Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PER3	8863	broad.mit.edu	37	1	7880644	7880644	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7880644G>A	uc001aoo.2	+	15	2052	c.1877G>A	c.(1876-1878)GGC>GAC	p.G626D	PER3_uc009vmg.1_Missense_Mutation_p.G634D|PER3_uc009vmh.1_Missense_Mutation_p.G627D|PER3_uc001aop.2_Missense_Mutation_p.G634D|PER3_uc010nzw.1_Missense_Mutation_p.G315D	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	626	CSNK1E binding domain (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGGGTCGGGCATAAGCCAA	0.512													3	39	---	---	---	---	capture	Missense_Mutation	SNP	7880644	7880644	PER3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11634	198
LOC649330	649330	broad.mit.edu	37	1	12907821	12907821	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12907821A>T	uc009vno.2	-	1	417	c.322T>A	c.(322-324)TCT>ACT	p.S108T	HNRNPCL1_uc010obf.1_Missense_Mutation_p.S108T	NM_001146181	NP_001139653	B7ZW38	B7ZW38_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	108							nucleic acid binding|nucleotide binding				0						AAGTCAAAAGAGGAGCCGTAC	0.493													27	113	---	---	---	---	capture	Missense_Mutation	SNP	12907821	12907821	LOC649330	1	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	8802	198
HPCAL4	51440	broad.mit.edu	37	1	40150150	40150150	+	Silent	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40150150G>A	uc001cdr.2	-	2	246	c.126C>T	c.(124-126)ATC>ATT	p.I42I	HPCAL4_uc010oix.1_Silent_p.I42I	NM_016257	NP_057341	Q9UM19	HPCL4_HUMAN	hippocalcin-like protein 4	42	EF-hand 1.				central nervous system development	intracellular	calcium ion binding			central_nervous_system(1)	1	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CCAGGTTGAGGATGCCGCTGG	0.627													6	30	---	---	---	---	capture	Silent	SNP	40150150	40150150	HPCAL4	1	G	A	A	A	1	0	0	0	0	0	0	0	1	525	41	2	2	7256	198
ELTD1	64123	broad.mit.edu	37	1	79383365	79383365	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:79383365T>C	uc001diq.3	-	12	1859	c.1703A>G	c.(1702-1704)AAC>AGC	p.N568S		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	568	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		AATAAAGTTGTTTTCGGTGCT	0.279													8	59	---	---	---	---	capture	Missense_Mutation	SNP	79383365	79383365	ELTD1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	5039	198
SLC26A9	115019	broad.mit.edu	37	1	205890886	205890886	+	Silent	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205890886G>A	uc001hdq.2	-	17	1977	c.1863C>T	c.(1861-1863)AGC>AGT	p.S621S	SLC26A9_uc001hdo.2_Silent_p.S289S|SLC26A9_uc001hdp.2_Silent_p.S621S	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a	621	STAS.					integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TATAGGACACGCTGGTGCCGT	0.642													9	11	---	---	---	---	capture	Silent	SNP	205890886	205890886	SLC26A9	1	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	14416	198
WDR64	128025	broad.mit.edu	37	1	241959665	241959665	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:241959665G>A	uc001hzf.1	+	16	1967	c.1814G>A	c.(1813-1815)CGT>CAT	p.R605H	WDR64_uc001hzg.1_Missense_Mutation_p.R518H	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64	1052										skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CATGTTCAACGTGAAAAAGTA	0.378													17	62	---	---	---	---	capture	Missense_Mutation	SNP	241959665	241959665	WDR64	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17196	198
OR51B6	390058	broad.mit.edu	37	11	5373571	5373571	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5373571C>A	uc010qzb.1	+	1	834	c.834C>A	c.(832-834)CAC>CAA	p.H278Q	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004750	NP_001004750	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B,	278	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTACATCCACTTCCTTTTCC	0.398													30	248	---	---	---	---	capture	Missense_Mutation	SNP	5373571	5373571	OR51B6	11	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	10996	198
ADM	133	broad.mit.edu	37	11	10327296	10327296	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:10327296C>T	uc001mik.1	+	1	666	c.49C>T	c.(49-51)CTA>TTA	p.L17L	ADM_uc001mil.1_Silent_p.L17L|ADM_uc001mim.1_5'UTR	NM_001124	NP_001115	P35318	ADML_HUMAN	adrenomedullin precursor	17					blood circulation|cAMP biosynthetic process|female pregnancy|negative regulation of vasoconstriction|progesterone biosynthetic process|response to wounding	cytoplasm|extracellular space|soluble fraction	hormone activity			central_nervous_system(1)	1				all cancers(16;3.51e-65)|Epithelial(150;1.52e-62)|BRCA - Breast invasive adenocarcinoma(625;0.0257)		GCTCGCCTTCCTAGGCGCTGA	0.612													19	63	---	---	---	---	capture	Silent	SNP	10327296	10327296	ADM	11	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	321	198
CHST1	8534	broad.mit.edu	37	11	45671304	45671304	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45671304C>T	uc001mys.1	-	4	1841	c.1170G>A	c.(1168-1170)TCG>TCA	p.S390S		NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	390	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GCTCCTCCTCCGAGGCGGCGA	0.692													28	118	---	---	---	---	capture	Silent	SNP	45671304	45671304	CHST1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3362	198
OR4P4	81300	broad.mit.edu	37	11	55406609	55406609	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55406609C>T	uc010rij.1	+	1	776	c.776C>T	c.(775-777)CCG>CTG	p.P259L		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	259	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						TACATTAGACCGGTCACAACA	0.418													70	199	---	---	---	---	capture	Missense_Mutation	SNP	55406609	55406609	OR4P4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10984	198
OR5D13	390142	broad.mit.edu	37	11	55541762	55541762	+	Silent	SNP	G	A	A	rs150209335	byFrequency;by1000genomes	TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55541762G>A	uc010ril.1	+	1	849	c.849G>A	c.(847-849)GCG>GCA	p.A283A		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				ACACAGTGGCGATTCCAATGC	0.363													6	93	---	---	---	---	capture	Silent	SNP	55541762	55541762	OR5D13	11	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	11058	198
OR6Q1	219952	broad.mit.edu	37	11	57798597	57798597	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57798597G>A	uc010rjz.1	+	1	173	c.173G>A	c.(172-174)CGG>CAG	p.R58Q	OR9Q1_uc001nmj.2_Intron	NM_001005186	NP_001005186	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(1)	1		Breast(21;0.0707)|all_epithelial(135;0.142)				CACCGACTACGGAGACCCATG	0.483													28	279	---	---	---	---	capture	Missense_Mutation	SNP	57798597	57798597	OR6Q1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11112	198
PLAC1L	219990	broad.mit.edu	37	11	59807922	59807922	+	Translation_Start_Site	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59807922C>T	uc001nol.2	+	1	175	c.-10C>T	c.(-12--8)GACGA>GATGA			NM_173801	NP_776162	Q86WS3	PLACL_HUMAN	placenta-specific 1-like precursor							extracellular region				ovary(2)|skin(1)	3						TCTGCTCAGACGAAGGTCTCC	0.473													49	181	---	---	---	---	capture	Translation_Start_Site	SNP	59807922	59807922	PLAC1L	11	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	11916	198
SLC22A11	55867	broad.mit.edu	37	11	64329558	64329558	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64329558G>A	uc001oai.2	+	3	954	c.580G>A	c.(580-582)GTC>ATC	p.V194I	SLC22A11_uc001oah.1_Missense_Mutation_p.R159H|SLC22A11_uc001oaj.2_Missense_Mutation_p.V194I|SLC22A11_uc009ypq.2_Missense_Mutation_p.V194I|SLC22A11_uc001oak.1_Missense_Mutation_p.V23I	NM_018484	NP_060954	Q9NSA0	S22AB_HUMAN	solute carrier family 22 member 11	194	Helical; (Potential).				urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2					Probenecid(DB01032)	CCCAACATTCGTCATCTACTG	0.622											OREG0004030	type=REGULATORY REGION|Gene=SLC22A11|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	21	42	---	---	---	---	capture	Missense_Mutation	SNP	64329558	64329558	SLC22A11	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14335	198
RAB38	23682	broad.mit.edu	37	11	87847172	87847172	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:87847172C>A	uc001pcj.1	-	3	667	c.620G>T	c.(619-621)GGC>GTC	p.G207V		NM_022337	NP_071732	P57729	RAB38_HUMAN	RAB38	207					protein transport|small GTPase mediated signal transduction	melanosome|plasma membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTTGGCACAGCCAGAGCAGCT	0.473													68	163	---	---	---	---	capture	Missense_Mutation	SNP	87847172	87847172	RAB38	11	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	12823	198
CCND2	894	broad.mit.edu	37	12	4409083	4409083	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:4409083C>T	uc001qmo.2	+	5	1083	c.778C>T	c.(778-780)CAG>TAG	p.Q260*		NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2	260					cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			TAGCCTGCAGCAGTACCGTCA	0.542			T	IGL@	NHL,CLL								8	83	---	---	---	---	capture	Nonsense_Mutation	SNP	4409083	4409083	CCND2	12	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	2888	198
PRPF40B	25766	broad.mit.edu	37	12	50030609	50030609	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50030609C>T	uc001rur.1	+	15	1535	c.1471C>T	c.(1471-1473)CGC>TGC	p.R491C	PRPF40B_uc001rup.1_Missense_Mutation_p.R513C|PRPF40B_uc001ruq.1_Missense_Mutation_p.R485C|PRPF40B_uc001rus.1_Missense_Mutation_p.R434C	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1	491					mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						ACGCCAACAACGCAAGAATCG	0.577											OREG0021797	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	114	---	---	---	---	capture	Missense_Mutation	SNP	50030609	50030609	PRPF40B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12468	198
LEMD3	23592	broad.mit.edu	37	12	65564282	65564282	+	Silent	SNP	C	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:65564282C>A	uc001ssl.1	+	1	912	c.906C>A	c.(904-906)GCC>GCA	p.A302A	LEMD3_uc009zqo.1_Silent_p.A302A	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	302					negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		CTAAATCGGCCGGCGGCAGGC	0.622													11	35	---	---	---	---	capture	Silent	SNP	65564282	65564282	LEMD3	12	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	8641	198
GLT1D1	144423	broad.mit.edu	37	12	129360521	129360521	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129360521G>A	uc010tbh.1	+	2	107	c.98G>A	c.(97-99)CGA>CAA	p.R33Q	GLT1D1_uc001uhx.1_Missense_Mutation_p.R44Q|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	44					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		TTTGAAAGCCGATCTGAGATT	0.488													52	282	---	---	---	---	capture	Missense_Mutation	SNP	129360521	129360521	GLT1D1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6401	198
F7	2155	broad.mit.edu	37	13	113771870	113771870	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113771870C>T	uc001vsv.2	+	8	816	c.765C>T	c.(763-765)TTC>TTT	p.F255F	F7_uc001vsw.2_Silent_p.F233F|F7_uc010tjt.1_Silent_p.F186F	NM_000131	NP_000122	P08709	FA7_HUMAN	coagulation factor VII isoform a precursor	255	Peptidase S1.				anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	CCCACTGTTTCGACAAAATCA	0.622													35	162	---	---	---	---	capture	Silent	SNP	113771870	113771870	F7	13	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	5303	198
STYX	6815	broad.mit.edu	37	14	53217446	53217446	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:53217446C>T	uc010tqy.1	+	5	252	c.190C>T	c.(190-192)CGA>TGA	p.R64*	STYX_uc001xaa.2_Nonsense_Mutation_p.R64*	NM_001130701	NP_001124173	Q8WUJ0	STYX_HUMAN	serine/threonine/tyrosine interacting protein	64					protein dephosphorylation|spermatogenesis	cytoplasm	protein tyrosine/serine/threonine phosphatase activity				0	Breast(41;0.176)					AATATGCATACGACAAAATAT	0.289													14	187	---	---	---	---	capture	Nonsense_Mutation	SNP	53217446	53217446	STYX	14	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	15250	198
KIAA1409	57578	broad.mit.edu	37	14	94109960	94109960	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94109960C>T	uc001ybv.1	+	33	5696	c.5613C>T	c.(5611-5613)GCC>GCT	p.A1871A	KIAA1409_uc001ybs.1_Silent_p.A1849A	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2026						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		TTGGGCTAGCCATCGTGGTCC	0.498													4	175	---	---	---	---	capture	Silent	SNP	94109960	94109960	KIAA1409	14	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	8152	198
AHNAK2	113146	broad.mit.edu	37	14	105418809	105418809	+	Silent	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105418809G>A	uc010axc.1	-	7	3099	c.2979C>T	c.(2977-2979)GCC>GCT	p.A993A	AHNAK2_uc001ypx.2_Silent_p.A893A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	993						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGCTGTCTTTGGCAGTCACGT	0.602													167	341	---	---	---	---	capture	Silent	SNP	105418809	105418809	AHNAK2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	415	198
SYNM	23336	broad.mit.edu	37	15	99671205	99671205	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99671205C>T	uc002bup.2	+	6	2760	c.2640C>T	c.(2638-2640)GAC>GAT	p.D880D	SYNM_uc002buo.2_Silent_p.D880D|SYNM_uc002buq.2_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	880	Tail.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						CACAGAAGGACGGTGCAGTGG	0.582													5	25	---	---	---	---	capture	Silent	SNP	99671205	99671205	SYNM	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15343	198
GRIN2A	2903	broad.mit.edu	37	16	9857448	9857448	+	Missense_Mutation	SNP	C	T	T	rs149745535		TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9857448C>T	uc002czo.3	-	13	4501	c.3953G>A	c.(3952-3954)CGG>CAG	p.R1318Q	GRIN2A_uc010uym.1_Missense_Mutation_p.R1318Q|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1318	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	p.R1318W(1)		skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CTCCAGAAGCCGTTCCCTGTC	0.527													28	189	---	---	---	---	capture	Missense_Mutation	SNP	9857448	9857448	GRIN2A	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6712	198
DNAH3	55567	broad.mit.edu	37	16	21156695	21156695	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21156695C>G	uc010vbe.1	-	3	255	c.255G>C	c.(253-255)TTG>TTC	p.L85F	DNAH3_uc002die.2_Missense_Mutation_p.L56F	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	85	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TGCGTTGCATCAAGGGCGGGT	0.527													3	51	---	---	---	---	capture	Missense_Mutation	SNP	21156695	21156695	DNAH3	16	C	G	G	G	1	0	0	0	0	1	0	0	0	376	29	4	4	4560	198
SEZ6L2	26470	broad.mit.edu	37	16	29884862	29884862	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29884862C>T	uc002duq.3	-	13	2533	c.2293G>A	c.(2293-2295)GCC>ACC	p.A765T	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Missense_Mutation_p.A695T|SEZ6L2_uc002dur.3_Missense_Mutation_p.A695T|SEZ6L2_uc002dus.3_Missense_Mutation_p.A651T|SEZ6L2_uc010vec.1_Missense_Mutation_p.A765T|SEZ6L2_uc010ved.1_Missense_Mutation_p.A721T	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	765	Sushi 4.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						GACTCACAGGCGCATTTGGGG	0.672													15	62	---	---	---	---	capture	Missense_Mutation	SNP	29884862	29884862	SEZ6L2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14037	198
CMTM2	146225	broad.mit.edu	37	16	66613682	66613682	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66613682C>T	uc002ept.2	+	1	332	c.172C>T	c.(172-174)CCC>TCC	p.P58S	CMTM2_uc010cdu.2_Missense_Mutation_p.P58S	NM_144673	NP_653274	Q8TAZ6	CKLF2_HUMAN	chemokine-like factor superfamily 2	58					chemotaxis	extracellular space|integral to membrane	cytokine activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		GGCGGTGCAGCCCAAGCACGA	0.557													33	68	---	---	---	---	capture	Missense_Mutation	SNP	66613682	66613682	CMTM2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3548	198
DNAI2	64446	broad.mit.edu	37	17	72308276	72308276	+	Silent	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72308276G>A	uc002jkf.2	+	12	1728	c.1629G>A	c.(1627-1629)GCG>GCA	p.A543A	DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_Intron|uc002jkh.1_5'Flank|DNAI2_uc002jki.2_RNA	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate polypeptide 2	543					cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3						ACCTGGAGGCGCTGGTCAGCA	0.617									Kartagener_syndrome				4	40	---	---	---	---	capture	Silent	SNP	72308276	72308276	DNAI2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4566	198
SERPINB13	5275	broad.mit.edu	37	18	61255920	61255920	+	Missense_Mutation	SNP	G	A	A	rs139825462		TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61255920G>A	uc002ljc.2	+	2	187	c.19G>A	c.(19-21)GTC>ATC	p.V7I	SERPINB13_uc002ljd.2_5'UTR|SERPINB13_uc010xep.1_Missense_Mutation_p.V7I|SERPINB13_uc010xeq.1_5'UTR|SERPINB13_uc010xer.1_5'UTR	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN	serine (or cysteine) proteinase inhibitor, clade	7					regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1						ACTTGGCGCCGTCAGCACTCG	0.418													67	115	---	---	---	---	capture	Missense_Mutation	SNP	61255920	61255920	SERPINB13	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13993	198
CLEC4M	10332	broad.mit.edu	37	19	7833731	7833731	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7833731C>T	uc002mih.2	+	8	1106	c.988C>T	c.(988-990)CGG>TGG	p.R330W	CLEC4M_uc010xjw.1_Missense_Mutation_p.R286W|CLEC4M_uc010dvt.2_Missense_Mutation_p.R307W|CLEC4M_uc010dvs.2_Missense_Mutation_p.R329W|CLEC4M_uc010xjx.1_Missense_Mutation_p.R302W|CLEC4M_uc002mhz.2_Missense_Mutation_p.A223V|CLEC4M_uc002mic.2_Missense_Mutation_p.A287V|CLEC4M_uc002mia.2_Missense_Mutation_p.R217W	NM_001144910	NP_001138382	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M isoform	353	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding			pancreas(1)	1						CAGCTTCCAGCGGTACTGGAA	0.498													18	157	---	---	---	---	capture	Missense_Mutation	SNP	7833731	7833731	CLEC4M	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3483	198
SLC1A6	6511	broad.mit.edu	37	19	15067440	15067440	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15067440C>T	uc002naa.1	-	6	1025	c.1017G>A	c.(1015-1017)CTG>CTA	p.L339L	SLC1A6_uc010dzu.1_Intron|SLC1A6_uc010xod.1_Silent_p.L275L	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	339					synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	TGTACATGCCCAGCTGACCCC	0.587													17	76	---	---	---	---	capture	Silent	SNP	15067440	15067440	SLC1A6	19	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	14329	198
KCNN1	3780	broad.mit.edu	37	19	18084899	18084899	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18084899G>A	uc002nht.2	+	3	512	c.202G>A	c.(202-204)GAT>AAT	p.D68N	KCNN1_uc010xqa.1_Missense_Mutation_p.D68N	NM_002248	NP_002239	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance	68					synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0						GGACCAGGACGATGACGAGGA	0.701													12	30	---	---	---	---	capture	Missense_Mutation	SNP	18084899	18084899	KCNN1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8000	198
PSG6	5675	broad.mit.edu	37	19	43414919	43414919	+	Silent	SNP	C	T	T	rs1065506		TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43414919C>T	uc002ovj.1	-	3	571	c.519G>A	c.(517-519)CCG>CCA	p.P173P	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Silent_p.P180P|PSG6_uc002ovi.2_Silent_p.P174P|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_5'UTR|PSG6_uc002ovf.1_Silent_p.P173P|PSG6_uc002ovg.1_Silent_p.P173P	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	173	Ig-like C2-type 1.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				AGCTTGCATCCGGAGTCTCAG	0.532													31	453	---	---	---	---	capture	Silent	SNP	43414919	43414919	PSG6	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12554	198
SIGLEC5	8778	broad.mit.edu	37	19	52115643	52115643	+	Silent	SNP	G	A	A	rs141897891	byFrequency	TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52115643G>A	uc002pxe.2	-	9	1636	c.1497C>T	c.(1495-1497)CCC>CCT	p.P499P		NM_003830	NP_003821	O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5 precursor	499	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding			skin(2)|breast(1)|central_nervous_system(1)	4		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		CTTGATCTCCGGGGCTGTCTG	0.493													45	197	---	---	---	---	capture	Silent	SNP	52115643	52115643	SIGLEC5	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14204	198
NLRP5	126206	broad.mit.edu	37	19	56515208	56515208	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56515208C>T	uc002qmj.2	+	2	189	c.189C>T	c.(187-189)TAC>TAT	p.Y63Y	NLRP5_uc002qmi.2_Silent_p.Y63Y	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	63	DAPIN.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TTTCCAGCTACGGGCTGCAAT	0.423													52	189	---	---	---	---	capture	Silent	SNP	56515208	56515208	NLRP5	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10387	198
KLF11	8462	broad.mit.edu	37	2	10186413	10186413	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:10186413G>T	uc002raf.1	+	2	341	c.179G>T	c.(178-180)AGA>ATA	p.R60I	KLF11_uc010yjc.1_Missense_Mutation_p.R43I	NM_003597	NP_003588	O14901	KLF11_HUMAN	Kruppel-like factor 11	60					apoptosis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|regulation of transcription involved in S phase of mitotic cell cycle	nucleus	sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		TGGGGTCAAAGATCCCAGAAA	0.537													28	52	---	---	---	---	capture	Missense_Mutation	SNP	10186413	10186413	KLF11	2	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	8260	198
LAPTM4A	9741	broad.mit.edu	37	2	20240757	20240757	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:20240757T>A	uc002rdm.2	-	2	635	c.127A>T	c.(127-129)ATG>TTG	p.M43L	LAPTM4A_uc002rdn.2_Missense_Mutation_p.M1L|LAPTM4A_uc010yjx.1_Missense_Mutation_p.M43L	NM_014713	NP_055528	Q15012	LAP4A_HUMAN	lysosomal protein transmembrane 4 alpha	43	Helical; (Potential).				transport	endomembrane system|Golgi apparatus|integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAATTGCCATCAATAGGTTT	0.378													66	136	---	---	---	---	capture	Missense_Mutation	SNP	20240757	20240757	LAPTM4A	2	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	8544	198
PROM2	150696	broad.mit.edu	37	2	95947041	95947041	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:95947041C>T	uc002suh.1	+	12	1612	c.1479C>T	c.(1477-1479)TTC>TTT	p.F493F	PROM2_uc002sui.2_Silent_p.F493F|PROM2_uc002suj.2_Silent_p.F147F|PROM2_uc002suk.2_Silent_p.F493F|PROM2_uc002sul.2_Silent_p.F19F|PROM2_uc002sum.2_RNA	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	493	Helical; (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						TCCTGGTGTTCGCCACCTTCC	0.642													51	108	---	---	---	---	capture	Silent	SNP	95947041	95947041	PROM2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	12452	198
DPP10	57628	broad.mit.edu	37	2	116534868	116534868	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116534868C>A	uc002tla.1	+	14	1763	c.1306C>A	c.(1306-1308)CAA>AAA	p.Q436K	DPP10_uc002tlb.1_Missense_Mutation_p.Q386K|DPP10_uc002tlc.1_Missense_Mutation_p.Q432K|DPP10_uc002tle.2_Missense_Mutation_p.Q440K|DPP10_uc002tlf.1_Missense_Mutation_p.Q429K	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	436	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TGAAACTACTCAAAAAATGTG	0.378													28	65	---	---	---	---	capture	Missense_Mutation	SNP	116534868	116534868	DPP10	2	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	4682	198
SCN2A	6326	broad.mit.edu	37	2	166179852	166179852	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166179852C>T	uc002udc.2	+	12	2148	c.1858C>T	c.(1858-1860)CGG>TGG	p.R620W	SCN2A_uc002udd.2_Missense_Mutation_p.R620W|SCN2A_uc002ude.2_Missense_Mutation_p.R620W	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	620					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	ACATGGAGAACGGCGCCACAG	0.562													4	35	---	---	---	---	capture	Missense_Mutation	SNP	166179852	166179852	SCN2A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	13809	198
SPEG	10290	broad.mit.edu	37	2	220329174	220329174	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220329174G>A	uc010fwg.2	+	9	2725	c.2725G>A	c.(2725-2727)GTG>ATG	p.V909M	SPEG_uc002vlm.2_RNA|SPEG_uc010fwh.1_Missense_Mutation_p.V117M|SPEG_uc002vln.1_Missense_Mutation_p.V117M|SPEG_uc002vlp.1_Missense_Mutation_p.V117M|SPEG_uc002vlq.2_Missense_Mutation_p.V60M	NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	909	Ig-like 3.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCGCCAGCCCGTGCGCCCAGA	0.662													13	93	---	---	---	---	capture	Missense_Mutation	SNP	220329174	220329174	SPEG	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14928	198
SPHKAP	80309	broad.mit.edu	37	2	228856023	228856023	+	Nonsense_Mutation	SNP	T	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:228856023T>A	uc002vpq.2	-	10	4788	c.4741A>T	c.(4741-4743)AAG>TAG	p.K1581*	SPHKAP_uc002vpp.2_Nonsense_Mutation_p.K1552*|SPHKAP_uc010zlx.1_Intron	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1581						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTAAGAATCTTCTTTTCTTCT	0.403													18	203	---	---	---	---	capture	Nonsense_Mutation	SNP	228856023	228856023	SPHKAP	2	T	A	A	A	1	0	0	0	0	0	1	0	0	806	62	5	4	14940	198
SALL4	57167	broad.mit.edu	37	20	50407509	50407509	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50407509C>T	uc002xwh.3	-	2	1614	c.1513G>A	c.(1513-1515)GGT>AGT	p.G505S	SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	505					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TGCAGGTCACCGGGCAAGGAG	0.567													92	235	---	---	---	---	capture	Missense_Mutation	SNP	50407509	50407509	SALL4	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13705	198
ZGPAT	84619	broad.mit.edu	37	20	62365995	62365995	+	Splice_Site	SNP	A	C	C			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62365995A>C	uc002ygk.2	+	5	1050	c.872_splice	c.e5-2	p.V291_splice	ZGPAT_uc002ygi.2_Intron|ZGPAT_uc002ygj.2_Intron|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Intron|ZGPAT_uc002ygm.2_Intron|ZGPAT_uc002ygn.3_Intron|LIME1_uc011abi.1_5'Flank|LIME1_uc002ygp.3_5'Flank	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain						negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					CATCTCTTGCAGTGGTGGGGT	0.622													83	170	---	---	---	---	capture	Splice_Site	SNP	62365995	62365995	ZGPAT	20	A	C	C	C	1	0	0	0	0	0	0	1	0	91	7	5	4	17554	198
NRIP1	8204	broad.mit.edu	37	21	16339283	16339283	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:16339283G>T	uc002yjx.2	-	4	1829	c.1231C>A	c.(1231-1233)CCT>ACT	p.P411T		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	411	Repression domain 2.				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		ATAGTTGTAGGTGTACTACTT	0.373													35	310	---	---	---	---	capture	Missense_Mutation	SNP	16339283	16339283	NRIP1	21	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	10559	198
TUBA8	51807	broad.mit.edu	37	22	18609536	18609536	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:18609536G>A	uc002znv.1	+	4	864	c.791G>A	c.(790-792)CGC>CAC	p.R264H	TUBA8_uc002znr.2_Missense_Mutation_p.R198H|TUBA8_uc002znw.1_Missense_Mutation_p.R288H|TUBA8_uc002znx.1_Missense_Mutation_p.R111H	NM_018943	NP_061816	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	264					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0						CCCTACCCCCGCATCCACTTC	0.567													13	95	---	---	---	---	capture	Missense_Mutation	SNP	18609536	18609536	TUBA8	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16632	198
SCUBE1	80274	broad.mit.edu	37	22	43600126	43600126	+	Silent	SNP	G	A	A	rs140846155	byFrequency;by1000genomes	TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:43600126G>A	uc003bdt.1	-	22	2932	c.2844C>T	c.(2842-2844)GAC>GAT	p.D948D		NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	948					adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				GCGCCAGCACGTCGAAGAGGG	0.572													14	126	---	---	---	---	capture	Silent	SNP	43600126	43600126	SCUBE1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13837	198
IL5RA	3568	broad.mit.edu	37	3	3139660	3139660	+	Silent	SNP	A	C	C			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:3139660A>C	uc011ask.1	-	8	1247	c.603T>G	c.(601-603)ACT>ACG	p.T201T	IL5RA_uc010hbq.2_Silent_p.T201T|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Silent_p.T201T|IL5RA_uc011asl.1_Silent_p.T201T|IL5RA_uc011asm.1_Silent_p.T201T|IL5RA_uc010hbt.2_Silent_p.T201T|IL5RA_uc011asn.1_Silent_p.T201T|IL5RA_uc010hbu.2_Silent_p.T201T	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1	201	Extracellular (Potential).				cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		TGAGGATAAAAGTCCTGGGAA	0.493													8	147	---	---	---	---	capture	Silent	SNP	3139660	3139660	IL5RA	3	A	C	C	C	1	0	0	0	0	0	0	0	1	28	3	4	4	7623	198
FAM19A1	407738	broad.mit.edu	37	3	68466552	68466552	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:68466552C>T	uc003dnd.2	+	3	457	c.241C>T	c.(241-243)CGG>TGG	p.R81W	FAM19A1_uc003dne.2_Missense_Mutation_p.R81W|FAM19A1_uc003dng.2_Missense_Mutation_p.R81W	NM_213609	NP_998774	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine	81						endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		AACAAGAAACCGGCCTTCTTG	0.418													38	95	---	---	---	---	capture	Missense_Mutation	SNP	68466552	68466552	FAM19A1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	5483	198
HPS3	84343	broad.mit.edu	37	3	148868422	148868422	+	Silent	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148868422G>A	uc003ewu.1	+	6	1340	c.1200G>A	c.(1198-1200)GCG>GCA	p.A400A	HPS3_uc003ewt.1_Silent_p.A400A|HPS3_uc011bnq.1_Silent_p.A235A	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein	400						cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GGTGCAGTGCGGCGGCAGCTC	0.532									Hermansky-Pudlak_syndrome				12	106	---	---	---	---	capture	Silent	SNP	148868422	148868422	HPS3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7265	198
CP	1356	broad.mit.edu	37	3	148925268	148925268	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148925268G>T	uc003ewy.3	-	5	1171	c.918C>A	c.(916-918)AAC>AAA	p.N306K	CP_uc011bnr.1_RNA|CP_uc003ewx.3_Missense_Mutation_p.N87K|CP_uc003ewz.2_Missense_Mutation_p.N306K|CP_uc010hvf.1_Missense_Mutation_p.N32K	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	306	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GGTAGTTCTTGTTAGTCAGTG	0.458													42	135	---	---	---	---	capture	Missense_Mutation	SNP	148925268	148925268	CP	3	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	3752	198
SAMD7	344658	broad.mit.edu	37	3	169654200	169654200	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169654200G>C	uc003fgd.2	+	8	1382	c.1115G>C	c.(1114-1116)GGA>GCA	p.G372A	SAMD7_uc003fge.2_Missense_Mutation_p.G372A|SAMD7_uc011bpo.1_Missense_Mutation_p.G273A	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	372	SAM.									skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			GGCACTATGGGATTAAAGCTA	0.343													23	81	---	---	---	---	capture	Missense_Mutation	SNP	169654200	169654200	SAMD7	3	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	13716	198
PCDHB12	56124	broad.mit.edu	37	5	140589502	140589502	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140589502C>T	uc003liz.2	+	1	1212	c.1023C>T	c.(1021-1023)AAC>AAT	p.N341N	PCDHB12_uc011dak.1_Silent_p.N4N	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	341	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGATGTAAACGACAACGCTC	0.413													51	88	---	---	---	---	capture	Silent	SNP	140589502	140589502	PCDHB12	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11440	198
GFPT2	9945	broad.mit.edu	37	5	179731784	179731784	+	Silent	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179731784G>A	uc003mlw.1	-	17	1928	c.1830C>T	c.(1828-1830)GTC>GTT	p.V610V		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	610	SIS 2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	GGCGGGCCGTGACTTGCTGCA	0.592													85	195	---	---	---	---	capture	Silent	SNP	179731784	179731784	GFPT2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	6286	198
GFPT2	9945	broad.mit.edu	37	5	179731922	179731922	+	Silent	SNP	G	C	C			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179731922G>C	uc003mlw.1	-	17	1790	c.1692C>G	c.(1690-1692)ACC>ACG	p.T564T		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	564	SIS 2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AGTGCATGTAGGTTATCTCTT	0.537													89	184	---	---	---	---	capture	Silent	SNP	179731922	179731922	GFPT2	5	G	C	C	C	1	0	0	0	0	0	0	0	1	444	35	4	4	6286	198
VARS2	57176	broad.mit.edu	37	6	30883807	30883807	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30883807G>T	uc003nsc.1	+	5	1188	c.556G>T	c.(556-558)GCA>TCA	p.A186S	VARS2_uc003nsd.2_Missense_Mutation_p.A186S|VARS2_uc011dmx.1_Missense_Mutation_p.A186S|VARS2_uc011dmy.1_Missense_Mutation_p.A46S|VARS2_uc011dmz.1_Missense_Mutation_p.A216S|VARS2_uc011dna.1_Missense_Mutation_p.A186S|VARS2_uc011dnb.1_RNA|VARS2_uc011dnc.1_RNA|VARS2_uc011dnd.1_5'Flank	NM_020442	NP_065175	Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	186					valyl-tRNA aminoacylation	mitochondrion	ATP binding|valine-tRNA ligase activity			ovary(3)|central_nervous_system(1)	4						TTCAGATCATGCAGGAATTGC	0.478													127	285	---	---	---	---	capture	Missense_Mutation	SNP	30883807	30883807	VARS2	6	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	17006	198
CLCN1	1180	broad.mit.edu	37	7	143047569	143047569	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143047569G>C	uc003wcr.1	+	21	2595	c.2508G>C	c.(2506-2508)AAG>AAC	p.K836N	CLCN1_uc011ktc.1_Missense_Mutation_p.K448N	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	836	CBS 2.|Cytoplasmic (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					CCCTGCACAAGGTGAGTCTTT	0.567													18	115	---	---	---	---	capture	Missense_Mutation	SNP	143047569	143047569	CLCN1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	3427	198
WHSC1L1	54904	broad.mit.edu	37	8	38148069	38148069	+	Silent	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:38148069G>A	uc003xli.2	-	17	3560	c.3042C>T	c.(3040-3042)GGC>GGT	p.G1014G	WHSC1L1_uc011lbm.1_Silent_p.G1014G|WHSC1L1_uc010lwe.2_Silent_p.G965G	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	1014	PWWP 2.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			GGAACACTCTGCCCTGGTGTA	0.463			T	NUP98	AML								98	272	---	---	---	---	capture	Silent	SNP	38148069	38148069	WHSC1L1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	17244	198
JPH1	56704	broad.mit.edu	37	8	75171695	75171695	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:75171695C>T	uc003yae.2	-	3	1223	c.1183G>A	c.(1183-1185)GCG>ACG	p.A395T	JPH1_uc003yaf.2_Missense_Mutation_p.A395T|JPH1_uc003yag.1_Missense_Mutation_p.A259T	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1	395	Ala-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GCGGCCAGCGCGGCCTGGTCG	0.597													23	34	---	---	---	---	capture	Missense_Mutation	SNP	75171695	75171695	JPH1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7883	198
RALYL	138046	broad.mit.edu	37	8	85774546	85774546	+	Silent	SNP	C	T	T			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:85774546C>T	uc003ycq.3	+	7	845	c.429C>T	c.(427-429)CAC>CAT	p.H143H	RALYL_uc003ycr.3_Silent_p.H143H|RALYL_uc003ycs.3_Silent_p.H143H|RALYL_uc010lzy.2_Silent_p.H132H|RALYL_uc003yct.3_Silent_p.H156H|RALYL_uc003ycu.3_Silent_p.H70H|RALYL_uc003ycv.3_Silent_p.H55H	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2	143							identical protein binding|nucleotide binding|RNA binding			ovary(1)	1						TTGATTACCACGGGCGTGTGC	0.483													5	33	---	---	---	---	capture	Silent	SNP	85774546	85774546	RALYL	8	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12915	198
CORO2A	7464	broad.mit.edu	37	9	100897128	100897128	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100897128G>A	uc004ayl.2	-	4	694	c.428C>T	c.(427-429)ACG>ATG	p.T143M	CORO2A_uc004aym.2_Missense_Mutation_p.T143M	NM_003389	NP_003380	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	143	WD 2.				actin cytoskeleton organization|intracellular signal transduction	actin cytoskeleton|transcriptional repressor complex	actin filament binding			skin(2)|ovary(1)|pancreas(1)	4		Acute lymphoblastic leukemia(62;0.0559)				GTTGGCGGCCGTGGGGTGCCA	0.468													9	21	---	---	---	---	capture	Missense_Mutation	SNP	100897128	100897128	CORO2A	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3721	198
RAB9A	9367	broad.mit.edu	37	X	13727279	13727279	+	Silent	SNP	C	G	G	rs146572677	byFrequency	TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:13727279C>G	uc004cvm.2	+	3	596	c.414C>G	c.(412-414)GCC>GCG	p.A138A	RAB9A_uc010neh.2_Silent_p.A138A	NM_004251	NP_004242	P51151	RAB9A_HUMAN	RAB9A, member RAS oncogene family	138					protein transport|small GTPase mediated signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome|lysosome|plasma membrane	GDP binding|GTP binding|GTPase activity|protein binding	p.A138V(1)		ovary(1)	1						CAGAAGAAGCCCAAGCTTGGT	0.458													4	145	---	---	---	---	capture	Silent	SNP	13727279	13727279	RAB9A	23	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	12853	198
PIK3C2B	5287	broad.mit.edu	37	1	204438072	204438072	+	Frame_Shift_Del	DEL	G	-	-	rs115574296	by1000genomes	TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204438072delG	uc001haw.2	-	3	1338	c.859delC	c.(859-861)CGCfs	p.R287fs	PIK3C2B_uc010pqv.1_Frame_Shift_Del_p.R287fs|PIK3C2B_uc001hax.1_Frame_Shift_Del_p.R287fs|PIK3C2B_uc009xbd.1_RNA	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	287	Interaction with GRB2.				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GCATAGGTGCGGGGGGGCACC	0.622													7	932	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	204438072	204438072	PIK3C2B	1	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	11813	198
TNRC6A	27327	broad.mit.edu	37	16	24807240	24807240	+	Frame_Shift_Del	DEL	A	-	-			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24807240delA	uc002dmm.2	+	9	3655	c.3541delA	c.(3541-3543)AAAfs	p.K1181fs	TNRC6A_uc010bxs.2_Frame_Shift_Del_p.K928fs|TNRC6A_uc010vcc.1_Frame_Shift_Del_p.K928fs|TNRC6A_uc002dmn.2_Frame_Shift_Del_p.K928fs|TNRC6A_uc002dmo.2_Frame_Shift_Del_p.K869fs	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1181	Sufficient for interaction with EIF2C1 and EIF2C4.				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		TCTGAGTGGCAAAAAAAGGAG	0.224													9	438	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	24807240	24807240	TNRC6A	16	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	16223	198
QRICH2	84074	broad.mit.edu	37	17	74276772	74276772	+	Frame_Shift_Del	DEL	T	-	-			TCGA-27-2518-01	TCGA-27-2518-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74276772delT	uc002jrd.1	-	10	4106	c.3926delA	c.(3925-3927)AAGfs	p.K1309fs	QRICH2_uc010wsz.1_Frame_Shift_Del_p.K1235fs|QRICH2_uc010dgw.1_Frame_Shift_Del_p.K153fs	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1309	Potential.						protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						CCTGTTGGCCTTTTCCTTTTC	0.587													7	183	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	74276772	74276772	QRICH2	17	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	12775	198
