Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CYP4X1	260293	broad.mit.edu	37	1	47501571	47501571	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47501571G>A	uc001cqt.2	+	5	836	c.586G>A	c.(586-588)GCT>ACT	p.A196T	CYP4X1_uc001cqr.2_Missense_Mutation_p.A195T|CYP4X1_uc001cqs.2_Missense_Mutation_p.A131T	NM_178033	NP_828847	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X,	196						endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2						CATGAAATGCGCTTTCAGCAA	0.428													45	85	---	---	---	---	capture	Missense_Mutation	SNP	47501571	47501571	CYP4X1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4153	196
SETDB1	9869	broad.mit.edu	37	1	150936730	150936730	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150936730C>T	uc001evu.2	+	22	3956	c.3766C>T	c.(3766-3768)CGG>TGG	p.R1256W	SETDB1_uc001evv.2_Missense_Mutation_p.R1255W	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	1256	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGAAGAATCCGGGCTGGGAC	0.507													21	46	---	---	---	---	capture	Missense_Mutation	SNP	150936730	150936730	SETDB1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	14031	196
FDPS	2224	broad.mit.edu	37	1	155288033	155288033	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155288033A>G	uc001fkc.2	+	6	854	c.635A>G	c.(634-636)TAT>TGT	p.Y212C	RAG1AP1_uc010pey.1_Intron|FDPS_uc001fkd.2_Missense_Mutation_p.Y146C|FDPS_uc001fke.2_Missense_Mutation_p.Y212C|FDPS_uc001fkf.2_Missense_Mutation_p.Y146C|C1orf104_uc001fkh.1_Intron|RUSC1_uc001fkj.2_5'Flank|RUSC1_uc001fkk.2_5'Flank	NM_002004	NP_001995	P14324	FPPS_HUMAN	farnesyl diphosphate synthase isoform a	212					cholesterol biosynthetic process|interspecies interaction between organisms|isoprenoid biosynthetic process	cytosol|nucleus	dimethylallyltranstransferase activity|geranyltranstransferase activity|metal ion binding				0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	CTGAAGCTCTATTGCCGGGAG	0.552													57	89	---	---	---	---	capture	Missense_Mutation	SNP	155288033	155288033	FDPS	1	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	5749	196
TPR	7175	broad.mit.edu	37	1	186310460	186310460	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186310460A>G	uc001grv.2	-	28	4109	c.3812T>C	c.(3811-3813)GTA>GCA	p.V1271A		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1271	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CTCCATAACTACATTCATTGT	0.343			T	NTRK1	papillary thyroid								62	87	---	---	---	---	capture	Missense_Mutation	SNP	186310460	186310460	TPR	1	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	16299	196
MYO3A	53904	broad.mit.edu	37	10	26482157	26482157	+	Missense_Mutation	SNP	A	G	G	rs34204285	by1000genomes	TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26482157A>G	uc001isn.2	+	32	4822	c.4462A>G	c.(4462-4464)AAA>GAA	p.K1488E	MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1488					protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						AGAGGAGCCAAAAATATTGAG	0.358													3	55	---	---	---	---	capture	Missense_Mutation	SNP	26482157	26482157	MYO3A	10	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	9986	196
PTEN	5728	broad.mit.edu	37	10	89720679	89720679	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720679C>T	uc001kfb.2	+	9	1861	c.830C>T	c.(829-831)ACA>ATA	p.T277I		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	277	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.D268_F279>VGQNVSLLGKYI(2)|p.G165_*404del(1)|p.G165_K342del(1)|p.T277I(1)|p.W274_F341del(1)|p.T277fs*13(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGGGTAAATACATTCTTCATA	0.259		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			19	7	---	---	---	---	capture	Missense_Mutation	SNP	89720679	89720679	PTEN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12633	196
MUC5B	727897	broad.mit.edu	37	11	1155150	1155150	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1155150C>T	uc009ycr.1	+	4	284	c.158C>T	c.(157-159)CCG>CTG	p.P53L		NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	58					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCAGGGGTCCCGCTCCGTGGG	0.667													7	17	---	---	---	---	capture	Missense_Mutation	SNP	1155150	1155150	MUC5B	11	C	T	T	T	1	0	0	0	0	1	0	0	0	287	23	1	1	9889	196
OR4D5	219875	broad.mit.edu	37	11	123811011	123811011	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123811011C>T	uc001pzk.1	+	1	688	c.688C>T	c.(688-690)CGG>TGG	p.R230W		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	230	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		AAGCCACTCACGGGAGGGCCG	0.522													103	196	---	---	---	---	capture	Missense_Mutation	SNP	123811011	123811011	OR4D5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	10961	196
ADAMTS15	170689	broad.mit.edu	37	11	130343595	130343595	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130343595G>A	uc010scd.1	+	8	2732	c.2732G>A	c.(2731-2733)CGG>CAG	p.R911Q		NM_139055	NP_620686	Q8TE58	ATS15_HUMAN	a disintegrin-like and metalloprotease	911	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		AGCTGCGGCCGGGGATTTCAG	0.682													18	19	---	---	---	---	capture	Missense_Mutation	SNP	130343595	130343595	ADAMTS15	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	260	196
CLSTN3	9746	broad.mit.edu	37	12	7302219	7302219	+	Silent	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7302219C>T	uc001qsr.2	+	14	2453	c.2175C>T	c.(2173-2175)CTC>CTT	p.L725L	CLSTN3_uc001qss.2_Silent_p.L737L	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	725	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						AAAGCCTGCTCCTGGACACAA	0.582													13	36	---	---	---	---	capture	Silent	SNP	7302219	7302219	CLSTN3	12	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	3528	196
ACSM4	341392	broad.mit.edu	37	12	7477186	7477186	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7477186C>T	uc001qsx.1	+	11	1528	c.1528C>T	c.(1528-1530)CGC>TGC	p.R510C		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	510					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						AGATCAAATCCGCGGAGAGGT	0.438													29	37	---	---	---	---	capture	Missense_Mutation	SNP	7477186	7477186	ACSM4	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	186	196
TUBA1A	7846	broad.mit.edu	37	12	49578914	49578914	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49578914C>T	uc009zlf.2	-	4	1507	c.1235G>A	c.(1234-1236)GGG>GAG	p.G412E	TUBA1B_uc001rto.2_Intron|TUBA1A_uc001rtp.2_Missense_Mutation_p.G412E|TUBA1A_uc001rtq.2_Missense_Mutation_p.G259E|TUBA1A_uc001rtr.2_Missense_Mutation_p.G259E|TUBA1A_uc009zlg.2_Missense_Mutation_p.G259E	NM_006009	NP_006000	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	412					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|structural molecule activity				0						TTCCTCCATCCCCTCCCCAAC	0.547													90	112	---	---	---	---	capture	Missense_Mutation	SNP	49578914	49578914	TUBA1A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	16625	196
GLTP	51228	broad.mit.edu	37	12	110290512	110290512	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110290512C>T	uc001tpm.2	-	5	592	c.478G>A	c.(478-480)GAC>AAC	p.D160N	GLTP_uc010sxt.1_RNA	NM_016433	NP_057517	Q9NZD2	GLTP_HUMAN	glycolipid transfer protein	160						cytoplasm	glycolipid binding|glycolipid transporter activity				0		Lung NSC(355;2.38e-06)|Breast(359;0.00354)|Myeloproliferative disorder(1001;0.0122)		BRCA - Breast invasive adenocarcinoma(302;0.0025)		TTCAGGAAGTCAGACTTATAG	0.587											OREG0022112	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	149	235	---	---	---	---	capture	Missense_Mutation	SNP	110290512	110290512	GLTP	12	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	6407	196
IQCH	64799	broad.mit.edu	37	15	67664811	67664811	+	Silent	SNP	C	T	T	rs111681102	byFrequency	TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:67664811C>T	uc002aqo.1	+	9	1163	c.1116C>T	c.(1114-1116)GCC>GCT	p.A372A	IQCH_uc010ujv.1_Silent_p.A191A|IQCH_uc002aqn.1_Silent_p.A199A|IQCH_uc002aqq.1_Silent_p.A120A|IQCH_uc002aqp.1_Silent_p.A124A	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1	372	IQ.									skin(3)|ovary(1)	4				Colorectal(3;0.0856)		ATTCGGAGGCCGCCATGAAGA	0.468													39	71	---	---	---	---	capture	Silent	SNP	67664811	67664811	IQCH	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7734	196
ZKSCAN2	342357	broad.mit.edu	37	16	25251329	25251329	+	Silent	SNP	T	C	C			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:25251329T>C	uc002dod.3	-	7	3119	c.2712A>G	c.(2710-2712)GAA>GAG	p.E904E	ZKSCAN2_uc010vcl.1_Silent_p.E700E	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	904	C2H2-type 5.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		TTCTCCGATGTTCTCGAAATC	0.458													50	77	---	---	---	---	capture	Silent	SNP	25251329	25251329	ZKSCAN2	16	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	17567	196
ZNF48	197407	broad.mit.edu	37	16	30409511	30409511	+	Missense_Mutation	SNP	C	T	T	rs141362652		TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30409511C>T	uc002dya.1	+	2	999	c.940C>T	c.(940-942)CGG>TGG	p.R314W	ZNF48_uc002dxz.1_Missense_Mutation_p.R191W	NM_152652	NP_689865	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	314	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGAGTTTGCCCGGGGATCCGA	0.622													30	42	---	---	---	---	capture	Missense_Mutation	SNP	30409511	30409511	ZNF48	16	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	17813	196
WDR81	124997	broad.mit.edu	37	17	1634533	1634533	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1634533C>G	uc002fti.2	+	4	718	c.457C>G	c.(457-459)CTC>GTC	p.L153V	WDR81_uc002fth.2_Missense_Mutation_p.L329V|WDR81_uc010vqp.1_Missense_Mutation_p.L177V|WDR81_uc002ftj.2_Missense_Mutation_p.L1380V|WDR81_uc010vqq.1_Intron	NM_001163811	NP_001157283	Q562E7	WDR81_HUMAN	WD repeat domain 81 isoform 4	153										skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCTCAGCTTCCTCACCTCCCT	0.498													9	15	---	---	---	---	capture	Missense_Mutation	SNP	1634533	1634533	WDR81	17	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	17211	196
NCOR1	9611	broad.mit.edu	37	17	16062148	16062148	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:16062148C>T	uc002gpo.2	-	6	898	c.658G>A	c.(658-660)GAG>AAG	p.E220K	NCOR1_uc002gpn.2_Missense_Mutation_p.E220K|NCOR1_uc002gpp.1_Missense_Mutation_p.E111K|NCOR1_uc002gpr.2_Missense_Mutation_p.E111K|NCOR1_uc002gps.1_Missense_Mutation_p.E220K|NCOR1_uc010coz.1_Missense_Mutation_p.E36K|NCOR1_uc010cpb.1_Missense_Mutation_p.E220K|NCOR1_uc010cpa.1_Missense_Mutation_p.E220K	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	220	Interaction with ZBTB33 and HEXIM1.				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ACGGGCTTCTCAGGCTCAGGA	0.488													45	83	---	---	---	---	capture	Missense_Mutation	SNP	16062148	16062148	NCOR1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	10142	196
SLC4A1	6521	broad.mit.edu	37	17	42335476	42335476	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42335476C>T	uc002igf.3	-	11	1309	c.1160G>A	c.(1159-1161)CGG>CAG	p.R387Q	SLC4A1_uc002igg.3_Missense_Mutation_p.R387Q	NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	387	Cytoplasmic.				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GTAGCGGCGCCGGATATCACG	0.587													47	75	---	---	---	---	capture	Missense_Mutation	SNP	42335476	42335476	SLC4A1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14542	196
ABCA5	23461	broad.mit.edu	37	17	67290837	67290837	+	Missense_Mutation	SNP	T	G	G			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67290837T>G	uc002jif.2	-	10	2672	c.1454A>C	c.(1453-1455)AAG>ACG	p.K485T	ABCA5_uc002jie.2_RNA|ABCA5_uc002jig.2_Missense_Mutation_p.K485T|ABCA5_uc002jih.2_Missense_Mutation_p.K485T|ABCA5_uc010dfe.2_Missense_Mutation_p.K485T	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5	485	ABC transporter 1.				cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					TCTGTATGTCTTCTGAATACC	0.264													58	98	---	---	---	---	capture	Missense_Mutation	SNP	67290837	67290837	ABCA5	17	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	35	196
DPYSL5	56896	broad.mit.edu	37	2	27151139	27151139	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27151139T>C	uc002rhu.3	+	5	775	c.617T>C	c.(616-618)CTG>CCG	p.L206P	DPYSL5_uc002rhv.3_Missense_Mutation_p.L206P	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	206					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGGAGGCACTGGATTTGGGG	0.478													17	49	---	---	---	---	capture	Missense_Mutation	SNP	27151139	27151139	DPYSL5	2	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	4705	196
ALPPL2	251	broad.mit.edu	37	2	233274470	233274470	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233274470C>T	uc002vss.3	+	11	1540	c.1487C>T	c.(1486-1488)GCG>GTG	p.A496V		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	496					phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			skin(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)|Levamisole(DB00848)	TGCGACCTGGCGCCCCGCGCC	0.736													7	9	---	---	---	---	capture	Missense_Mutation	SNP	233274470	233274470	ALPPL2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	549	196
CLDN14	23562	broad.mit.edu	37	21	37833394	37833394	+	Silent	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:37833394G>A	uc002yvk.1	-	2	742	c.600C>T	c.(598-600)GCC>GCT	p.A200A	CLDN14_uc002yvn.1_Silent_p.A200A|CLDN14_uc002yvo.1_Silent_p.A200A|CLDN14_uc002yvl.1_Silent_p.A200A|CLDN14_uc002yvm.1_Silent_p.A200A	NM_012130	NP_036262	O95500	CLD14_HUMAN	claudin 14	200	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0						TGGTCGTGGTGGCCCTGGGCG	0.652													25	32	---	---	---	---	capture	Silent	SNP	37833394	37833394	CLDN14	21	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	3440	196
RFPL1	5988	broad.mit.edu	37	22	29834818	29834818	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29834818C>T	uc003afn.2	+	1	247	c.38C>T	c.(37-39)TCA>TTA	p.S13L	RFPL1S_uc003afm.1_RNA	NM_021026	NP_066306	O75677	RFPL1_HUMAN	ret finger protein-like 1	13							zinc ion binding				0						AACAGGCTTTCACCTCACGGA	0.463													59	119	---	---	---	---	capture	Missense_Mutation	SNP	29834818	29834818	RFPL1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	13148	196
CCDC12	151903	broad.mit.edu	37	3	46965117	46965117	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46965117C>T	uc011baq.1	-	4	334	c.325G>A	c.(325-327)GAG>AAG	p.E109K	CCDC12_uc003cqo.2_Missense_Mutation_p.E109K	NM_144716	NP_653317	Q8WUD4	CCD12_HUMAN	coiled-coil domain containing 12	96											0		Prostate(884;0.0143)|Ovarian(412;0.0448)|Acute lymphoblastic leukemia(5;0.143)		OV - Ovarian serous cystadenocarcinoma(275;2.2e-56)|BRCA - Breast invasive adenocarcinoma(193;0.00136)|KIRC - Kidney renal clear cell carcinoma(197;0.00703)|Kidney(197;0.00809)		ATGACGGGCTCGGGCTTGGCG	0.552											OREG0015545	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	11	---	---	---	---	capture	Missense_Mutation	SNP	46965117	46965117	CCDC12	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2729	196
OR5H1	26341	broad.mit.edu	37	3	97851850	97851850	+	Silent	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97851850G>A	uc011bgt.1	+	1	309	c.309G>A	c.(307-309)TCG>TCA	p.S103S		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						AGTTTTTTTCGTTTGCAATCA	0.388													128	213	---	---	---	---	capture	Silent	SNP	97851850	97851850	OR5H1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11063	196
SLC9A10	285335	broad.mit.edu	37	3	111997653	111997653	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111997653G>A	uc003dyu.2	-	4	463	c.241C>T	c.(241-243)CGT>TGT	p.R81C	SLC9A10_uc011bhu.1_5'UTR|SLC9A10_uc010hqc.2_Missense_Mutation_p.R81C	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	81	Helical; (Potential).				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						GTAAATATACGAAAAAATAAG	0.313													60	120	---	---	---	---	capture	Missense_Mutation	SNP	111997653	111997653	SLC9A10	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14602	196
SOX14	8403	broad.mit.edu	37	3	137484038	137484038	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137484038C>G	uc003erm.1	+	1	460	c.412C>G	c.(412-414)CTG>GTG	p.L138V		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	138					negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0						GCCCTACTCCCTGCTGGACCC	0.721													9	14	---	---	---	---	capture	Missense_Mutation	SNP	137484038	137484038	SOX14	3	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	14837	196
UGT2B28	54490	broad.mit.edu	37	4	70148376	70148376	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70148376C>A	uc003hej.2	+	2	868	c.866C>A	c.(865-867)CCT>CAT	p.P289H	UGT2B28_uc010ihr.2_Missense_Mutation_p.P289H	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	289					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	AAACCCCTACCTAAGGTAAAC	0.383													69	105	---	---	---	---	capture	Missense_Mutation	SNP	70148376	70148376	UGT2B28	4	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	16842	196
ENPEP	2028	broad.mit.edu	37	4	111398043	111398043	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:111398043G>A	uc003iab.3	+	1	815	c.473G>A	c.(472-474)CGG>CAG	p.R158Q		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	158	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	GTGCAAGTCCGGAGGTGTTTC	0.627													82	152	---	---	---	---	capture	Missense_Mutation	SNP	111398043	111398043	ENPEP	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5083	196
PCDHB15	56121	broad.mit.edu	37	5	140626805	140626805	+	Silent	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140626805C>T	uc003lje.2	+	1	1659	c.1659C>T	c.(1657-1659)GAC>GAT	p.D553D		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	553	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTGCTGGACGCCAACGACA	0.711													26	37	---	---	---	---	capture	Silent	SNP	140626805	140626805	PCDHB15	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11443	196
PCDHGB2	56103	broad.mit.edu	37	5	140740727	140740727	+	Missense_Mutation	SNP	A	C	C	rs150123769	by1000genomes	TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140740727A>C	uc003ljs.1	+	1	1025	c.1025A>C	c.(1024-1026)GAT>GCT	p.D342A	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc011dar.1_Missense_Mutation_p.D342A	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	342	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATGACAACGATTGTGCACCT	0.448													41	52	---	---	---	---	capture	Missense_Mutation	SNP	140740727	140740727	PCDHGB2	5	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	11466	196
PCDHGA11	56105	broad.mit.edu	37	5	140802685	140802685	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140802685C>T	uc003lkq.1	+	1	2149	c.1891C>T	c.(1891-1893)CGG>TGG	p.R631W	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.R631W|PCDHGA11_uc003lkp.1_Intron	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	631	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGTACAGCGCGGGCACTGCT	0.687													31	29	---	---	---	---	capture	Missense_Mutation	SNP	140802685	140802685	PCDHGA11	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11455	196
SGK1	6446	broad.mit.edu	37	6	134582969	134582969	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:134582969C>T	uc003qep.2	-	2	985	c.387G>A	c.(385-387)ATG>ATA	p.M129I	SGK1_uc003qeo.3_Intron			O00141	SGK1_HUMAN	SubName: Full=Putative uncharacterized protein DKFZp686H1615;	Error:Variant_position_missing_in_O00141_after_alignment					apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TATAAATATGCATTAAAAAAT	0.269													8	16	---	---	---	---	capture	Missense_Mutation	SNP	134582969	134582969	SGK1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	313	25	2	2	14100	196
ABCA13	154664	broad.mit.edu	37	7	48412010	48412010	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48412010C>A	uc003toq.2	+	33	11074	c.11049C>A	c.(11047-11049)AGC>AGA	p.S3683R	ABCA13_uc010kys.1_Missense_Mutation_p.S757R|ABCA13_uc003tos.1_Missense_Mutation_p.S509R	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3683	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TTTGTACCAGCCTGGTGTACA	0.403													111	133	---	---	---	---	capture	Missense_Mutation	SNP	48412010	48412010	ABCA13	7	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	31	196
SEMA3C	10512	broad.mit.edu	37	7	80456743	80456743	+	Missense_Mutation	SNP	T	G	G	rs13310887		TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80456743T>G	uc003uhj.2	-	4	887	c.325A>C	c.(325-327)ACA>CCA	p.T109P	SEMA3C_uc011kgw.1_Missense_Mutation_p.T127P|SEMA3C_uc011kgx.1_Intron	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	109	Sema.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						ACACTTACTGTGGGATCTTTG	0.338													12	38	---	---	---	---	capture	Missense_Mutation	SNP	80456743	80456743	SEMA3C	7	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	13919	196
GRM3	2913	broad.mit.edu	37	7	86415951	86415951	+	Silent	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86415951G>A	uc003uid.2	+	3	1942	c.843G>A	c.(841-843)TCG>TCA	p.S281S	GRM3_uc010lef.2_Silent_p.S279S|GRM3_uc010leg.2_Silent_p.S153S|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	281	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GCGACGACTCGCGGGAGCTCA	0.662													19	52	---	---	---	---	capture	Silent	SNP	86415951	86415951	GRM3	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6731	196
EMID2	136227	broad.mit.edu	37	7	101063350	101063350	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:101063350G>A	uc010lhy.1	+	2	443	c.251G>A	c.(250-252)CGG>CAG	p.R84Q	EMID2_uc003uyo.1_Missense_Mutation_p.R84Q	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2	84	EMI.					collagen				ovary(1)	1	Lung NSC(181;0.215)					CAGAGCTGCCGGTGGCCGGGG	0.647													10	22	---	---	---	---	capture	Missense_Mutation	SNP	101063350	101063350	EMID2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5047	196
FBXL13	222235	broad.mit.edu	37	7	102604030	102604030	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:102604030C>T	uc003vaq.2	-	8	1101	c.674G>A	c.(673-675)CGT>CAT	p.R225H	FBXL13_uc010liq.1_Missense_Mutation_p.R40H|FBXL13_uc010lir.1_Missense_Mutation_p.R225H|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Missense_Mutation_p.R225H|FBXL13_uc003vav.2_RNA	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	225											0						AAAATTCAAACGCAGCACATT	0.328													43	124	---	---	---	---	capture	Missense_Mutation	SNP	102604030	102604030	FBXL13	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5655	196
RELN	5649	broad.mit.edu	37	7	103368566	103368566	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103368566G>A	uc003vca.2	-	7	905	c.745C>T	c.(745-747)CGA>TGA	p.R249*	RELN_uc010liz.2_Nonsense_Mutation_p.R249*	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	249					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACCAGTTCTCGTGGGCCATAT	0.408													44	114	---	---	---	---	capture	Nonsense_Mutation	SNP	103368566	103368566	RELN	7	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	13115	196
CSMD1	64478	broad.mit.edu	37	8	3216774	3216774	+	Silent	SNP	C	T	T			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:3216774C>T	uc011kwk.1	-	21	3597	c.3207G>A	c.(3205-3207)ACG>ACA	p.T1069T	CSMD1_uc011kwj.1_Silent_p.T461T|CSMD1_uc003wqe.2_Silent_p.T225T	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1069	Sushi 6.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGCAGGAAAACGTCAGAGAGT	0.552													32	47	---	---	---	---	capture	Silent	SNP	3216774	3216774	CSMD1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	3909	196
C9orf80	58493	broad.mit.edu	37	9	115451883	115451883	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115451883C>A	uc004bgg.2	-	4	320	c.143G>T	c.(142-144)AGA>ATA	p.R48I	C9orf80_uc010muk.2_Intron	NM_021218	NP_067041	Q9NRY2	SOSSC_HUMAN	SOSSC protein	48					DNA repair|response to ionizing radiation	SOSS complex	protein binding				0						AAGAGAGGGTCTCGAGAGTGC	0.428													40	63	---	---	---	---	capture	Missense_Mutation	SNP	115451883	115451883	C9orf80	9	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	2474	196
SPIN2B	474343	broad.mit.edu	37	X	57146697	57146697	+	Silent	SNP	G	A	A			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:57146697G>A	uc004duy.2	-	2	625	c.366C>T	c.(364-366)GCC>GCT	p.A122A	SPIN2B_uc004duz.2_Silent_p.A122A|SPIN2B_uc004dva.2_Silent_p.A122A|uc011mor.1_RNA	NM_001006682	NP_001006683	Q9BPZ2	SPI2B_HUMAN	spindlin-like protein 2	122					apoptosis|cell cycle|gamete generation	nucleus					0						TTGCAAGGTTGGCATCACTAA	0.433													96	24	---	---	---	---	capture	Silent	SNP	57146697	57146697	SPIN2B	23	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	14946	196
PRB2	653247	broad.mit.edu	37	12	11546320	11546322	+	In_Frame_Del	DEL	TTG	-	-			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11546320_11546322delTTG	uc010shk.1	-	3	725_727	c.690_692delCAA	c.(688-693)AACAAG>AAG	p.N230del		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACTTTGGGACTTGTTGTCTCCTT	0.601													12	702	---	---	---	---	capture_indel	In_Frame_Del	DEL	11546320	11546322	PRB2	12	TTG	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	12339	196
TRAPPC10	7109	broad.mit.edu	37	21	45472274	45472275	+	Frame_Shift_Ins	INS	-	A	A	rs149217788	byFrequency	TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45472274_45472275insA	uc002zea.2	+	4	568_569	c.399_400insA	c.(397-402)AAGAAAfs	p.K133fs	TRAPPC10_uc010gpo.2_5'UTR|TRAPPC10_uc002zdz.2_Frame_Shift_Ins_p.K133fs	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	133_134					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						ATGATGCCAAGAAAAAAAACAA	0.356													7	198	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	45472274	45472275	TRAPPC10	21	-	A	A	A	1	0	1	1	0	0	0	0	0	425	33	5	5	16340	196
TYRP1	7306	broad.mit.edu	37	9	12702411	12702414	+	Frame_Shift_Del	DEL	ACAA	-	-			TCGA-27-1837-01	TCGA-27-1837-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:12702411_12702414delACAA	uc003zkv.3	+	5	1232_1235	c.1054_1057delACAA	c.(1054-1059)ACAAACfs	p.T352fs		NM_000550	NP_000541	P17643	TYRP1_HUMAN	tyrosinase-related protein 1 precursor	352_353	Lumenal, melanosome (Potential).				melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity			lung(1)	1		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		TTCCAACTCTACAAACAGTTTCCG	0.387									Oculocutaneous_Albinism				34	50	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	12702411	12702414	TYRP1	9	ACAA	-	-	-	1	0	1	0	1	0	0	0	0	182	14	5	5	16698	196
