	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	277						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TCCCTTGAACCATTTTTGCAA	0.343													62	84	---	---	---	---	capture	Missense_Mutation	SNP	154110601	154110601	NUP210L	1	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	10668	194
SPTA1	6708	broad.mit.edu	37	1	158626393	158626393	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158626393G>C	uc001fst.1	-	20	3058	c.2859C>G	c.(2857-2859)GAC>GAG	p.D953E		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	953	Spectrin 10.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTTTCATACTGTCTCCAAATG	0.413													100	182	---	---	---	---	capture	Missense_Mutation	SNP	158626393	158626393	SPTA1	1	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	15008	194
SPTA1	6708	broad.mit.edu	37	1	158632602	158632602	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158632602C>T	uc001fst.1	-	17	2553	c.2354G>A	c.(2353-2355)CGA>CAA	p.R785Q		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	785	Spectrin 8.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTTCTTCTTTCGGGTGGCCAG	0.478													42	55	---	---	---	---	capture	Missense_Mutation	SNP	158632602	158632602	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15008	194
LAMB3	3914	broad.mit.edu	37	1	209804029	209804029	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209804029G>A	uc001hhg.2	-	8	1264	c.874C>T	c.(874-876)CGC>TGC	p.R292C	LAMB3_uc009xco.2_Missense_Mutation_p.R292C|LAMB3_uc001hhh.2_Missense_Mutation_p.R292C|LAMB3_uc010psl.1_RNA|LAMB3_uc009xcp.1_Missense_Mutation_p.R228C	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	292	Laminin EGF-like 1.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GGTGCACAGCGCTCACAATTT	0.597													27	41	---	---	---	---	capture	Missense_Mutation	SNP	209804029	209804029	LAMB3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8532	194
SIPA1L2	57568	broad.mit.edu	37	1	232615447	232615447	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:232615447T>C	uc001hvg.2	-	5	2169	c.2011A>G	c.(2011-2013)ACC>GCC	p.T671A		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	671	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TTGTATGTGGTATAGAGAGAG	0.448													46	73	---	---	---	---	capture	Missense_Mutation	SNP	232615447	232615447	SIPA1L2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	14223	194
KIAA1804	84451	broad.mit.edu	37	1	233515030	233515030	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:233515030C>T	uc001hvt.3	+	9	2539	c.2278C>T	c.(2278-2280)CGA>TGA	p.R760*	KIAA1804_uc001hvu.3_Nonsense_Mutation_p.R206*	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4	760					activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				GAAGAAGAAACGAGAGGGAAT	0.602													41	60	---	---	---	---	capture	Nonsense_Mutation	SNP	233515030	233515030	KIAA1804	1	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	8181	194
OR2M4	26245	broad.mit.edu	37	1	248402638	248402638	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248402638G>T	uc010pzh.1	+	1	408	c.408G>T	c.(406-408)ATG>ATT	p.M136I		NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,	136	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCATCCTCATGAATCCGAAAC	0.473													62	90	---	---	---	---	capture	Missense_Mutation	SNP	248402638	248402638	OR2M4	1	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	10916	194
CALML5	51806	broad.mit.edu	37	10	5540984	5540984	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5540984C>T	uc001iic.2	-	1	550	c.418G>A	c.(418-420)GCG>ACG	p.A140T		NM_017422	NP_059118	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	140	EF-hand 4.				epidermis development|signal transduction		calcium ion binding|protein binding				0						AGCATCCTCGCGAACTCCTCG	0.701													5	1	---	---	---	---	capture	Missense_Mutation	SNP	5540984	5540984	CALML5	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2565	194
SLK	9748	broad.mit.edu	37	10	105752828	105752828	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105752828A>G	uc001kxo.1	+	4	485	c.451A>G	c.(451-453)ATC>GTC	p.I151V	SLK_uc001kxp.1_Missense_Mutation_p.I151V	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2	151	Protein kinase.				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TGATAATAAGATCATCCACAG	0.333													54	17	---	---	---	---	capture	Missense_Mutation	SNP	105752828	105752828	SLK	10	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	14640	194
IFITM1	8519	broad.mit.edu	37	11	314342	314342	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:314342G>A	uc001loy.3	+	1	352	c.172G>A	c.(172-174)GCC>ACC	p.A58T		NM_003641	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1	58	Cytoplasmic (Potential).				negative regulation of cell proliferation|regulation of immune response|response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding|receptor signaling protein activity				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		CATAGCATTCGCCTACTCCGT	0.612													99	126	---	---	---	---	capture	Missense_Mutation	SNP	314342	314342	IFITM1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7451	194
SYT9	143425	broad.mit.edu	37	11	7334771	7334771	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7334771C>T	uc001mfe.2	+	3	880	c.643C>T	c.(643-645)CGG>TGG	p.R215W	SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX	215	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TGACGGGAGACGGAGTAACAG	0.398													60	91	---	---	---	---	capture	Missense_Mutation	SNP	7334771	7334771	SYT9	11	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	15369	194
OR5J2	282775	broad.mit.edu	37	11	55944236	55944236	+	Nonsense_Mutation	SNP	T	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55944236T>A	uc010rjb.1	+	1	143	c.143T>A	c.(142-144)TTA>TAA	p.L48*		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	48	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					ATGATCCTCTTAATCCAAATC	0.428													150	225	---	---	---	---	capture	Nonsense_Mutation	SNP	55944236	55944236	OR5J2	11	T	A	A	A	1	0	0	0	0	0	1	0	0	793	61	5	4	11069	194
POLA2	23649	broad.mit.edu	37	11	65048610	65048610	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65048610C>A	uc001odj.2	+	8	1234	c.892C>A	c.(892-894)CCT>ACT	p.P298T	POLA2_uc010rod.1_Missense_Mutation_p.P90T|POLA2_uc001odk.2_5'UTR	NM_002689	NP_002680	Q14181	DPOA2_HUMAN	DNA-directed DNA polymerase alpha 2	298					DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	nucleoplasm	DNA binding				0					Dacarbazine(DB00851)	TTCTCTGTTTCCTGGACAGGT	0.512													55	84	---	---	---	---	capture	Missense_Mutation	SNP	65048610	65048610	POLA2	11	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	12091	194
OR10G7	390265	broad.mit.edu	37	11	123909464	123909464	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123909464G>A	uc001pzq.1	-	1	245	c.245C>T	c.(244-246)ACC>ATC	p.T82I		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGACACCAAGGTCATCAGCAT	0.532													75	222	---	---	---	---	capture	Missense_Mutation	SNP	123909464	123909464	OR10G7	11	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	10806	194
C3AR1	719	broad.mit.edu	37	12	8211864	8211864	+	Silent	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8211864G>A	uc001qtv.1	-	2	1010	c.918C>T	c.(916-918)TAC>TAT	p.Y306Y		NM_004054	NP_004045	Q16581	C3AR_HUMAN	complement component 3a receptor 1	306	Extracellular (Potential).				blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)	1				Kidney(36;0.0893)		GCTCAGACTCGTAGAAGGAAT	0.438													64	73	---	---	---	---	capture	Silent	SNP	8211864	8211864	C3AR1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	2185	194
C12orf51	283450	broad.mit.edu	37	12	112622744	112622744	+	Silent	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112622744G>A	uc009zwc.2	-	54	8778	c.8760C>T	c.(8758-8760)AGC>AGT	p.S2920S		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TGCCTCCGATGCTGAGCACGG	0.627													9	24	---	---	---	---	capture	Silent	SNP	112622744	112622744	C12orf51	12	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	1682	194
DDX54	79039	broad.mit.edu	37	12	113600992	113600992	+	Silent	SNP	G	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113600992G>T	uc001tup.2	-	16	2054	c.2026C>A	c.(2026-2028)CGG>AGG	p.R676R	DDX54_uc001tuq.3_Silent_p.R676R	NM_024072	NP_076977	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	676					estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nucleolus	ATP binding|ATP-dependent RNA helicase activity|estrogen receptor binding|RNA binding|transcription corepressor activity			skin(2)|central_nervous_system(1)	3						TCCTGGTCCCGCTGCCGGGCC	0.667													3	65	---	---	---	---	capture	Silent	SNP	113600992	113600992	DDX54	12	G	T	T	T	1	0	0	0	0	0	0	0	1	493	38	4	4	4330	194
LTBP2	4053	broad.mit.edu	37	14	74991895	74991895	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74991895C>G	uc001xqa.2	-	15	2849	c.2462G>C	c.(2461-2463)GGG>GCG	p.G821A		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	821					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CTCTGCAATCCCCTGTTCAGG	0.612													50	65	---	---	---	---	capture	Missense_Mutation	SNP	74991895	74991895	LTBP2	14	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	8989	194
LTBP2	4053	broad.mit.edu	37	14	74991927	74991927	+	Silent	SNP	C	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74991927C>G	uc001xqa.2	-	15	2817	c.2430G>C	c.(2428-2430)GGG>GGC	p.G810G		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	810					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TTGTGGCATTCCCTGTGGAGG	0.597													28	34	---	---	---	---	capture	Silent	SNP	74991927	74991927	LTBP2	14	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	8989	194
STON2	85439	broad.mit.edu	37	14	81744671	81744671	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:81744671G>C	uc010tvu.1	-	4	1185	c.984C>G	c.(982-984)ATC>ATG	p.I328M	STON2_uc001xvk.1_Missense_Mutation_p.I328M|STON2_uc010tvt.1_Missense_Mutation_p.I125M	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	328					endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		TGAAAGGGTTGATAGGGGAGG	0.512													18	90	---	---	---	---	capture	Missense_Mutation	SNP	81744671	81744671	STON2	14	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	15208	194
C14orf109	26175	broad.mit.edu	37	14	93651787	93651787	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:93651787T>A	uc010auo.2	+	1	413	c.55T>A	c.(55-57)TCT>ACT	p.S19T	MOAP1_uc001ybj.2_5'Flank|C14orf109_uc001ybk.3_Intron	NM_001098621	NP_001092091	Q8N6I4	CN109_HUMAN	hypothetical protein LOC26175 isoform 1	13						integral to membrane					0		all_cancers(154;0.11)|Acute lymphoblastic leukemia(33;0.0488)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		GCTGAGTGACTCTTTAACGCT	0.502													89	143	---	---	---	---	capture	Missense_Mutation	SNP	93651787	93651787	C14orf109	14	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	1725	194
RLTPR	146206	broad.mit.edu	37	16	67683828	67683828	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67683828C>T	uc002etn.2	+	21	2159	c.2039C>T	c.(2038-2040)GCG>GTG	p.A680V	RLTPR_uc010cel.1_Missense_Mutation_p.A673V|RLTPR_uc010vjr.1_Missense_Mutation_p.A644V	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	680	LRR 16.									breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GTGGCCCAGGCGCAGCGCAGC	0.647													12	17	---	---	---	---	capture	Missense_Mutation	SNP	67683828	67683828	RLTPR	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13286	194
TP53	7157	broad.mit.edu	37	17	7578203	7578203	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578203C>T	uc002gim.2	-	6	840	c.646G>A	c.(646-648)GTG>ATG	p.V216M	TP53_uc002gig.1_Missense_Mutation_p.V216M|TP53_uc002gih.2_Missense_Mutation_p.V216M|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V84M|TP53_uc010cng.1_Missense_Mutation_p.V84M|TP53_uc002gii.1_Missense_Mutation_p.V84M|TP53_uc010cnh.1_Missense_Mutation_p.V216M|TP53_uc010cni.1_Missense_Mutation_p.V216M|TP53_uc002gij.2_Missense_Mutation_p.V216M|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.V123M|TP53_uc002gio.2_Missense_Mutation_p.V84M|TP53_uc010vug.1_Missense_Mutation_p.V177M	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	216	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|V -> M (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V216M(49)|p.V216del(8)|p.0?(7)|p.V216L(7)|p.V216E(4)|p.V216G(3)|p.V216A(3)|p.V216fs*6(2)|p.V216fs*31(2)|p.H214fs*5(2)|p.K164_P219del(1)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.V216fs*28(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACCACCACACTATGTCGA	0.537		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			26	11	---	---	---	---	capture	Missense_Mutation	SNP	7578203	7578203	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16264	194
PLXDC1	57125	broad.mit.edu	37	17	37265501	37265501	+	Silent	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37265501C>T	uc002hrg.2	-	3	611	c.399G>A	c.(397-399)TCG>TCA	p.S133S	PLXDC1_uc002hrh.2_RNA|PLXDC1_uc002hri.2_RNA|PLXDC1_uc002hrj.1_RNA|PLXDC1_uc002hrk.1_RNA	NM_020405	NP_065138	Q8IUK5	PXDC1_HUMAN	plexin domain containing 1 precursor	133	Extracellular (Potential).				angiogenesis	cytoplasm|extracellular region|integral to membrane|tight junction				ovary(1)|kidney(1)|skin(1)	3						GGGCACTCACCGAAGCCTGCC	0.657													8	9	---	---	---	---	capture	Silent	SNP	37265501	37265501	PLXDC1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12020	194
KRTAP4-8	728224	broad.mit.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	T	T	rs76270529	by1000genomes	TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39254054A>T	uc010wfo.1	-	1	322	c.283T>A	c.(283-285)TGC>AGC	p.C95S		NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4.8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].|15.					keratin filament					0						ctggagatgcagcagcTAGGG	0.318													6	38	---	---	---	---	capture	Missense_Mutation	SNP	39254054	39254054	KRTAP4-8	17	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	8476	194
SCN4A	6329	broad.mit.edu	37	17	62036660	62036660	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62036660C>T	uc002jds.1	-	12	2061	c.1984G>A	c.(1984-1986)GTA>ATA	p.V662I		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	662	II.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	AGTCCCTGTACGTTGGCCAGG	0.592													44	63	---	---	---	---	capture	Missense_Mutation	SNP	62036660	62036660	SCN4A	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13813	194
PALM	5064	broad.mit.edu	37	19	746653	746653	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:746653G>A	uc002lpm.1	+	9	1197	c.1003G>A	c.(1003-1005)GCT>ACT	p.A335T	PALM_uc002lpn.1_Missense_Mutation_p.A291T|PALM_uc010xfu.1_Missense_Mutation_p.A200T	NM_002579	NP_002570	O75781	PALM_HUMAN	paralemmin isoform 1	335					cellular component movement|negative regulation of adenylate cyclase activity|negative regulation of dopamine receptor signaling pathway|positive regulation of filopodium assembly|regulation of cell shape	cytoplasmic membrane-bounded vesicle|filopodium membrane|integral to plasma membrane					0		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)		CGAAGACGCGGCTGAGCCCAA	0.647													11	7	---	---	---	---	capture	Missense_Mutation	SNP	746653	746653	PALM	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11312	194
SAFB2	9667	broad.mit.edu	37	19	5587954	5587954	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5587954C>T	uc002mcd.2	-	19	2775	c.2563G>A	c.(2563-2565)GAG>AAG	p.E855K		NM_014649	NP_055464	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	855	Interacts with SAFB1.|Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding				0				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		TGGTGCTCCTCTAGCCGCTGG	0.652													3	14	---	---	---	---	capture	Missense_Mutation	SNP	5587954	5587954	SAFB2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	13699	194
IFT172	26160	broad.mit.edu	37	2	27670769	27670769	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27670769C>A	uc002rku.2	-	41	4500	c.4449G>T	c.(4447-4449)AGG>AGT	p.R1483S	IFT172_uc010ezb.2_RNA	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	1483					cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					CAGTGAAGATCCTTTTGTAGA	0.502													57	95	---	---	---	---	capture	Missense_Mutation	SNP	27670769	27670769	IFT172	2	C	A	A	A	1	0	0	0	0	1	0	0	0	389	30	4	4	7482	194
CAPN13	92291	broad.mit.edu	37	2	30959413	30959413	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:30959413G>T	uc002rnn.2	-	17	1854	c.1678C>A	c.(1678-1680)CAA>AAA	p.Q560K	CAPN13_uc002rnm.2_RNA	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13	560	EF-hand 1.				proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					AACTCCTCTTGGTCTAGCCGC	0.493													29	39	---	---	---	---	capture	Missense_Mutation	SNP	30959413	30959413	CAPN13	2	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	2602	194
FAM82A1	151393	broad.mit.edu	37	2	38202445	38202445	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:38202445T>C	uc002rql.2	+	4	841	c.718T>C	c.(718-720)TAT>CAT	p.Y240H	FAM82A1_uc002rqn.1_Missense_Mutation_p.Y418H|FAM82A1_uc002rqk.1_Missense_Mutation_p.Y95H|FAM82A1_uc002rqm.2_Missense_Mutation_p.Y95H	NM_144713	NP_653314	Q96LZ7	RMD2_HUMAN	family with sequence similarity 82, member A1	240						cytoplasm|integral to membrane|microtubule|spindle pole	binding			ovary(1)	1						AAAGAAACATTATGCTAATAT	0.254													45	56	---	---	---	---	capture	Missense_Mutation	SNP	38202445	38202445	FAM82A1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	5576	194
SULT1C4	27233	broad.mit.edu	37	2	108999906	108999906	+	Silent	SNP	A	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108999906A>T	uc002tea.1	+	5	928	c.555A>T	c.(553-555)GGA>GGT	p.G185G	SULT1C4_uc010ywr.1_RNA|SULT1C4_uc002teb.1_Silent_p.G110G	NM_006588	NP_006579	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member	185					3'-phosphoadenosine 5'-phosphosulfate metabolic process|sulfation|xenobiotic metabolic process	cytosol	sulfotransferase activity				0						ATGTGAAAGGATGGTGGGAAG	0.478													34	50	---	---	---	---	capture	Silent	SNP	108999906	108999906	SULT1C4	2	A	T	T	T	1	0	0	0	0	0	0	0	1	145	12	4	4	15267	194
RPRM	56475	broad.mit.edu	37	2	154334770	154334770	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:154334770C>T	uc002tyq.1	-	1	553	c.310G>A	c.(310-312)GTG>ATG	p.V104M		NM_019845	NP_062819	Q9NS64	RPRM_HUMAN	reprimo, TP53 dependant G2 arrest mediator	104					cell cycle arrest	cytoplasm|integral to membrane	protein binding				0						CCCACGACCACCGCCTCCACC	0.637													8	21	---	---	---	---	capture	Missense_Mutation	SNP	154334770	154334770	RPRM	2	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	13510	194
STAT4	6775	broad.mit.edu	37	2	192011451	192011451	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192011451G>A	uc002usm.1	-	3	415	c.161C>T	c.(160-162)ACG>ATG	p.T54M	STAT4_uc010zgm.1_RNA|STAT4_uc010zgn.1_RNA|STAT4_uc010zgo.1_RNA|STAT4_uc002usn.1_Missense_Mutation_p.T54M|STAT4_uc002uso.2_Missense_Mutation_p.T54M|STAT4_uc002usp.3_Missense_Mutation_p.T54M|STAT4_uc010zgl.1_Missense_Mutation_p.T54M	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription	54					JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			AAGAAGAATCGTTGCCATGGT	0.323													30	45	---	---	---	---	capture	Missense_Mutation	SNP	192011451	192011451	STAT4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15157	194
CD28	940	broad.mit.edu	37	2	204599561	204599561	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:204599561C>T	uc002vah.3	+	4	811	c.589C>T	c.(589-591)CGC>TGC	p.R197C	CD28_uc010zio.1_RNA|CD28_uc010ftx.2_Missense_Mutation_p.R78C|CD28_uc002vaj.3_RNA	NM_006139	NP_006130	P10747	CD28_HUMAN	CD28 antigen precursor	197	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cytokine biosynthetic process|humoral immune response|positive regulation of anti-apoptosis|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation of translation|positive regulation of viral genome replication|regulation of defense response to virus by virus|regulatory T cell differentiation|T cell costimulation|viral reproduction	cytosol|external side of plasma membrane|integral to plasma membrane	coreceptor activity|protease binding|SH3/SH2 adaptor activity				0						CATGACTCCCCGCCGCCCCGG	0.597													63	67	---	---	---	---	capture	Missense_Mutation	SNP	204599561	204599561	CD28	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2964	194
ANGPT4	51378	broad.mit.edu	37	20	860425	860425	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:860425C>T	uc002wei.2	-	6	1121	c.1018G>A	c.(1018-1020)GTG>ATG	p.V340M	ANGPT4_uc010zpn.1_Missense_Mutation_p.V334M	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	340	Fibrinogen C-terminal.				anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						TGAAAATTCACGGTGCCATTC	0.617													27	91	---	---	---	---	capture	Missense_Mutation	SNP	860425	860425	ANGPT4	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	609	194
PTPRT	11122	broad.mit.edu	37	20	41306569	41306569	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:41306569G>A	uc002xkg.2	-	7	1274	c.1090C>T	c.(1090-1092)CGA>TGA	p.R364*	PTPRT_uc010ggj.2_Nonsense_Mutation_p.R364*	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	364	Extracellular (Potential).|Fibronectin type-III 1.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCACCTGGTCGTGTGAGGAGC	0.562													78	164	---	---	---	---	capture	Nonsense_Mutation	SNP	41306569	41306569	PTPRT	20	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	12707	194
MATN4	8785	broad.mit.edu	37	20	43927042	43927042	+	Silent	SNP	A	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43927042A>T	uc002xnn.2	-	7	1381	c.1194T>A	c.(1192-1194)CCT>CCA	p.P398P	MATN4_uc002xno.2_Silent_p.P357P|MATN4_uc002xnp.2_Silent_p.P316P|MATN4_uc010zwr.1_Silent_p.P346P|MATN4_uc002xnr.1_Silent_p.P398P	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	439	VWFA 2.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				AGCGACCCAGAGGGAACTCGG	0.662													19	34	---	---	---	---	capture	Silent	SNP	43927042	43927042	MATN4	20	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	9249	194
MATN4	8785	broad.mit.edu	37	20	43933002	43933002	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43933002G>A	uc002xnn.2	-	3	696	c.509C>T	c.(508-510)GCG>GTG	p.A170V	MATN4_uc002xno.2_Missense_Mutation_p.A170V|MATN4_uc002xnp.2_Missense_Mutation_p.A170V|MATN4_uc010zwr.1_Missense_Mutation_p.A118V|MATN4_uc002xnr.1_Missense_Mutation_p.A170V|RBPJL_uc002xns.2_5'Flank|RBPJL_uc002xnt.2_5'Flank	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	170	VWFA 1.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				CACCCCCACCGCGTAAATTTC	0.706													13	27	---	---	---	---	capture	Missense_Mutation	SNP	43933002	43933002	MATN4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9249	194
MMP9	4318	broad.mit.edu	37	20	44641083	44641083	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44641083G>A	uc002xqz.2	+	8	1211	c.1192G>A	c.(1192-1194)GTG>ATG	p.V398M		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	398					collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	TTTGTTCCTCGTGGCGGCGCA	0.662													32	86	---	---	---	---	capture	Missense_Mutation	SNP	44641083	44641083	MMP9	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9581	194
MIOX	55586	broad.mit.edu	37	22	50928230	50928230	+	Missense_Mutation	SNP	G	A	A	rs140377157	byFrequency	TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50928230G>A	uc003bll.1	+	10	917	c.803G>A	c.(802-804)CGG>CAG	p.R268Q	MIOX_uc003blm.1_Silent_p.A263A|MIOX_uc003bln.1_Silent_p.A224A	NM_017584	NP_060054	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	268					inositol catabolic process	cytoplasm|inclusion body	aldo-keto reductase (NADP) activity|ferric iron binding|inositol oxygenase activity				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GACAAGCTGCGGCCCTACTAC	0.662													30	20	---	---	---	---	capture	Missense_Mutation	SNP	50928230	50928230	MIOX	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9502	194
SCN5A	6331	broad.mit.edu	37	3	38592026	38592026	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38592026C>A	uc003cio.2	-	28	6031	c.5837G>T	c.(5836-5838)GGC>GTC	p.G1946V	SCN5A_uc003cin.2_Missense_Mutation_p.G1945V|SCN5A_uc003cil.3_Missense_Mutation_p.G1946V|SCN5A_uc010hhi.2_Missense_Mutation_p.G1928V|SCN5A_uc010hhk.2_Missense_Mutation_p.G1913V|SCN5A_uc011ayr.1_Missense_Mutation_p.G1892V	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1946					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GGCGATGAGGCCCTCTCGCTC	0.622													4	35	---	---	---	---	capture	Missense_Mutation	SNP	38592026	38592026	SCN5A	3	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	13815	194
SNRK	54861	broad.mit.edu	37	3	43381834	43381834	+	Missense_Mutation	SNP	A	C	C			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:43381834A>C	uc003cms.3	+	5	1119	c.787A>C	c.(787-789)ATT>CTT	p.I263L	SNRK_uc003cmt.3_Missense_Mutation_p.I263L|SNRK_uc010hik.2_Missense_Mutation_p.I263L|SNRK_uc011azr.1_Missense_Mutation_p.I57L	NM_017719	NP_060189	Q9NRH2	SNRK_HUMAN	SNF related kinase	263	Protein kinase.				myeloid cell differentiation	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(3)|stomach(1)|breast(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		TTTAGAAGAGATTGAAAATCA	0.443													130	199	---	---	---	---	capture	Missense_Mutation	SNP	43381834	43381834	SNRK	3	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	14743	194
LETM1	3954	broad.mit.edu	37	4	1818642	1818642	+	Splice_Site	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1818642C>T	uc003gdv.2	-	12	2041	c.1744_splice	c.e12-1	p.D582_splice		NM_012318	NP_036450	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane						cristae formation	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			central_nervous_system(1)	1			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			CCTGCAAGTCCTAATAAAATT	0.264													306	112	---	---	---	---	capture	Splice_Site	SNP	1818642	1818642	LETM1	4	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	8654	194
WHSC1	7468	broad.mit.edu	37	4	1978378	1978378	+	Silent	SNP	C	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1978378C>A	uc003gdz.3	+	21	3974	c.3798C>A	c.(3796-3798)TCC>TCA	p.S1266S	WHSC1_uc003geb.3_Silent_p.S1266S|WHSC1_uc003gec.3_Silent_p.S1266S|WHSC1_uc003ged.3_Silent_p.S1266S|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_Silent_p.S485S|WHSC1_uc011bvh.1_Silent_p.S327S|WHSC1_uc010icf.2_Silent_p.S614S	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	1266	PHD-type 4; atypical.				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		ACCACCTGTCCTGCCTGGGCC	0.657			T	IGH@	MM								100	13	---	---	---	---	capture	Silent	SNP	1978378	1978378	WHSC1	4	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	17243	194
USP46	64854	broad.mit.edu	37	4	53468067	53468067	+	Silent	SNP	C	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:53468067C>G	uc003gzn.2	-	7	1061	c.876G>C	c.(874-876)CTG>CTC	p.L292L	USP46_uc003gzm.3_Silent_p.L285L|USP46_uc011bzr.1_Silent_p.L269L|USP46_uc011bzs.1_Silent_p.L176L	NM_022832	NP_073743	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46 isoform 1	292					behavior|protein deubiquitination|regulation of synaptic transmission, GABAergic|ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(32;0.0295)			ACATGCGGTCCAGGTTCACTG	0.537													29	43	---	---	---	---	capture	Silent	SNP	53468067	53468067	USP46	4	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	16959	194
C4orf40	401137	broad.mit.edu	37	4	71024299	71024299	+	Silent	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71024299G>A	uc003hfa.3	+	4	403	c.330G>A	c.(328-330)CCG>CCA	p.P110P	C4orf40_uc003hfb.3_Silent_p.P110P	NM_214711	NP_999876	Q6MZM9	CD040_HUMAN	hypothetical protein LOC401137 precursor	110						extracellular region					0						GGGGTTTCCCGTTTGTCCCTC	0.532													168	229	---	---	---	---	capture	Silent	SNP	71024299	71024299	C4orf40	4	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	2247	194
GPR98	84059	broad.mit.edu	37	5	89981612	89981612	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89981612G>A	uc003kju.2	+	29	6386	c.6290G>A	c.(6289-6291)CGT>CAT	p.R2097H	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2097	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AATTCTCCACGTCTTGGGCCT	0.423													33	51	---	---	---	---	capture	Missense_Mutation	SNP	89981612	89981612	GPR98	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6654	194
ADAMTS19	171019	broad.mit.edu	37	5	128957961	128957961	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:128957961C>G	uc003kvb.1	+	10	1672	c.1672C>G	c.(1672-1674)CTG>GTG	p.L558V	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	558	Disintegrin.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TCCCTCCAAGCTGCCAGGGAT	0.468													41	54	---	---	---	---	capture	Missense_Mutation	SNP	128957961	128957961	ADAMTS19	5	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	264	194
GABRA6	2559	broad.mit.edu	37	5	161116169	161116169	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161116169C>A	uc003lyu.2	+	4	778	c.440C>A	c.(439-441)ACC>AAC	p.T147N	GABRA6_uc003lyv.2_5'Flank	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	147	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATTTTATACACCATGAGGTGA	0.373										TCGA Ovarian(5;0.080)			34	64	---	---	---	---	capture	Missense_Mutation	SNP	161116169	161116169	GABRA6	5	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	6107	194
DDX41	51428	broad.mit.edu	37	5	176943782	176943782	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176943782C>G	uc003mho.2	-	2	103	c.82G>C	c.(82-84)GAG>CAG	p.E28Q	DDX41_uc003mhm.2_5'Flank|DDX41_uc003mhn.2_5'UTR|DDX41_uc003mhp.2_5'UTR|DDX41_uc003mhq.1_5'UTR	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	DEAD-box protein abstrakt	28				PAGGSRSEAEDEDDEDYVPYVPLRQRR -> LPEEAAPRRK MRTTRTTCPMCRYAAP (in Ref. 1; AAF04150).	apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TCGTCGTCCTCATCTTCCGCC	0.706													2	16	---	---	---	---	capture	Missense_Mutation	SNP	176943782	176943782	DDX41	5	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	4319	194
GPR116	221395	broad.mit.edu	37	6	46826114	46826114	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46826114C>T	uc003oyo.3	-	17	3815	c.3526G>A	c.(3526-3528)GCC>ACC	p.A1176T	GPR116_uc011dwj.1_Missense_Mutation_p.A731T|GPR116_uc011dwk.1_Missense_Mutation_p.A605T|GPR116_uc003oyp.3_Missense_Mutation_p.A1034T|GPR116_uc003oyq.3_Missense_Mutation_p.A1176T|GPR116_uc010jzi.1_Missense_Mutation_p.A848T	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	1176	Helical; Name=5; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			GCTGGGATGGCGAAAGCCAGC	0.547													36	53	---	---	---	---	capture	Missense_Mutation	SNP	46826114	46826114	GPR116	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6567	194
NT5E	4907	broad.mit.edu	37	6	86197137	86197137	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:86197137A>G	uc003pko.3	+	5	1590	c.1034A>G	c.(1033-1035)TAT>TGT	p.Y345C	NT5E_uc010kbr.2_Missense_Mutation_p.Y345C	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor	345					DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	ACAATTGTCTATCTGGATGGC	0.393													5	255	---	---	---	---	capture	Missense_Mutation	SNP	86197137	86197137	NT5E	6	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	10600	194
MAP3K7	6885	broad.mit.edu	37	6	91281453	91281453	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:91281453A>G	uc003pnz.1	-	2	356	c.194T>C	c.(193-195)ATA>ACA	p.I65T	MAP3K7_uc003poa.1_Missense_Mutation_p.I65T|MAP3K7_uc003pob.1_Missense_Mutation_p.I65T|MAP3K7_uc003poc.1_Missense_Mutation_p.I65T	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	65	Protein kinase.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TTCACTTTCTATTTGTTTAAT	0.318													35	48	---	---	---	---	capture	Missense_Mutation	SNP	91281453	91281453	MAP3K7	6	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	9169	194
SLC16A10	117247	broad.mit.edu	37	6	111498841	111498841	+	Silent	SNP	T	C	C			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:111498841T>C	uc003pus.2	+	3	1090	c.915T>C	c.(913-915)TTT>TTC	p.F305F	SLC16A10_uc003pur.3_Silent_p.F305F|SLC16A10_uc003put.2_5'UTR	NM_018593	NP_061063	Q8TF71	MOT10_HUMAN	solute carrier family 16, member 10	305	Helical; (Potential).				aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)		TTGCACTTTTTGGATACTTTG	0.363													115	131	---	---	---	---	capture	Silent	SNP	111498841	111498841	SLC16A10	6	T	C	C	C	1	0	0	0	0	0	0	0	1	816	63	3	3	14296	194
RSPH4A	345895	broad.mit.edu	37	6	116938051	116938051	+	Nonsense_Mutation	SNP	G	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116938051G>T	uc003pxe.2	+	1	410	c.265G>T	c.(265-267)GAG>TAG	p.E89*	RSPH4A_uc010kee.2_Nonsense_Mutation_p.E89*	NM_001010892	NP_001010892	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A isoform 1	89					cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton|radial spoke					0						CTCTCCGCGGGAGCCCTCTTC	0.647									Kartagener_syndrome				23	50	---	---	---	---	capture	Nonsense_Mutation	SNP	116938051	116938051	RSPH4A	6	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	13598	194
RFX6	222546	broad.mit.edu	37	6	117244279	117244279	+	Missense_Mutation	SNP	C	A	A	rs144863251		TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117244279C>A	uc003pxm.2	+	14	1510	c.1447C>A	c.(1447-1449)CAA>AAA	p.Q483K		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	483					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding	p.Q483K(1)		ovary(1)|pancreas(1)|skin(1)	3						GACCAGCAAACAAAATGGAAG	0.363													56	110	---	---	---	---	capture	Missense_Mutation	SNP	117244279	117244279	RFX6	6	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	13162	194
DLL1	28514	broad.mit.edu	37	6	170599203	170599203	+	Silent	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:170599203G>A	uc003qxm.2	-	1	495	c.25C>T	c.(25-27)CTG>TTG	p.L9L	DLL1_uc011ehc.1_Silent_p.L9L|DLL1_uc003qxn.3_Silent_p.L9L	NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor	9					cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		AGCACCGCCAGGGCCAGCGCG	0.647													18	26	---	---	---	---	capture	Silent	SNP	170599203	170599203	DLL1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	4524	194
HOXA6	3203	broad.mit.edu	37	7	27186942	27186942	+	Missense_Mutation	SNP	T	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:27186942T>G	uc003syo.1	-	1	427	c.427A>C	c.(427-429)ATG>CTG	p.M143L	uc003syp.1_Missense_Mutation_p.S9A	NM_024014	NP_076919	P31267	HXA6_HUMAN	homeobox A6	143						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						CAGGAGTTCATCCGCTGCATC	0.493													50	140	---	---	---	---	capture	Missense_Mutation	SNP	27186942	27186942	HOXA6	7	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	7221	194
TXNDC3	51314	broad.mit.edu	37	7	37903981	37903981	+	Silent	SNP	G	C	C			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37903981G>C	uc003tfn.2	+	9	858	c.486G>C	c.(484-486)CCG>CCC	p.P162P		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	162	NDK 1.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						TTATCAAACCGGATGCTGTGA	0.284									Kartagener_syndrome				9	42	---	---	---	---	capture	Silent	SNP	37903981	37903981	TXNDC3	7	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	16680	194
ABCB1	5243	broad.mit.edu	37	7	87179256	87179256	+	Missense_Mutation	SNP	G	A	A	rs142600685	byFrequency	TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87179256G>A	uc003uiz.1	-	14	1883	c.1465C>T	c.(1465-1467)CGC>TGC	p.R489C	ABCB1_uc011khc.1_Missense_Mutation_p.R425C	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	489	ABC transporter 1.|Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	CGGCCATAGCGAATGTTTTCA	0.428													79	256	---	---	---	---	capture	Missense_Mutation	SNP	87179256	87179256	ABCB1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	40	194
MCM7	4176	broad.mit.edu	37	7	99693696	99693696	+	Silent	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99693696C>T	uc003usw.1	-	11	1806	c.1296G>A	c.(1294-1296)GGG>GGA	p.G432G	MCM7_uc003usv.1_Silent_p.G256G|MCM7_uc003usx.1_Silent_p.G256G|uc003usy.1_5'Flank|MIR25_hsa-mir-25|MI0000082_5'Flank|uc003usz.1_5'Flank|MIR93_hsa-mir-93|MI0000095_5'Flank|uc003uta.1_5'Flank|MIR106B_hsa-mir-106b|MI0000734_5'Flank	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	432	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	GCACCAGGGCCCCACCCTCTA	0.612													25	77	---	---	---	---	capture	Silent	SNP	99693696	99693696	MCM7	7	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	9305	194
MUC17	140453	broad.mit.edu	37	7	100681846	100681846	+	Silent	SNP	C	T	T	rs138267850		TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100681846C>T	uc003uxp.1	+	3	7202	c.7149C>T	c.(7147-7149)GAC>GAT	p.D2383D	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2383	Extracellular (Potential).|59 X approximate tandem repeats.|38.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACTGCTGACGATACTAGCA	0.498													142	384	---	---	---	---	capture	Silent	SNP	100681846	100681846	MUC17	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9884	194
PIK3CG	5294	broad.mit.edu	37	7	106508257	106508257	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106508257C>T	uc003vdv.3	+	2	336	c.251C>T	c.(250-252)GCG>GTG	p.A84V	PIK3CG_uc003vdu.2_Missense_Mutation_p.A84V|PIK3CG_uc003vdw.2_Missense_Mutation_p.A84V	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	84					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						ACCAGCGTGGCGGCGGACTTC	0.637													23	32	---	---	---	---	capture	Missense_Mutation	SNP	106508257	106508257	PIK3CG	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11819	194
EBF2	64641	broad.mit.edu	37	8	25766052	25766052	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25766052G>T	uc003xes.1	-	7	588	c.571C>A	c.(571-573)CTC>ATC	p.L191I	PPP2R2A_uc003xek.2_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	191					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TTGCACTTGAGGAAAAATTTT	0.363													31	47	---	---	---	---	capture	Missense_Mutation	SNP	25766052	25766052	EBF2	8	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	4836	194
ACTL7B	10880	broad.mit.edu	37	9	111618206	111618206	+	Missense_Mutation	SNP	G	A	A	rs139165156		TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:111618206G>A	uc004bdi.2	-	1	70	c.5C>T	c.(4-6)GCG>GTG	p.A2V		NM_006686	NP_006677	Q9Y614	ACL7B_HUMAN	actin-like 7B	2						actin cytoskeleton|cytoplasm	structural constituent of cytoskeleton			pancreas(1)	1						GTTCCTTGTCGCCATCTGCCT	0.667													44	45	---	---	---	---	capture	Missense_Mutation	SNP	111618206	111618206	ACTL7B	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	201	194
COL5A1	1289	broad.mit.edu	37	9	137620520	137620520	+	Missense_Mutation	SNP	C	T	T	rs148548209		TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137620520C>T	uc004cfe.2	+	6	1173	c.791C>T	c.(790-792)ACG>ATG	p.T264M		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	264	Nonhelical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TTTCAGTACACGGAAGGAGAC	0.612													74	140	---	---	---	---	capture	Missense_Mutation	SNP	137620520	137620520	COL5A1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3661	194
EIF1AX	1964	broad.mit.edu	37	X	20148634	20148634	+	Silent	SNP	G	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:20148634G>A	uc004czt.2	-	6	637	c.429C>T	c.(427-429)GAC>GAT	p.D143D		NM_001412	NP_001403	P47813	IF1AX_HUMAN	X-linked eukaryotic translation initiation	143						cytosol	translation initiation factor activity			ovary(1)	1						ATCTACTTACGTCATCAATAT	0.338													44	77	---	---	---	---	capture	Silent	SNP	20148634	20148634	EIF1AX	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4947	194
ZNF674	641339	broad.mit.edu	37	X	46359485	46359485	+	Silent	SNP	G	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:46359485G>T	uc004dgr.2	-	6	1766	c.1539C>A	c.(1537-1539)ATC>ATA	p.I513I	ZNF674_uc011mlg.1_Silent_p.I507I	NM_001039891	NP_001034980	Q2M3X9	ZN674_HUMAN	zinc finger family member 674 isoform 1	513	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)	2						TCTGATGTTTGATGAGAGTTG	0.398													25	42	---	---	---	---	capture	Silent	SNP	46359485	46359485	ZNF674	23	G	T	T	T	1	0	0	0	0	0	0	0	1	577	45	4	4	17959	194
ACRC	93953	broad.mit.edu	37	X	70830591	70830591	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70830591A>G	uc004eae.2	+	11	2173	c.1672A>G	c.(1672-1674)AGC>GGC	p.S558G	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	558						nucleus				ovary(3)	3	Renal(35;0.156)					TGGCTTATGCAGCACTGGTGA	0.493													21	40	---	---	---	---	capture	Missense_Mutation	SNP	70830591	70830591	ACRC	23	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	171	194
RPS4X	6191	broad.mit.edu	37	X	71492579	71492579	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:71492579C>T	uc004ear.2	-	7	830	c.734G>A	c.(733-735)CGC>CAC	p.R245H		NM_001007	NP_000998	P62701	RS4X_HUMAN	ribosomal protein S4, X-linked X isoform	245					endocrine pancreas development|positive regulation of cell proliferation|positive regulation of translation|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome				0	Renal(35;0.156)					AATGGTGAGGCGGATACCCTT	0.488													23	49	---	---	---	---	capture	Missense_Mutation	SNP	71492579	71492579	RPS4X	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13537	194
COL4A6	1288	broad.mit.edu	37	X	107407829	107407829	+	Splice_Site	SNP	C	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107407829C>A	uc004enw.3	-	40	4175	c.4072_splice	c.e40+1	p.G1358_splice	COL4A6_uc004env.3_Splice_Site_p.G1357_splice|COL4A6_uc011msn.1_Splice_Site_p.G1333_splice|COL4A6_uc010npk.2_Intron|COL4A6_uc010npj.2_5'Flank	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						TCTCAACTTACCTCTTGGCCC	0.592									Alport_syndrome_with_Diffuse_Leiomyomatosis				88	169	---	---	---	---	capture	Splice_Site	SNP	107407829	107407829	COL4A6	23	C	A	A	A	1	0	0	0	0	0	0	1	0	234	18	5	4	3660	194
MAGEC2	51438	broad.mit.edu	37	X	141291591	141291591	+	Silent	SNP	C	T	T			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:141291591C>T	uc004fbu.1	-	3	531	c.183G>A	c.(181-183)CTG>CTA	p.L61L		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	61						cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CACCAAGAATCAGAGAAGAGG	0.443										HNSCC(46;0.14)			73	82	---	---	---	---	capture	Silent	SNP	141291591	141291591	MAGEC2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	9095	194
IQSEC3	440073	broad.mit.edu	37	12	248252	248254	+	In_Frame_Del	DEL	GAG	-	-			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:248252_248254delGAG	uc001qhw.1	+	1	820_822	c.814_816delGAG	c.(814-816)GAGdel	p.E276del	IQSEC3_uc001qhu.1_In_Frame_Del_p.E276del|IQSEC3_uc001qht.1_In_Frame_Del_p.E361del|uc001qhv.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	579	Poly-Glu.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		Agaggaggaagaggaggaggagg	0.586													2	4	---	---	---	---	capture_indel	In_Frame_Del	DEL	248252	248254	IQSEC3	12	GAG	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	7742	194
FAM193A	8603	broad.mit.edu	37	4	2692666	2692667	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:2692666_2692667delCA	uc010icl.2	+	13	2250_2251	c.1899_1900delCA	c.(1897-1902)TTCAGAfs	p.F633fs	FAM193A_uc010ick.2_Frame_Shift_Del_p.F833fs|FAM193A_uc003gfd.2_Frame_Shift_Del_p.F633fs|FAM193A_uc011bvm.1_Frame_Shift_Del_p.F655fs|FAM193A_uc011bvn.1_Frame_Shift_Del_p.F633fs|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Frame_Shift_Del_p.F487fs	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	633_634										ovary(3)	3						ACAGCCAGTTCAGAGTGTCATC	0.530													35	72	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	2692666	2692667	FAM193A	4	CA	-	-	-	1	0	1	0	1	0	0	0	0	376	29	5	5	5476	194
PRDM5	11107	broad.mit.edu	37	4	121720881	121720884	+	Frame_Shift_Del	DEL	CAAT	-	-	rs34666716	byFrequency;by1000genomes	TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:121720881_121720884delCAAT	uc003idn.2	-	9	1212_1215	c.962_965delATTG	c.(961-966)GATTGTfs	p.D321fs	PRDM5_uc003ido.2_Frame_Shift_Del_p.D290fs|PRDM5_uc010ine.2_Frame_Shift_Del_p.D290fs	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	321_322	C2H2-type 6.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						ACATTCTTGACAATCAAATATCTC	0.309													21	38	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	121720881	121720884	PRDM5	4	CAAT	-	-	-	1	0	1	0	1	0	0	0	0	221	17	5	5	12356	194
MDN1	23195	broad.mit.edu	37	6	90362720	90362720	+	Frame_Shift_Del	DEL	C	-	-			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90362720delC	uc003pnn.1	-	94	15932	c.15816delG	c.(15814-15816)ACGfs	p.T5272fs		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	5272					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CCTGGAAGATCGTGTCCATGA	0.333													143	241	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	90362720	90362720	MDN1	6	C	-	-	-	1	0	1	0	1	0	0	0	0	392	31	5	5	9328	194
CNKSR3	154043	broad.mit.edu	37	6	154743668	154743668	+	Frame_Shift_Del	DEL	T	-	-			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:154743668delT	uc003qpy.2	-	9	1422	c.917delA	c.(916-918)AACfs	p.N306fs		NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	306					negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		CCACCGTAGGTTTTTCAGGGG	0.448													8	308	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	154743668	154743668	CNKSR3	6	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	3573	194
TMC1	117531	broad.mit.edu	37	9	75441788	75441789	+	Frame_Shift_Ins	INS	-	A	A			TCGA-27-1835-01	TCGA-27-1835-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:75441788_75441789insA	uc004aiz.1	+	21	2547_2548	c.2007_2008insA	c.(2005-2010)GGCAAAfs	p.G669fs	TMC1_uc010moz.1_Frame_Shift_Ins_p.G627fs|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Frame_Shift_Ins_p.G523fs|TMC1_uc010mpa.1_Frame_Shift_Ins_p.G523fs	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	669_670	Extracellular (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						CCCCCAGTGGCAAAAATAGAAT	0.411													83	183	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	75441788	75441789	TMC1	9	-	A	A	A	1	0	1	1	0	0	0	0	0	314	25	5	5	15869	194
