Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CHD5	26038	broad.mit.edu	37	1	6172293	6172293	+	Missense_Mutation	SNP	T	G	G			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6172293T>G	uc001amb.1	-	35	5147	c.5047A>C	c.(5047-5049)AAT>CAT	p.N1683H	CHD5_uc001alz.1_Missense_Mutation_p.N540H|CHD5_uc001ama.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1683					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TTGTCACCATTTTGCTGTGTT	0.433													4	333	---	---	---	---	capture	Missense_Mutation	SNP	6172293	6172293	CHD5	1	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	3294	199
AIM1L	55057	broad.mit.edu	37	1	26658052	26658052	+	Silent	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26658052G>A	uc001bmd.3	-	14	1537	c.1107C>T	c.(1105-1107)GGC>GGT	p.G369G		NM_001039775	NP_001034864	Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	369	Beta/gamma crystallin 'Greek key' 8.						sugar binding			pancreas(1)	1		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		TGGGGAACTCGCCCTCAGAGA	0.567													40	72	---	---	---	---	capture	Silent	SNP	26658052	26658052	AIM1L	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	431	199
WDR65	149465	broad.mit.edu	37	1	43663300	43663300	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43663300G>A	uc001cip.1	+	7	1320	c.1199G>A	c.(1198-1200)CGC>CAC	p.R400H	EBNA1BP2_uc001cio.2_Intron|WDR65_uc010ojz.1_Missense_Mutation_p.R389H|WDR65_uc001ciq.1_Missense_Mutation_p.R400H	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65	400	WD 5.									skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACCTGCATCCGCAAACCCCTT	0.458													5	256	---	---	---	---	capture	Missense_Mutation	SNP	43663300	43663300	WDR65	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17197	199
PTPRF	5792	broad.mit.edu	37	1	44069848	44069848	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44069848C>T	uc001cjr.2	+	16	3365	c.3025C>T	c.(3025-3027)CCG>TCG	p.P1009S	PTPRF_uc001cjs.2_Missense_Mutation_p.P1000S|PTPRF_uc001cju.2_Intron|PTPRF_uc009vwt.2_Missense_Mutation_p.P569S|PTPRF_uc001cjv.2_Missense_Mutation_p.P469S|PTPRF_uc001cjw.2_Missense_Mutation_p.P235S	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1009	Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCGGACCATGCCGGTGGAGCA	0.617													4	97	---	---	---	---	capture	Missense_Mutation	SNP	44069848	44069848	PTPRF	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12696	199
TCHH	7062	broad.mit.edu	37	1	152080572	152080572	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152080572T>A	uc001ezp.2	-	2	5121	c.5121A>T	c.(5119-5121)AGA>AGT	p.R1707S	TCHH_uc009wne.1_Missense_Mutation_p.R1707S	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1707	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAGGAATTTTCTCTCTCGTT	0.587													37	82	---	---	---	---	capture	Missense_Mutation	SNP	152080572	152080572	TCHH	1	T	A	A	A	1	0	0	0	0	1	0	0	0	803	62	4	4	15585	199
TCHH	7062	broad.mit.edu	37	1	152081047	152081047	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152081047C>T	uc001ezp.2	-	2	4646	c.4646G>A	c.(4645-4647)CGG>CAG	p.R1549Q	TCHH_uc009wne.1_Missense_Mutation_p.R1549Q	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1549	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCTGACGCCGCTGTTGCCC	0.607													38	98	---	---	---	---	capture	Missense_Mutation	SNP	152081047	152081047	TCHH	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15585	199
OR2M2	391194	broad.mit.edu	37	1	248344068	248344068	+	Missense_Mutation	SNP	C	T	T	rs150685608		TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248344068C>T	uc010pzf.1	+	1	781	c.781C>T	c.(781-783)CGG>TGG	p.R261W		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CATGTACATACGGCCCACATC	0.517													150	358	---	---	---	---	capture	Missense_Mutation	SNP	248344068	248344068	OR2M2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	10914	199
C10orf113	387638	broad.mit.edu	37	10	21435284	21435284	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:21435284G>A	uc001iqm.2	-	1	144	c.124C>T	c.(124-126)CCA>TCA	p.P42S	NEBL_uc001iqk.2_Intron	NM_001010896	NP_001010896	Q5VZT2	CJ113_HUMAN	hypothetical protein LOC387638	52										ovary(3)|pancreas(1)	4						TTCATGTCTGGAATGTACATT	0.443													68	76	---	---	---	---	capture	Missense_Mutation	SNP	21435284	21435284	C10orf113	10	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	1572	199
PTEN	5728	broad.mit.edu	37	10	89711899	89711899	+	Missense_Mutation	SNP	C	T	T	rs121913293		TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711899C>T	uc001kfb.2	+	7	1548	c.517C>T	c.(517-519)CGC>TGC	p.R173C		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	173	Phosphatase tensin-type.		R -> C (in endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3; retains ability to bind phospholipid membranes).|R -> P (loss of phosphatase activity towards Ins(1,3,4,5)P4).|R -> H (loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R173C(32)|p.R173H(22)|p.R55fs*1(4)|p.V166fs*17(3)|p.?(3)|p.G165fs*9(3)|p.R173fs*10(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G165_K342del(1)|p.G165_*404del(1)|p.R173R(1)|p.R173P(1)|p.R172fs*5(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAGTCAGAGGCGCTATGTGTA	0.348	R173C(REH_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			90	100	---	---	---	---	capture	Missense_Mutation	SNP	89711899	89711899	PTEN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12633	199
DNMBP	23268	broad.mit.edu	37	10	101654794	101654794	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:101654794A>G	uc001kqj.2	-	11	3157	c.3065T>C	c.(3064-3066)GTA>GCA	p.V1022A	DNMBP_uc010qpl.1_5'UTR|DNMBP_uc001kqg.2_Missense_Mutation_p.V310A|DNMBP_uc001kqh.2_Missense_Mutation_p.V654A	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1022	BAR.				intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		TTCTTCAAATACTTCATCTTT	0.353													18	22	---	---	---	---	capture	Missense_Mutation	SNP	101654794	101654794	DNMBP	10	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	4630	199
SORCS1	114815	broad.mit.edu	37	10	108389034	108389034	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:108389034C>T	uc001kym.2	-	19	2596	c.2588G>A	c.(2587-2589)GGC>GAC	p.G863D	SORCS1_uc001kyl.2_Missense_Mutation_p.G863D|SORCS1_uc009xxs.2_Missense_Mutation_p.G863D|SORCS1_uc001kyn.1_Missense_Mutation_p.G863D|SORCS1_uc001kyo.2_Missense_Mutation_p.G863D	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	863	Lumenal (Potential).|PKD.					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ACGGAAAATGCCCACGTTCTG	0.483													3	26	---	---	---	---	capture	Missense_Mutation	SNP	108389034	108389034	SORCS1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14822	199
RAB11FIP2	22841	broad.mit.edu	37	10	119798511	119798511	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:119798511T>C	uc001ldj.1	-	3	1677	c.1237A>G	c.(1237-1239)AGG>GGG	p.R413G	RAB11FIP2_uc009xyz.1_Missense_Mutation_p.R413G	NM_014904	NP_055719	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2	413					protein transport	plasma membrane|recycling endosome membrane	protein homodimerization activity				0		Colorectal(252;0.235)		all cancers(201;0.0238)		TTTGAAGCCCTGAATTTTGCT	0.343													3	136	---	---	---	---	capture	Missense_Mutation	SNP	119798511	119798511	RAB11FIP2	10	T	C	C	C	1	0	0	0	0	1	0	0	0	713	55	3	3	12789	199
GRM5	2915	broad.mit.edu	37	11	88780659	88780659	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:88780659G>A	uc001pcq.2	-	1	582	c.382C>T	c.(382-384)CGC>TGC	p.R128C	GRM5_uc009yvm.2_Missense_Mutation_p.R128C|GRM5_uc009yvn.1_Missense_Mutation_p.R128C	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	128	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	p.R128H(1)		central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	TCCACACAGCGTACCAAGCCT	0.522													22	86	---	---	---	---	capture	Missense_Mutation	SNP	88780659	88780659	GRM5	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6733	199
ANO4	121601	broad.mit.edu	37	12	101480464	101480464	+	Silent	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101480464C>T	uc010svm.1	+	17	2135	c.1563C>T	c.(1561-1563)TTC>TTT	p.F521F	ANO4_uc001thw.2_Silent_p.F486F|ANO4_uc001thx.2_Silent_p.F521F|ANO4_uc001thy.2_Silent_p.F41F	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	521	Helical; (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CTGCCGTGTTCGGGATCGTCA	0.517										HNSCC(74;0.22)			180	386	---	---	---	---	capture	Silent	SNP	101480464	101480464	ANO4	12	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	693	199
EML1	2009	broad.mit.edu	37	14	100363508	100363508	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:100363508G>A	uc001ygs.2	+	7	773	c.704G>A	c.(703-705)CGT>CAT	p.R235H	EML1_uc010avt.1_Missense_Mutation_p.R222H|EML1_uc010tww.1_Missense_Mutation_p.R223H|EML1_uc001ygq.2_Missense_Mutation_p.R254H|EML1_uc001ygr.2_Missense_Mutation_p.R254H	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	235						cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)				CGAGACTGCCGTAACAACCTG	0.468													36	47	---	---	---	---	capture	Missense_Mutation	SNP	100363508	100363508	EML1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5051	199
CIB2	10518	broad.mit.edu	37	15	78403609	78403609	+	Silent	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:78403609C>T	uc002bdb.1	-	3	417	c.96G>A	c.(94-96)TCG>TCA	p.S32S	CIB2_uc002bdc.1_5'UTR|CIB2_uc010ums.1_Silent_p.S32S	NM_006383	NP_006374	O75838	CIB2_HUMAN	DNA-dependent protein kinase catalytic	32							calcium ion binding				0						CATAGAATCGCGAATGCAGCC	0.612													46	39	---	---	---	---	capture	Silent	SNP	78403609	78403609	CIB2	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3386	199
ACSM2B	348158	broad.mit.edu	37	16	20570756	20570756	+	Missense_Mutation	SNP	A	G	G	rs74479331		TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20570756A>G	uc002dhj.3	-	4	401	c.191T>C	c.(190-192)CTC>CCC	p.L64P	ACSM2B_uc002dhk.3_Missense_Mutation_p.L64P|ACSM2B_uc010bwf.1_Missense_Mutation_p.L64P	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	64					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						TGGGCTTGGGAGTCGCTTGCC	0.512													3	54	---	---	---	---	capture	Missense_Mutation	SNP	20570756	20570756	ACSM2B	16	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	184	199
KRTAP4-8	728224	broad.mit.edu	37	17	39254021	39254021	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39254021C>T	uc010wfo.1	-	1	355	c.316G>A	c.(316-318)GTG>ATG	p.V106M		NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4.8	106	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].|17.					keratin filament					0						cagctggacacacagcagctg	0.204													3	13	---	---	---	---	capture	Missense_Mutation	SNP	39254021	39254021	KRTAP4-8	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	8476	199
SGCA	6442	broad.mit.edu	37	17	48245006	48245006	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48245006G>A	uc002iqi.2	+	3	257	c.221G>A	c.(220-222)CGG>CAG	p.R74Q	SGCA_uc010wmh.1_Intron|SGCA_uc002iqj.2_Missense_Mutation_p.R74Q|SGCA_uc010wmi.1_RNA	NM_000023	NP_000014	Q16586	SGCA_HUMAN	sarcoglycan, alpha isoform 1 precursor	74	Extracellular (Potential).		R -> W (in LGMD2D).		muscle contraction|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(2)	2						GACCTGCCCCGGTGGCTCCGC	0.657													24	49	---	---	---	---	capture	Missense_Mutation	SNP	48245006	48245006	SGCA	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14092	199
ARHGAP28	79822	broad.mit.edu	37	18	6859897	6859897	+	Splice_Site	SNP	G	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6859897G>T	uc010wzi.1	+	4	433	c.195_splice	c.e4+1	p.V65_splice	ARHGAP28_uc002knc.2_Splice_Site_p.V190_splice|ARHGAP28_uc002knd.2_Splice_Site_p.V83_splice|ARHGAP28_uc002kne.2_Splice_Site_p.V83_splice|ARHGAP28_uc002knf.2_Splice_Site_p.V74_splice			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				TGACTCTGTGGTAAGTCATCC	0.428													72	137	---	---	---	---	capture	Splice_Site	SNP	6859897	6859897	ARHGAP28	18	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	870	199
SIGLEC11	114132	broad.mit.edu	37	19	50462137	50462137	+	Missense_Mutation	SNP	C	A	A	rs142292396	byFrequency	TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50462137C>A	uc010ybh.1	-	7	1217	c.1126G>T	c.(1126-1128)GGC>TGC	p.G376C	SIGLEC11_uc010ybi.1_Missense_Mutation_p.G376C	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	376	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		AGGGATGTGCCGTTCCCGAGG	0.662													6	57	---	---	---	---	capture	Missense_Mutation	SNP	50462137	50462137	SIGLEC11	19	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	14200	199
KLK15	55554	broad.mit.edu	37	19	51329907	51329907	+	Silent	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51329907G>A	uc002ptl.2	-	4	619	c.588C>T	c.(586-588)GGC>GGT	p.G196G	KLK1_uc002ptk.1_5'Flank|KLK1_uc010ycg.1_5'Flank|KLK15_uc002ptm.2_Intron|KLK15_uc002ptn.2_Intron|KLK15_uc002pto.2_Silent_p.G195G|KLK15_uc010ych.1_RNA|KLK15_uc010yci.1_Intron|KLK15_uc010eod.2_Intron	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15 isoform 4	196	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)|breast(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		TGCCCTCCGCGCCTGCACACA	0.582													57	54	---	---	---	---	capture	Silent	SNP	51329907	51329907	KLK15	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8323	199
BRSK1	84446	broad.mit.edu	37	19	55814187	55814187	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55814187G>C	uc002qkg.2	+	10	1257	c.980G>C	c.(979-981)GGC>GCC	p.G327A	BRSK1_uc002qkf.2_Missense_Mutation_p.G343A|BRSK1_uc002qkh.2_Missense_Mutation_p.G22A	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	327	UBA.			G->A: Abolishes activation of kinase activity.	establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity	p.G327D(1)		ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GCATCACTGGGCTGCTTCAGG	0.682													28	35	---	---	---	---	capture	Missense_Mutation	SNP	55814187	55814187	BRSK1	19	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	1511	199
C2orf89	129293	broad.mit.edu	37	2	85051138	85051138	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85051138G>A	uc010ysl.1	-	6	1362	c.1273C>T	c.(1273-1275)CGG>TGG	p.R425W	C2orf89_uc002sou.3_Missense_Mutation_p.R376W	NM_001080824	NP_001074293	Q86V40	CB089_HUMAN	hypothetical protein LOC129293 precursor	425	Extracellular (Potential).					integral to membrane				ovary(1)	1						CGCTGTGACCGCCTCCGCTTC	0.652													10	21	---	---	---	---	capture	Missense_Mutation	SNP	85051138	85051138	C2orf89	2	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	2183	199
SCN9A	6335	broad.mit.edu	37	2	167055444	167055444	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167055444C>T	uc010fpl.2	-	27	6013	c.5672G>A	c.(5671-5673)CGT>CAT	p.R1891H	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1902	IQ.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	TAAGCGGTAACGTCTATAAGC	0.363													76	141	---	---	---	---	capture	Missense_Mutation	SNP	167055444	167055444	SCN9A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13818	199
PDE1A	5136	broad.mit.edu	37	2	183066517	183066517	+	Splice_Site	SNP	C	G	G			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:183066517C>G	uc002uos.2	-	10	1035	c.951_splice	c.e10-1	p.R317_splice	PDE1A_uc010zfp.1_Splice_Site_p.R213_splice|PDE1A_uc002uoq.1_Splice_Site_p.R317_splice|PDE1A_uc010zfq.1_Splice_Site_p.R317_splice|PDE1A_uc002uor.2_Splice_Site_p.R301_splice|PDE1A_uc002uou.2_Splice_Site_p.R283_splice	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			CCGAAGATCCCTGCAGAGTCA	0.289													3	145	---	---	---	---	capture	Splice_Site	SNP	183066517	183066517	PDE1A	2	C	G	G	G	1	0	0	0	0	0	0	1	0	312	24	5	4	11536	199
PASK	23178	broad.mit.edu	37	2	242054741	242054741	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242054741C>T	uc002wao.1	-	13	3252	c.3160G>A	c.(3160-3162)GCA>ACA	p.A1054T	PASK_uc010zol.1_Missense_Mutation_p.A868T|PASK_uc010zom.1_Missense_Mutation_p.A1019T|PASK_uc010fzl.1_Missense_Mutation_p.A1054T|PASK_uc010zon.1_Missense_Mutation_p.A835T|PASK_uc002wap.2_Missense_Mutation_p.A597T|PASK_uc002waq.2_Missense_Mutation_p.A1054T	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1054	Protein kinase.				regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GATAGAATTGCGATCTCTAAA	0.433													4	206	---	---	---	---	capture	Missense_Mutation	SNP	242054741	242054741	PASK	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11375	199
TM9SF4	9777	broad.mit.edu	37	20	30745712	30745712	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30745712G>A	uc002wxj.2	+	14	1680	c.1445G>A	c.(1444-1446)CGC>CAC	p.R482H	TM9SF4_uc010zts.1_Missense_Mutation_p.R389H|TM9SF4_uc002wxk.2_Missense_Mutation_p.R465H|TM9SF4_uc010gdz.2_Missense_Mutation_p.R361H	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	482						integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AACCCTGTGCGCACCAACCAG	0.587													45	134	---	---	---	---	capture	Missense_Mutation	SNP	30745712	30745712	TM9SF4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15865	199
MC3R	4159	broad.mit.edu	37	20	54824428	54824428	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54824428G>A	uc002xxb.2	+	1	641	c.529G>A	c.(529-531)GTG>ATG	p.V177M		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	214	Helical; Name=4; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			CGTCTGTGGCGTGGTGTTCAT	0.562													59	215	---	---	---	---	capture	Missense_Mutation	SNP	54824428	54824428	MC3R	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9278	199
HUNK	30811	broad.mit.edu	37	21	33370854	33370854	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:33370854G>A	uc002yph.2	+	11	1862	c.1502G>A	c.(1501-1503)CGC>CAC	p.R501H		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	501					multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						TTTGGCTGCCGCAATATTTTC	0.527													4	223	---	---	---	---	capture	Missense_Mutation	SNP	33370854	33370854	HUNK	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7383	199
OR5H6	79295	broad.mit.edu	37	3	97983628	97983628	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97983628G>C	uc003dsi.1	+	1	500	c.500G>C	c.(499-501)GGT>GCT	p.G167A		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	167	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						TCATTTATAGGTGGCCTTCTT	0.348													67	176	---	---	---	---	capture	Missense_Mutation	SNP	97983628	97983628	OR5H6	3	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	11067	199
REST	5978	broad.mit.edu	37	4	57797807	57797807	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57797807C>T	uc003hch.2	+	4	3130	c.2783C>T	c.(2782-2784)ACG>ATG	p.T928M	REST_uc003hci.2_Missense_Mutation_p.T928M|REST_uc010ihf.2_Missense_Mutation_p.T602M	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	928					cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					AACTTGAATACGCCAGAGGGT	0.413													34	71	---	---	---	---	capture	Missense_Mutation	SNP	57797807	57797807	REST	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13129	199
NDST4	64579	broad.mit.edu	37	4	115997685	115997685	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:115997685T>A	uc003ibu.2	-	2	1187	c.508A>T	c.(508-510)AAC>TAC	p.N170Y	NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	170	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GGTAAGCTGTTCTCATTGGCT	0.368													60	144	---	---	---	---	capture	Missense_Mutation	SNP	115997685	115997685	NDST4	4	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	10165	199
KLKB1	3818	broad.mit.edu	37	4	187173239	187173239	+	Missense_Mutation	SNP	C	A	A	rs61733605		TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187173239C>A	uc003iyy.2	+	11	1284	c.1213C>A	c.(1213-1215)CAG>AAG	p.Q405K	KLKB1_uc011clc.1_Missense_Mutation_p.Q203K|KLKB1_uc011cld.1_Missense_Mutation_p.Q367K	NM_000892	NP_000883	P03952	KLKB1_HUMAN	plasma kallikrein B1 precursor	405	Peptidase S1.				blood coagulation, intrinsic pathway|Factor XII activation|fibrinolysis|plasminogen activation|positive regulation of fibrinolysis	cytoplasm|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(1)	1		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		GTGGCCCTGGCAGGTGAGCCT	0.542													53	107	---	---	---	---	capture	Missense_Mutation	SNP	187173239	187173239	KLKB1	4	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	8332	199
RAB3C	115827	broad.mit.edu	37	5	57913622	57913622	+	Silent	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:57913622C>T	uc003jrp.2	+	2	274	c.177C>T	c.(175-177)TTC>TTT	p.F59F		NM_138453	NP_612462	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	59	Effector region (By similarity).				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		CATCTGCATTCGTCAGCACAG	0.383													39	93	---	---	---	---	capture	Silent	SNP	57913622	57913622	RAB3C	5	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	12828	199
SV2C	22987	broad.mit.edu	37	5	75428035	75428035	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:75428035C>A	uc003kei.1	+	2	594	c.460C>A	c.(460-462)CTT>ATT	p.L154I		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	154	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TCAGTGGGCCCTTTTCTTCGT	0.527													9	161	---	---	---	---	capture	Missense_Mutation	SNP	75428035	75428035	SV2C	5	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	15307	199
GABRA1	2554	broad.mit.edu	37	5	161324208	161324208	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161324208C>T	uc010jiw.2	+	11	1619	c.1151C>T	c.(1150-1152)CCG>CTG	p.P384L	GABRA1_uc010jix.2_Missense_Mutation_p.P384L|GABRA1_uc010jiy.2_Missense_Mutation_p.P384L|GABRA1_uc003lyx.3_Missense_Mutation_p.P384L|GABRA1_uc010jiz.2_Missense_Mutation_p.P384L|GABRA1_uc010jja.2_Missense_Mutation_p.P384L|GABRA1_uc010jjb.2_Missense_Mutation_p.P384L	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	384	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	AGGGGCGACCCGGGCTTAGCC	0.458													50	154	---	---	---	---	capture	Missense_Mutation	SNP	161324208	161324208	GABRA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6102	199
PKHD1	5314	broad.mit.edu	37	6	51910930	51910930	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51910930C>T	uc003pah.1	-	24	2740	c.2464G>A	c.(2464-2466)GAT>AAT	p.D822N	PKHD1_uc003pai.2_Missense_Mutation_p.D822N	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	822	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GTGAAGTCATCGGCATTATTC	0.443													83	175	---	---	---	---	capture	Missense_Mutation	SNP	51910930	51910930	PKHD1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11874	199
EZR	7430	broad.mit.edu	37	6	159192358	159192358	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159192358G>A	uc003qrt.3	-	8	1092	c.877C>T	c.(877-879)CGC>TGC	p.R293C	EZR_uc011efr.1_5'Flank|EZR_uc011efs.1_Missense_Mutation_p.R261C|EZR_uc003qru.3_Missense_Mutation_p.R293C	NM_003379	NP_003370	P15311	EZRI_HUMAN	ezrin	293	Interaction with SCYL3.|FERM.				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TTCCTGCGGCGCATATACAAC	0.572													4	126	---	---	---	---	capture	Missense_Mutation	SNP	159192358	159192358	EZR	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5289	199
FAM126A	84668	broad.mit.edu	37	7	22985627	22985627	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:22985627G>A	uc003svm.3	-	11	1402	c.1147C>T	c.(1147-1149)CGG>TGG	p.R383W	FAM126A_uc003svn.3_3'UTR	NM_032581	NP_115970	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	383						cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1						CCTCCTGACCGTCTGTGGTTC	0.438													138	480	---	---	---	---	capture	Missense_Mutation	SNP	22985627	22985627	FAM126A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	5383	199
AMPH	273	broad.mit.edu	37	7	38516566	38516566	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38516566G>A	uc003tgu.2	-	6	469	c.400C>T	c.(400-402)CGC>TGC	p.R134C	AMPH_uc003tgv.2_Missense_Mutation_p.R134C	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	134	BAR.				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						TTGGCGATGCGATTCTGTCAA	0.522													34	127	---	---	---	---	capture	Missense_Mutation	SNP	38516566	38516566	AMPH	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	588	199
ABCA13	154664	broad.mit.edu	37	7	48287865	48287865	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48287865G>T	uc003toq.2	+	14	1714	c.1689G>T	c.(1687-1689)TGG>TGT	p.W563C	ABCA13_uc010kyr.2_Missense_Mutation_p.W66C	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	563					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TCATTACTTGGCACAAAAATA	0.388													10	117	---	---	---	---	capture	Missense_Mutation	SNP	48287865	48287865	ABCA13	7	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	31	199
TRPV6	55503	broad.mit.edu	37	7	142572296	142572296	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142572296T>A	uc003wbx.1	-	11	1616	c.1400A>T	c.(1399-1401)TAC>TTC	p.Y467F	TRPV6_uc003wbw.1_Missense_Mutation_p.Y253F|TRPV6_uc010lou.1_Missense_Mutation_p.Y338F	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	467	Helical; (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					TCGGGCGAAGTACATGACGTT	0.577													58	196	---	---	---	---	capture	Missense_Mutation	SNP	142572296	142572296	TRPV6	7	T	A	A	A	1	0	0	0	0	1	0	0	0	741	57	4	4	16483	199
ARHGEF5	7984	broad.mit.edu	37	7	144062310	144062310	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144062310G>A	uc003wel.2	+	2	2666	c.2548G>A	c.(2548-2550)GAA>AAA	p.E850K	ARHGEF5_uc003wek.2_Missense_Mutation_p.E850K|ARHGEF5_uc003wem.2_5'Flank	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	850					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					CCCTCCCACCGAACCACCCCC	0.587													15	86	---	---	---	---	capture	Missense_Mutation	SNP	144062310	144062310	ARHGEF5	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	902	199
ZNF786	136051	broad.mit.edu	37	7	148768162	148768162	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148768162C>T	uc003wfh.2	-	4	1839	c.1702G>A	c.(1702-1704)GGG>AGG	p.G568R	ZNF786_uc011kuk.1_Missense_Mutation_p.G531R|ZNF786_uc003wfi.2_Missense_Mutation_p.G482R	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	568	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CCACACTCCCCGCACGAGAAC	0.632													15	25	---	---	---	---	capture	Missense_Mutation	SNP	148768162	148768162	ZNF786	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	18034	199
HTR5A	3361	broad.mit.edu	37	7	154875908	154875908	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:154875908G>A	uc003wlu.1	+	2	849	c.785G>A	c.(784-786)CGC>CAC	p.R262H		NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A	262	Cytoplasmic (By similarity).		R -> C (in a colorectal cancer sample; somatic mutation).			integral to plasma membrane	serotonin receptor activity	p.R262C(1)		ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		TTCACGGTCCGCCACGCCACC	0.607													5	66	---	---	---	---	capture	Missense_Mutation	SNP	154875908	154875908	HTR5A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7375	199
TEX15	56154	broad.mit.edu	37	8	30701172	30701172	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30701172G>A	uc003xil.2	-	1	5362	c.5362C>T	c.(5362-5364)CGA>TGA	p.R1788*		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1788										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTAACCTGTCGTTTGTACTTT	0.343													28	66	---	---	---	---	capture	Nonsense_Mutation	SNP	30701172	30701172	TEX15	8	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	15664	199
TRIM55	84675	broad.mit.edu	37	8	67040581	67040581	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:67040581G>T	uc003xvv.2	+	2	437	c.211G>T	c.(211-213)GCA>TCA	p.A71S	TRIM55_uc003xvu.2_Missense_Mutation_p.A71S|TRIM55_uc003xvw.2_Missense_Mutation_p.A71S|TRIM55_uc003xvx.2_Missense_Mutation_p.A71S	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1	71						cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TACCACCATGGCATCAGGGGG	0.493													7	261	---	---	---	---	capture	Missense_Mutation	SNP	67040581	67040581	TRIM55	8	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	16412	199
ZHX2	22882	broad.mit.edu	37	8	123965254	123965254	+	Missense_Mutation	SNP	A	C	C			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:123965254A>C	uc003ypk.1	+	3	2071	c.1504A>C	c.(1504-1506)ACC>CCC	p.T502P		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	502						cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CGTCCACATCACCAGCGAATC	0.572													28	63	---	---	---	---	capture	Missense_Mutation	SNP	123965254	123965254	ZHX2	8	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	17556	199
FER1L6	654463	broad.mit.edu	37	8	125110086	125110086	+	Silent	SNP	C	A	A			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:125110086C>A	uc003yqw.2	+	37	5051	c.4845C>A	c.(4843-4845)ATC>ATA	p.I1615I	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1615	C2 6.|Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			ATGAGAATATCTTCACAGGCC	0.408													45	92	---	---	---	---	capture	Silent	SNP	125110086	125110086	FER1L6	8	C	A	A	A	1	0	0	0	0	0	0	0	1	408	32	4	4	5761	199
PTPN3	5774	broad.mit.edu	37	9	112153417	112153417	+	Splice_Site	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112153417C>T	uc004bed.2	-	21	2218	c.2106_splice	c.e21+1	p.N702_splice	PTPN3_uc004beb.2_Splice_Site_p.N571_splice|PTPN3_uc004bec.2_Splice_Site_p.N526_splice|PTPN3_uc010mtu.2_Splice_Site|PTPN3_uc011lwg.1_Splice_Site_p.N657_splice|PTPN3_uc011lwh.1_Splice_Site_p.N548_splice|PTPN3_uc011lwd.1_Splice_Site_p.N170_splice|PTPN3_uc011lwe.1_Splice_Site_p.N415_splice|PTPN3_uc011lwf.1_Splice_Site_p.N370_splice	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type						negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						TCCTAACTTACGTTCACGTAA	0.358													15	27	---	---	---	---	capture	Splice_Site	SNP	112153417	112153417	PTPN3	9	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	12684	199
ARSF	416	broad.mit.edu	37	X	2994636	2994636	+	Missense_Mutation	SNP	A	C	C			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2994636A>C	uc004cre.1	+	4	430	c.209A>C	c.(208-210)CAG>CCG	p.Q70P	ARSF_uc004crf.1_Missense_Mutation_p.Q70P	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	70						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGACTGACTCAGCACATCTCT	0.483													16	11	---	---	---	---	capture	Missense_Mutation	SNP	2994636	2994636	ARSF	23	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	984	199
PHKA1	5255	broad.mit.edu	37	X	71821869	71821869	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:71821869C>T	uc004eax.3	-	28	3345	c.3044G>A	c.(3043-3045)CGT>CAT	p.R1015H	PHKA1_uc004eay.3_Intron|PHKA1_uc011mqi.1_Intron	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	1015					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					TGACAGTCTACGAAATTCCAC	0.358													13	14	---	---	---	---	capture	Missense_Mutation	SNP	71821869	71821869	PHKA1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11746	199
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Frame_Shift_Del	DEL	G	-	-	rs28934574		TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577094delG	uc002gim.2	-	8	1038	c.844delC	c.(844-846)CGGfs	p.R282fs	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Del_p.R282fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.R150fs|TP53_uc010cng.1_Frame_Shift_Del_p.R150fs|TP53_uc002gii.1_Frame_Shift_Del_p.R150fs|TP53_uc010cnh.1_Frame_Shift_Del_p.R282fs|TP53_uc010cni.1_Frame_Shift_Del_p.R282fs|TP53_uc002gij.2_Frame_Shift_Del_p.R282fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	282	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R282W(367)|p.R282G(27)|p.R282Q(20)|p.R282P(14)|p.R282R(8)|p.0?(7)|p.R282L(3)|p.D281fs*63(2)|p.?(2)|p.R282fs*24(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.R280fs*62(1)|p.R282_E287delRRTEEE(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.R282H(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R282fs*63(1)|p.C275fs*20(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGTGCGCCGGTCTCTCCCA	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			57	35	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	7577094	7577094	TP53	17	G	-	-	-	1	0	1	0	1	0	0	0	0	506	39	5	5	16264	199
MAP1B	4131	broad.mit.edu	37	5	71493036	71493036	+	Frame_Shift_Del	DEL	A	-	-			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71493036delA	uc003kbw.3	+	5	4095	c.3854delA	c.(3853-3855)GAGfs	p.E1285fs	MAP1B_uc010iyw.1_Frame_Shift_Del_p.E1302fs|MAP1B_uc010iyx.1_Frame_Shift_Del_p.E1159fs|MAP1B_uc010iyy.1_Frame_Shift_Del_p.E1159fs	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1285						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ACGCCCAATGAGATTAAAGTC	0.527													41	85	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	71493036	71493036	MAP1B	5	A	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	9142	199
RAD23B	5887	broad.mit.edu	37	9	110084381	110084383	+	In_Frame_Del	DEL	ACA	-	-			TCGA-27-2519-01	TCGA-27-2519-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:110084381_110084383delACA	uc004bde.2	+	7	1166_1168	c.799_801delACA	c.(799-801)ACAdel	p.T269del	RAD23B_uc011lwa.1_In_Frame_Del_p.T269del|RAD23B_uc011lwb.1_In_Frame_Del_p.T248del	NM_002874	NP_002865	P54727	RD23B_HUMAN	UV excision repair protein RAD23 homolog B	269	Poly-Thr.				nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|regulation of proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|nucleoplasm|proteasome complex|XPC complex	damaged DNA binding|polyubiquitin binding|single-stranded DNA binding			ovary(1)	1						AGCAACAACTACAACAACAAGTT	0.468								Direct_reversal_of_damage|NER					33	69	---	---	---	---	capture_indel	In_Frame_Del	DEL	110084381	110084383	RAD23B	9	ACA	-	-	-	1	0	1	0	1	0	0	0	0	182	14	5	5	12878	199
