Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NPHP4	261734	broad.mit.edu	37	1	5969267	5969267	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:5969267G>C	uc001alq.1	-	12	1714	c.1448C>G	c.(1447-1449)CCA>CGA	p.P483R	NPHP4_uc001als.1_RNA|NPHP4_uc009vlt.1_Intron|NPHP4_uc001alt.1_Intron	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	483					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		TACTGGCGCTGGCGGGCCTGG	0.642													3	4	---	---	---	---	capture	Missense_Mutation	SNP	5969267	5969267	NPHP4	1	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	10488	200
PRAMEF2	65122	broad.mit.edu	37	1	12918957	12918957	+	Silent	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12918957G>A	uc001aum.1	+	2	180	c.93G>A	c.(91-93)CTG>CTA	p.L31L		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	31											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGGAGGAGCTGCCCAGGGTGC	0.622													22	107	---	---	---	---	capture	Silent	SNP	12918957	12918957	PRAMEF2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	12335	200
MACF1	23499	broad.mit.edu	37	1	39753206	39753206	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39753206A>T	uc010ois.1	+	16	1977	c.1772A>T	c.(1771-1773)GAA>GTA	p.E591V	MACF1_uc001cda.1_Missense_Mutation_p.E499V	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	591					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTGTGTATGAACTACTGTCT	0.463													57	238	---	---	---	---	capture	Missense_Mutation	SNP	39753206	39753206	MACF1	1	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	9059	200
FAAH	2166	broad.mit.edu	37	1	46871972	46871972	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46871972C>T	uc001cpu.2	+	7	965	c.883C>T	c.(883-885)CGA>TGA	p.R295*	FAAH_uc001cpv.2_Intron	NM_001441	NP_001432	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	295	Cytoplasmic (By similarity).				fatty acid catabolic process	cytoplasm|cytoskeleton|endomembrane system|integral to membrane|organelle membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|fatty acid amide hydrolase activity			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	ACTGTGCCTGCGAGCCCTGCT	0.642											OREG0013458	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	87	---	---	---	---	capture	Nonsense_Mutation	SNP	46871972	46871972	FAAH	1	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	5307	200
HOOK1	51361	broad.mit.edu	37	1	60312821	60312821	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:60312821A>T	uc009wad.2	+	11	995	c.893A>T	c.(892-894)GAA>GTA	p.E298V	HOOK1_uc001czo.2_Missense_Mutation_p.E298V|HOOK1_uc001czp.2_RNA|HOOK1_uc010oor.1_Missense_Mutation_p.E256V	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	298	Potential.|Sufficient for interaction with microtubules.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					CTTGCAGAAGAAACAAGAGCC	0.348													59	76	---	---	---	---	capture	Missense_Mutation	SNP	60312821	60312821	HOOK1	1	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	7207	200
PDE4B	5142	broad.mit.edu	37	1	66831413	66831413	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:66831413C>T	uc001dcn.2	+	13	1539	c.1348C>T	c.(1348-1350)CAT>TAT	p.H450Y	PDE4B_uc009war.2_Missense_Mutation_p.H358Y|PDE4B_uc001dco.2_Missense_Mutation_p.H450Y|PDE4B_uc001dcp.2_Missense_Mutation_p.H435Y|PDE4B_uc001dcq.2_Missense_Mutation_p.H278Y|PDE4B_uc009was.2_Missense_Mutation_p.H217Y	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN	phosphodiesterase 4B isoform 1	450					signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)	TGACGTTGATCATCCTGGAGT	0.418													20	37	---	---	---	---	capture	Missense_Mutation	SNP	66831413	66831413	PDE4B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	11543	200
SLC44A3	126969	broad.mit.edu	37	1	95322914	95322914	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:95322914G>A	uc001dqv.3	+	10	1203	c.1096G>A	c.(1096-1098)GGC>AGC	p.G366S	SLC44A3_uc001dqx.3_Missense_Mutation_p.G366S|SLC44A3_uc010otq.1_Missense_Mutation_p.G298S|SLC44A3_uc010otr.1_Missense_Mutation_p.G330S|SLC44A3_uc001dqw.3_Missense_Mutation_p.G318S|SLC44A3_uc010ots.1_Missense_Mutation_p.G286S|SLC44A3_uc009wds.2_Missense_Mutation_p.G269S|SLC44A3_uc010ott.1_Missense_Mutation_p.G286S|SLC44A3_uc010otu.1_RNA	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1	366						integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TATGGAAGGCGGCCAAGTGGA	0.458													14	124	---	---	---	---	capture	Missense_Mutation	SNP	95322914	95322914	SLC44A3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14529	200
FLG2	388698	broad.mit.edu	37	1	152327770	152327770	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152327770G>T	uc001ezw.3	-	3	2565	c.2492C>A	c.(2491-2493)TCT>TAT	p.S831Y	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	831	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCAAAGCCAGAGGATTGTCC	0.517													19	584	---	---	---	---	capture	Missense_Mutation	SNP	152327770	152327770	FLG2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	5868	200
GORAB	92344	broad.mit.edu	37	1	170508571	170508571	+	Silent	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:170508571C>T	uc001gha.2	+	2	384	c.357C>T	c.(355-357)CCC>CCT	p.P119P	GORAB_uc009wvw.2_3'UTR|GORAB_uc001ggz.3_Silent_p.P119P|GORAB_uc009wvx.2_5'UTR|GORAB_uc001ghb.2_5'UTR|GORAB_uc001ghc.2_5'UTR	NM_152281	NP_689494	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting isoform a	119						Golgi apparatus|nucleus					0						TCACCTCCCCCGTTGGTGATG	0.468													22	177	---	---	---	---	capture	Silent	SNP	170508571	170508571	GORAB	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6508	200
NEK7	140609	broad.mit.edu	37	1	198262082	198262082	+	Silent	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:198262082G>A	uc001gun.3	+	8	924	c.597G>A	c.(595-597)ACG>ACA	p.T199T		NM_133494	NP_598001	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	199	Protein kinase.					cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4						CAGTTGGTACGCCTTATTACA	0.323													105	150	---	---	---	---	capture	Silent	SNP	198262082	198262082	NEK7	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10236	200
HNRNPU	3192	broad.mit.edu	37	1	245025769	245025769	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:245025769C>G	uc001iaz.1	-	3	1089	c.871G>C	c.(871-873)GAT>CAT	p.D291H	HNRNPU_uc001iax.1_5'Flank|HNRNPU_uc001iay.1_5'Flank|HNRNPU_uc001iba.1_Missense_Mutation_p.D272H|HNRNPU_uc001ibb.1_5'UTR	NM_031844	NP_114032	Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U	291	B30.2/SPRY.				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			TTACAAGTATCAAGACAAACC	0.378													15	191	---	---	---	---	capture	Missense_Mutation	SNP	245025769	245025769	HNRNPU	1	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	7198	200
C10orf18	54906	broad.mit.edu	37	10	5804609	5804609	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5804609G>A	uc001iij.2	+	20	7914	c.7289G>A	c.(7288-7290)TGG>TAG	p.W2430*	C10orf18_uc001iik.2_Nonsense_Mutation_p.W1274*	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	2430										ovary(1)|central_nervous_system(1)	2						AGTAGCTATTGGTAAGAACAC	0.343													5	310	---	---	---	---	capture	Nonsense_Mutation	SNP	5804609	5804609	C10orf18	10	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	1584	200
MYO3A	53904	broad.mit.edu	37	10	26414537	26414537	+	Missense_Mutation	SNP	G	T	T	rs141374777		TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26414537G>T	uc001isn.2	+	19	2474	c.2114G>T	c.(2113-2115)AGT>ATT	p.S705I	MYO3A_uc009xko.1_Missense_Mutation_p.S705I|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	705	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						TCATCACCAAGGTAAAAATTT	0.338													13	208	---	---	---	---	capture	Missense_Mutation	SNP	26414537	26414537	MYO3A	10	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	9986	200
MPP7	143098	broad.mit.edu	37	10	28378639	28378639	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:28378639G>A	uc001iua.1	-	14	1488	c.1084C>T	c.(1084-1086)CGA>TGA	p.R362*	MPP7_uc009xkz.1_RNA|MPP7_uc001iub.1_Nonsense_Mutation_p.R362*|MPP7_uc009xla.2_Nonsense_Mutation_p.R362*|MPP7_uc010qdv.1_RNA	NM_173496	NP_775767	Q5T2T1	MPP7_HUMAN	palmitoylated membrane protein 7	362					establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1						TTAGTTTGTCGCCGATACGGT	0.383													130	198	---	---	---	---	capture	Nonsense_Mutation	SNP	28378639	28378639	MPP7	10	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	9651	200
RUFY2	55680	broad.mit.edu	37	10	70139220	70139220	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:70139220G>T	uc001job.2	-	12	1598	c.1271C>A	c.(1270-1272)ACC>AAC	p.T424N	RUFY2_uc001jnz.1_RNA|RUFY2_uc001joa.2_5'Flank|RUFY2_uc001joc.2_Missense_Mutation_p.T355N|RUFY2_uc010qiw.1_Missense_Mutation_p.T331N|RUFY2_uc001jod.1_Missense_Mutation_p.T389N	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a	438	Potential.					nucleus	metal ion binding			ovary(1)	1						AATTTTATTGGTTTTTTCTTC	0.274													4	142	---	---	---	---	capture	Missense_Mutation	SNP	70139220	70139220	RUFY2	10	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	13631	200
ZMIZ1	57178	broad.mit.edu	37	10	81058831	81058831	+	Missense_Mutation	SNP	T	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:81058831T>G	uc001kaf.2	+	16	2263	c.1691T>G	c.(1690-1692)CTC>CGC	p.L564R	ZMIZ1_uc001kag.2_Missense_Mutation_p.L440R	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	564					transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GAGCTGCGGCTCACATTCCCT	0.647													3	40	---	---	---	---	capture	Missense_Mutation	SNP	81058831	81058831	ZMIZ1	10	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	17576	200
MAPK8IP1	9479	broad.mit.edu	37	11	45923593	45923593	+	Silent	SNP	A	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45923593A>T	uc001nbr.2	+	4	755	c.585A>T	c.(583-585)TCA>TCT	p.S195S		NM_005456	NP_005447	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting	195	JNK-binding domain (JBD).				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity			ovary(2)|breast(1)|skin(1)	4				GBM - Glioblastoma multiforme(35;0.231)		TGTCTCGATCATCCTCACCCC	0.527													16	173	---	---	---	---	capture	Silent	SNP	45923593	45923593	MAPK8IP1	11	A	T	T	T	1	0	0	0	0	0	0	0	1	93	8	4	4	9197	200
DLAT	1737	broad.mit.edu	37	11	111899615	111899615	+	Silent	SNP	G	A	A	rs148153443		TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111899615G>A	uc001pmo.2	+	4	1265	c.606G>A	c.(604-606)TCG>TCA	p.S202S	DLAT_uc009yyk.1_Silent_p.S202S|DLAT_uc010rwr.1_Intron	NM_001931	NP_001922	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase precursor	202					glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial pyruvate dehydrogenase complex	dihydrolipoyllysine-residue acetyltransferase activity|protein binding				0		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)	NADH(DB00157)	CCACTGCTTCGCCACCTACAC	0.532													5	222	---	---	---	---	capture	Silent	SNP	111899615	111899615	DLAT	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4507	200
HTR3A	3359	broad.mit.edu	37	11	113857602	113857602	+	Silent	SNP	C	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113857602C>A	uc010rxb.1	+	7	1319	c.1086C>A	c.(1084-1086)ATC>ATA	p.I362I	HTR3A_uc010rxa.1_Silent_p.I330I|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Silent_p.I309I	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	324	Cytoplasmic (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	CCGAGACCATCTTCATTGTGC	0.582													51	95	---	---	---	---	capture	Silent	SNP	113857602	113857602	HTR3A	11	C	A	A	A	1	0	0	0	0	0	0	0	1	408	32	4	4	7369	200
HTR3A	3359	broad.mit.edu	37	11	113857614	113857614	+	Silent	SNP	G	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113857614G>C	uc010rxb.1	+	7	1331	c.1098G>C	c.(1096-1098)CGG>CGC	p.R366R	HTR3A_uc010rxa.1_Silent_p.R334R|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Silent_p.R313R	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	328	Cytoplasmic (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	TCATTGTGCGGCTGGTGCACA	0.572													44	80	---	---	---	---	capture	Silent	SNP	113857614	113857614	HTR3A	11	G	C	C	C	1	0	0	0	0	0	0	0	1	535	42	4	4	7369	200
APOA5	116519	broad.mit.edu	37	11	116661604	116661604	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:116661604G>A	uc001ppr.2	-	3	349	c.341C>T	c.(340-342)GCG>GTG	p.A114V	ZNF259_uc001ppp.2_5'Flank|ZNF259_uc009yzd.2_5'Flank|ZNF259_uc001ppq.2_5'Flank|APOA5_uc009yze.2_Missense_Mutation_p.A114V|APOA5_uc009yzf.2_Missense_Mutation_p.A114V|APOA5_uc009yzg.2_Missense_Mutation_p.A140V	NM_052968	NP_443200	Q6Q788	APOA5_HUMAN	apolipoprotein AV precursor	114	Potential.				acylglycerol homeostasis|cholesterol homeostasis|lipid transport|lipoprotein metabolic process|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor-mediated endocytosis|positive regulation of triglyceride catabolic process|positive regulation of very-low-density lipoprotein particle remodeling|tissue regeneration|triglyceride catabolic process|triglyceride homeostasis	chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	enzyme binding|heparin binding|lipoprotein lipase activator activity|low-density lipoprotein particle receptor binding|phosphatidylcholine binding				0	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		CAGCTCGTGCGCCTCTGCCAT	0.662													102	60	---	---	---	---	capture	Missense_Mutation	SNP	116661604	116661604	APOA5	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	777	200
GRIP1	23426	broad.mit.edu	37	12	66786170	66786170	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66786170C>T	uc001stk.2	-	18	2467	c.2226G>A	c.(2224-2226)ATG>ATA	p.M742I	GRIP1_uc010sta.1_Missense_Mutation_p.M686I|GRIP1_uc001stj.2_Missense_Mutation_p.M524I|GRIP1_uc001stl.1_Missense_Mutation_p.M634I|GRIP1_uc001stm.2_Missense_Mutation_p.M742I	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	794					androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TGGAGGGGTACATGTCGGAGA	0.537													11	233	---	---	---	---	capture	Missense_Mutation	SNP	66786170	66786170	GRIP1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	6720	200
GOLGA3	2802	broad.mit.edu	37	12	133381337	133381337	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133381337T>A	uc001ukz.1	-	7	2121	c.1562A>T	c.(1561-1563)GAC>GTC	p.D521V	GOLGA3_uc001ula.1_Missense_Mutation_p.D521V|GOLGA3_uc001ulb.2_Missense_Mutation_p.D521V	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	521	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CCTCTGCATGTCCTCTACCTT	0.607													9	129	---	---	---	---	capture	Missense_Mutation	SNP	133381337	133381337	GOLGA3	12	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	6490	200
BRCA2	675	broad.mit.edu	37	13	32914389	32914389	+	Missense_Mutation	SNP	A	G	G	rs80358823		TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:32914389A>G	uc001uub.1	+	11	6124	c.5897A>G	c.(5896-5898)CAT>CGT	p.H1966R		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	1966					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GGGAAGCTTCATAAGTCAGTC	0.358			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			117	128	---	---	---	---	capture	Missense_Mutation	SNP	32914389	32914389	BRCA2	13	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	1487	200
SLITRK6	84189	broad.mit.edu	37	13	86370282	86370282	+	Missense_Mutation	SNP	T	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:86370282T>G	uc001vll.1	-	2	821	c.362A>C	c.(361-363)CAC>CCC	p.H121P	SLITRK6_uc010afe.1_5'Flank	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	121	Extracellular (Potential).|LRR 2.					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TAAAGAATTGTGATTGATATG	0.353													13	172	---	---	---	---	capture	Missense_Mutation	SNP	86370282	86370282	SLITRK6	13	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	14639	200
SALL2	6297	broad.mit.edu	37	14	21991030	21991030	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21991030G>T	uc001wbe.2	-	2	3114	c.2832C>A	c.(2830-2832)TTC>TTA	p.F944L	SALL2_uc010tly.1_Missense_Mutation_p.F942L|SALL2_uc010tlz.1_Missense_Mutation_p.F807L|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Missense_Mutation_p.F809L|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	944	C2H2-type 7.						DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CCTGCCTGCAGAAAACACAAG	0.597													4	128	---	---	---	---	capture	Missense_Mutation	SNP	21991030	21991030	SALL2	14	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	13703	200
ACIN1	22985	broad.mit.edu	37	14	23531439	23531439	+	Missense_Mutation	SNP	C	T	T	rs138390500	byFrequency	TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23531439C>T	uc001wit.3	-	16	3539	c.3211G>A	c.(3211-3213)GGG>AGG	p.G1071R	ACIN1_uc001wio.3_RNA|ACIN1_uc001wip.3_Missense_Mutation_p.G313R|ACIN1_uc001wiq.3_Missense_Mutation_p.G313R|ACIN1_uc001wir.3_Missense_Mutation_p.G344R|ACIN1_uc001wis.3_Missense_Mutation_p.G752R|ACIN1_uc010akg.2_Missense_Mutation_p.G1058R	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1071					apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CATTTGACCCCGTGCAGAGCT	0.552													4	226	---	---	---	---	capture	Missense_Mutation	SNP	23531439	23531439	ACIN1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	142	200
RPAP1	26015	broad.mit.edu	37	15	41819389	41819389	+	Silent	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41819389C>T	uc001zod.2	-	13	1846	c.1722G>A	c.(1720-1722)CGG>CGA	p.R574R		NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	574						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CCAGGGAATGCCGGGCCAGGC	0.612													4	117	---	---	---	---	capture	Silent	SNP	41819389	41819389	RPAP1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	13433	200
SECISBP2L	9728	broad.mit.edu	37	15	49325161	49325161	+	Splice_Site	SNP	C	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49325161C>G	uc001zxe.1	-	4	798	c.664_splice	c.e4+1	p.D222_splice	SECISBP2L_uc001zxd.1_Splice_Site_p.D222_splice|SECISBP2L_uc010bep.1_Splice_Site|SECISBP2L_uc010beq.1_Intron	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like											breast(1)|skin(1)	2						CCTTGCCTTACCAGTTTGCTG	0.393													127	215	---	---	---	---	capture	Splice_Site	SNP	49325161	49325161	SECISBP2L	15	C	G	G	G	1	0	0	0	0	0	0	1	0	234	18	5	4	13900	200
SECISBP2L	9728	broad.mit.edu	37	15	49325180	49325180	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49325180C>G	uc001zxe.1	-	4	780	c.646G>C	c.(646-648)GAT>CAT	p.D216H	SECISBP2L_uc001zxd.1_Missense_Mutation_p.D216H|SECISBP2L_uc010bep.1_5'UTR|SECISBP2L_uc010beq.1_Intron	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	216										breast(1)|skin(1)	2						TGTGAAGCATCTACCAGAAGC	0.398													120	220	---	---	---	---	capture	Missense_Mutation	SNP	49325180	49325180	SECISBP2L	15	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	13900	200
FBXO22	26263	broad.mit.edu	37	15	76225151	76225151	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:76225151A>G	uc002bbk.2	+	7	1025	c.920A>G	c.(919-921)CAG>CGG	p.Q307R	FBXO22_uc002bbl.2_Missense_Mutation_p.Q203R|FBXO22OS_uc002bbm.1_RNA	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	307					ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						GCTGCGATGCAGCGCCTCAAA	0.527													76	66	---	---	---	---	capture	Missense_Mutation	SNP	76225151	76225151	FBXO22	15	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	5680	200
TSC2	7249	broad.mit.edu	37	16	2138318	2138318	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2138318C>T	uc002con.2	+	41	5357	c.5251C>T	c.(5251-5253)CGC>TGC	p.R1751C	TSC2_uc010bsd.2_Missense_Mutation_p.R1728C|TSC2_uc002coo.2_Missense_Mutation_p.R1684C|TSC2_uc010uvv.1_Missense_Mutation_p.R1648C|TSC2_uc010uvw.1_Missense_Mutation_p.R1636C|TSC2_uc002cop.2_Missense_Mutation_p.R1507C|TSC2_uc002coq.2_Missense_Mutation_p.R526C|TSC2_uc002cor.2_Missense_Mutation_p.R452C	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	1751	Rap-GAP.		Missing (in TSC2).	RLR->QLQ: No effect.	cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				CAAGCGGCTCCGCCAGCGGGT	0.662			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				44	16	---	---	---	---	capture	Missense_Mutation	SNP	2138318	2138318	TSC2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16489	200
RRAD	6236	broad.mit.edu	37	16	66957423	66957424	+	Missense_Mutation	DNP	CA	AC	AC			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66957423_66957424CA>AC	uc002eqn.2	-	4	796_797	c.644_645TG>GT	c.(643-645)GTG>GGT	p.V215G	RRAD_uc002eqo.2_Missense_Mutation_p.V215G	NM_001128850	NP_001122322	P55042	RAD_HUMAN	Ras-related associated with diabetes	215					small GTPase mediated signal transduction	plasma membrane	calmodulin binding|GTP binding|GTPase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		ACTCACCATCCACCGAGACCTC	0.634													13	75	---	---	---	---	capture	Missense_Mutation	DNP	66957423	66957424	RRAD	16	CA	AC	AC	AC	1	0	0	0	0	1	0	0	0	262	21	4	4	13563	200
ACADVL	37	broad.mit.edu	37	17	7125285	7125285	+	Missense_Mutation	SNP	G	A	A	rs140629318		TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7125285G>A	uc002gev.2	+	8	788	c.637G>A	c.(637-639)GCT>ACT	p.A213T	DLG4_uc002get.3_5'Flank|DLG4_uc010vto.1_5'Flank|ACADVL_uc010vtp.1_Missense_Mutation_p.A223T|ACADVL_uc010vtq.1_Missense_Mutation_p.A259T|ACADVL_uc002gew.2_Missense_Mutation_p.A191T|ACADVL_uc002gex.2_Missense_Mutation_p.A137T	NM_000018	NP_000009	P49748	ACADV_HUMAN	acyl-Coenzyme A dehydrogenase, very long chain	213	Catalytic.		A -> P (in ACADVLD).		energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA dehydrogenase|negative regulation of fatty acid biosynthetic process|negative regulation of fatty acid oxidation|regulation of cholesterol metabolic process|temperature homeostasis	mitochondrial inner membrane|mitochondrial nucleoid	long-chain-acyl-CoA dehydrogenase activity			ovary(3)	3						GACTGTGGCCGCTTTCTGTCT	0.572													20	67	---	---	---	---	capture	Missense_Mutation	SNP	7125285	7125285	ACADVL	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	116	200
SLC13A2	9058	broad.mit.edu	37	17	26823547	26823547	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26823547T>C	uc002hbh.2	+	11	1617	c.1550T>C	c.(1549-1551)GTG>GCG	p.V517A	SLC13A2_uc010wam.1_Missense_Mutation_p.V473A|SLC13A2_uc010wan.1_Missense_Mutation_p.V566A|SLC13A2_uc010wao.1_Missense_Mutation_p.V474A|SLC13A2_uc002hbi.2_Missense_Mutation_p.V446A	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b	517	Helical; (Potential).					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	ATGTTGCCTGTGGCCACCCCG	0.617													10	210	---	---	---	---	capture	Missense_Mutation	SNP	26823547	26823547	SLC13A2	17	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	14285	200
MYO18A	399687	broad.mit.edu	37	17	27424842	27424842	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27424842C>T	uc002hdt.1	-	26	4224	c.4066G>A	c.(4066-4068)GCG>ACG	p.A1356T	MYO18A_uc010wbc.1_Missense_Mutation_p.A898T|MYO18A_uc002hds.2_Missense_Mutation_p.A898T|MYO18A_uc010csa.1_Missense_Mutation_p.A1356T|MYO18A_uc002hdu.1_Missense_Mutation_p.A1356T|MYO18A_uc010wbd.1_Missense_Mutation_p.A1025T	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	1356	Potential.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TTGATCTCCGCTGCCCGGATG	0.602													95	102	---	---	---	---	capture	Missense_Mutation	SNP	27424842	27424842	MYO18A	17	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	9975	200
SUZ12	23512	broad.mit.edu	37	17	30320320	30320320	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:30320320G>A	uc002hgs.2	+	11	1483	c.1261G>A	c.(1261-1263)GAA>AAA	p.E421K	SUZ12_uc002hgt.2_Missense_Mutation_p.E398K	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1	421					negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TACTCCAAATGAAAACCGACA	0.264			T	JAZF1	endometrial stromal tumours								40	48	---	---	---	---	capture	Missense_Mutation	SNP	30320320	30320320	SUZ12	17	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	15304	200
GNGT2	2793	broad.mit.edu	37	17	47284162	47284162	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47284162T>C	uc002ioo.1	-	4	474	c.167A>G	c.(166-168)GAC>GGC	p.D56G		NM_031498	NP_113686	O14610	GBGT2_HUMAN	guanine nucleotide binding protein-gamma	56					G-protein coupled receptor protein signaling pathway|phototransduction|synaptic transmission	extracellular region|heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			GGGATTCTTGTCCTCAGGGAT	0.507													19	167	---	---	---	---	capture	Missense_Mutation	SNP	47284162	47284162	GNGT2	17	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	6470	200
WIPI1	55062	broad.mit.edu	37	17	66417949	66417949	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66417949G>A	uc010dey.2	-	13	1397	c.1306C>T	c.(1306-1308)CGT>TGT	p.R436C	WIPI1_uc002jhd.3_RNA|WIPI1_uc010wqo.1_Missense_Mutation_p.R354C|WIPI1_uc002jhe.3_RNA	NM_017983	NP_060453	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting	436					macroautophagy|vesicle targeting, trans-Golgi to endosome	autophagic vacuole membrane|clathrin-coated vesicle|cytosol|endosome membrane|PAS complex|pre-autophagosomal structure membrane|trans-Golgi network	androgen receptor binding|estrogen receptor binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding				0						TGATTTCCACGGCACAAGATT	0.468													135	162	---	---	---	---	capture	Missense_Mutation	SNP	66417949	66417949	WIPI1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17251	200
CLUL1	27098	broad.mit.edu	37	18	633305	633305	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:633305C>A	uc002kkp.2	+	6	1009	c.864C>A	c.(862-864)GAC>GAA	p.D288E	CLUL1_uc010wys.1_Missense_Mutation_p.D340E|CLUL1_uc002kkq.2_Missense_Mutation_p.D288E	NM_014410	NP_055225	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal) precursor	288					cell death	extracellular region				ovary(2)	2						TAGCTCCTGACCACGGAGGCC	0.428													6	83	---	---	---	---	capture	Missense_Mutation	SNP	633305	633305	CLUL1	18	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	3535	200
TCEB3C	162699	broad.mit.edu	37	18	44554624	44554624	+	Silent	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44554624C>T	uc010xdb.1	-	1	1826	c.1590G>A	c.(1588-1590)CCG>CCA	p.P530P	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	530					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0						TGGCCATCAGCGGGGCCACTT	0.368													11	395	---	---	---	---	capture	Silent	SNP	44554624	44554624	TCEB3C	18	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15570	200
SLC39A3	29985	broad.mit.edu	37	19	2733097	2733097	+	Silent	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2733097G>A	uc002lwg.2	-	3	851	c.597C>T	c.(595-597)AGC>AGT	p.S199S	SLC39A3_uc010xgy.1_Silent_p.S199S	NM_144564	NP_653165	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter),	199	Helical; (Potential).					integral to membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACGAACAGGCTCACCACTT	0.716													10	72	---	---	---	---	capture	Silent	SNP	2733097	2733097	SLC39A3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	14511	200
OR2Z1	284383	broad.mit.edu	37	19	8841547	8841547	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8841547T>C	uc010xkg.1	+	1	157	c.157T>C	c.(157-159)TCC>CCC	p.S53P		NM_001004699	NP_001004699	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z,	53	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2						CCGTGTGGACTCCCGGCTCCA	0.542													114	89	---	---	---	---	capture	Missense_Mutation	SNP	8841547	8841547	OR2Z1	19	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10940	200
ZNF844	284391	broad.mit.edu	37	19	12187394	12187394	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12187394T>C	uc002mtb.2	+	4	1602	c.1459T>C	c.(1459-1461)TTT>CTT	p.F487L	ZNF844_uc010dym.1_Missense_Mutation_p.F330L	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844	487					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCCTTCATTTTTTCCACTTCC	0.448													4	148	---	---	---	---	capture	Missense_Mutation	SNP	12187394	12187394	ZNF844	19	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	18066	200
GPR4	2828	broad.mit.edu	37	19	46094298	46094298	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46094298C>T	uc002pcm.2	-	2	1772	c.827G>A	c.(826-828)AGC>AAC	p.S276N	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	276	Helical; Name=7; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		ACAGTTGAGGCTGGTGAAAGC	0.647													5	36	---	---	---	---	capture	Missense_Mutation	SNP	46094298	46094298	GPR4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	6628	200
ATP6V1C2	245973	broad.mit.edu	37	2	10912727	10912727	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:10912727G>A	uc002ras.2	+	8	738	c.629G>A	c.(628-630)CGA>CAA	p.R210Q	ATP6V1C2_uc002rat.2_Missense_Mutation_p.R210Q	NM_001039362	NP_001034451	Q8NEY4	VATC2_HUMAN	vacuolar H+ ATPase C2 isoform a	210					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		GTGGTCCCTCGATCAACCAAG	0.507													25	424	---	---	---	---	capture	Missense_Mutation	SNP	10912727	10912727	ATP6V1C2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1172	200
TET3	200424	broad.mit.edu	37	2	74328397	74328397	+	Silent	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74328397C>T	uc002skb.3	+	9	4077	c.4077C>T	c.(4075-4077)CCC>CCT	p.P1359P		NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	1359							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GGCTGTTCCCCGGTGAGGGGC	0.657													12	15	---	---	---	---	capture	Silent	SNP	74328397	74328397	TET3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15656	200
RANBP2	5903	broad.mit.edu	37	2	109388156	109388156	+	Splice_Site	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109388156G>A	uc002tem.3	+	21	7976	c.7850_splice	c.e21-1	p.A2617_splice		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						TGGTGTTACAGCAAAAGAGAA	0.348													4	285	---	---	---	---	capture	Splice_Site	SNP	109388156	109388156	RANBP2	2	G	A	A	A	1	0	0	0	0	0	0	1	0	442	34	5	2	12923	200
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma 								50	97	---	---	---	---	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	200
SCLY	51540	broad.mit.edu	37	2	239002554	239002554	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:239002554A>T	uc010fyv.2	+	9	1038	c.974A>T	c.(973-975)GAC>GTC	p.D325V	SCLY_uc002vxm.3_Missense_Mutation_p.D292V|SCLY_uc002vxn.2_3'UTR|SCLY_uc010znq.1_Missense_Mutation_p.D119V|SCLY_uc010znr.1_Missense_Mutation_p.D231V|SCLY_uc002vxp.3_5'Flank	NM_016510	NP_057594	Q96I15	SCLY_HUMAN	selenocysteine lyase	325					cellular amino acid metabolic process	cytosol	pyridoxal phosphate binding|selenocysteine lyase activity|transferase activity			ovary(2)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		CACATGAGGGACGTCCGCGAC	0.622													14	20	---	---	---	---	capture	Missense_Mutation	SNP	239002554	239002554	SCLY	2	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	13800	200
SPTLC3	55304	broad.mit.edu	37	20	13052999	13052999	+	Silent	SNP	C	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13052999C>G	uc002wod.1	+	3	688	c.399C>G	c.(397-399)GCC>GCG	p.A133A		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	133					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	TCTGCAGTGCCCCAGGGCCTC	0.438													79	250	---	---	---	---	capture	Silent	SNP	13052999	13052999	SPTLC3	20	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	15017	200
ZNF831	128611	broad.mit.edu	37	20	57829379	57829379	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:57829379G>A	uc002yan.2	+	5	4615	c.4615G>A	c.(4615-4617)GCA>ACA	p.A1539T		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1539						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					AGAGGGCAGAGCACAGACCCT	0.498													5	111	---	---	---	---	capture	Missense_Mutation	SNP	57829379	57829379	ZNF831	20	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	18061	200
STAB1	23166	broad.mit.edu	37	3	52536060	52536060	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52536060G>A	uc003dej.2	+	4	444	c.370G>A	c.(370-372)GGG>AGG	p.G124R	STAB1_uc003dei.1_Missense_Mutation_p.G124R	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	124	EGF-like 1.|Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CAATGGCCACGGGACCTGCTT	0.637													29	40	---	---	---	---	capture	Missense_Mutation	SNP	52536060	52536060	STAB1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15127	200
MINA	84864	broad.mit.edu	37	3	97664110	97664110	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97664110T>C	uc003drz.1	-	10	1822	c.1316A>G	c.(1315-1317)AAG>AGG	p.K439R	MINA_uc003dry.1_Missense_Mutation_p.K110R|MINA_uc003dsa.1_Missense_Mutation_p.K438R|MINA_uc003dsb.1_Missense_Mutation_p.K439R|MINA_uc003dsc.1_Missense_Mutation_p.K438R	NM_001042533	NP_001035998	Q8IUF8	MINA_HUMAN	MYC induced nuclear antigen isoform a	439					ribosome biogenesis	cytoplasm|nucleolus				ovary(1)	1						TTTCAGGTCCTTGACAGAAAT	0.383													25	217	---	---	---	---	capture	Missense_Mutation	SNP	97664110	97664110	MINA	3	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	9498	200
EAF2	55840	broad.mit.edu	37	3	121554141	121554141	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121554141C>A	uc003een.2	+	1	108	c.9C>A	c.(7-9)AGC>AGA	p.S3R	IQCB1_uc010hre.1_5'Flank|IQCB1_uc003eek.2_5'Flank|IQCB1_uc010hrf.1_5'Flank|EAF2_uc003eem.2_RNA|EAF2_uc003eeo.2_5'UTR	NM_018456	NP_060926	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	3					apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding				0				GBM - Glioblastoma multiforme(114;0.0972)		TTATGAATAGCGCAGCGGGAT	0.572													5	62	---	---	---	---	capture	Missense_Mutation	SNP	121554141	121554141	EAF2	3	C	A	A	A	1	0	0	0	0	1	0	0	0	350	27	4	4	4831	200
CLSTN2	64084	broad.mit.edu	37	3	140281698	140281698	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:140281698G>A	uc003etn.2	+	14	2448	c.2258G>A	c.(2257-2259)CGC>CAC	p.R753H		NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	753	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						CATCACATCCGCTACCGCAAC	0.552										HNSCC(16;0.037)			11	63	---	---	---	---	capture	Missense_Mutation	SNP	140281698	140281698	CLSTN2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3527	200
LRRIQ4	344657	broad.mit.edu	37	3	169555374	169555374	+	Silent	SNP	A	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169555374A>G	uc003fgb.2	+	5	1638	c.1638A>G	c.(1636-1638)GGA>GGG	p.G546G		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	546											0						ATAAGAAAGGAAAGAAGGATG	0.363													10	13	---	---	---	---	capture	Silent	SNP	169555374	169555374	LRRIQ4	3	A	G	G	G	1	0	0	0	0	0	0	0	1	106	9	3	3	8946	200
SLC7A14	57709	broad.mit.edu	37	3	170219101	170219101	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:170219101G>A	uc003fgz.2	-	3	654	c.338C>T	c.(337-339)CCC>CTC	p.P113L	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	113						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TGTGGTCTTGGGGACTCGAAC	0.507													5	61	---	---	---	---	capture	Missense_Mutation	SNP	170219101	170219101	SLC7A14	3	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	14588	200
CSF2	1437	broad.mit.edu	37	5	131409784	131409784	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131409784T>C	uc003kwf.2	+	2	202	c.170T>C	c.(169-171)GTA>GCA	p.V57A		NM_000758	NP_000749	P04141	CSF2_HUMAN	colony stimulating factor 2 precursor	57					immune response|negative regulation of cytolysis|positive regulation of DNA replication|positive regulation of interleukin-23 production|positive regulation of macrophage derived foam cell differentiation|positive regulation of podosome assembly|positive regulation of tyrosine phosphorylation of Stat5 protein	extracellular space	cytokine activity|granulocyte macrophage colony-stimulating factor receptor binding|growth factor activity				0		all_cancers(142;4.28e-07)|all_lung(232;2.81e-05)|Lung NSC(810;0.000693)|Lung SC(612;0.122)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Sargramostim(DB00020)	AATGAAACAGTAGAAGTCATC	0.517													5	82	---	---	---	---	capture	Missense_Mutation	SNP	131409784	131409784	CSF2	5	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	3898	200
PDE6A	5145	broad.mit.edu	37	5	149323959	149323959	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149323959C>T	uc003lrg.3	-	1	398	c.278G>A	c.(277-279)CGC>CAC	p.R93H		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	93	GAF 1.				cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CAGGCTCATGCGGTCTGCCTG	0.522													4	114	---	---	---	---	capture	Missense_Mutation	SNP	149323959	149323959	PDE6A	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11548	200
SOX30	11063	broad.mit.edu	37	5	157065654	157065654	+	Silent	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:157065654G>A	uc003lxb.1	-	4	1806	c.1464C>T	c.(1462-1464)AGC>AGT	p.S488S	SOX30_uc003lxc.1_Intron|SOX30_uc011dds.1_Silent_p.S183S	NM_178424	NP_848511	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30 isoform a	488					regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)|central_nervous_system(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CACTGGAGACGCTGGGCTGGA	0.532													50	14	---	---	---	---	capture	Silent	SNP	157065654	157065654	SOX30	5	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	14844	200
FARS2	10667	broad.mit.edu	37	6	5613545	5613545	+	Silent	SNP	A	T	T	rs147628137		TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:5613545A>T	uc010jnv.1	+	6	1545	c.1209A>T	c.(1207-1209)GTA>GTT	p.V403V	FARS2_uc003mwr.2_Silent_p.V403V	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor	403	FDX-ACB.				phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	ACAAGTTTGTACATCCAAAGT	0.393													15	146	---	---	---	---	capture	Silent	SNP	5613545	5613545	FARS2	6	A	T	T	T	1	0	0	0	0	0	0	0	1	171	14	4	4	5624	200
MDC1	9656	broad.mit.edu	37	6	30680501	30680501	+	Silent	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30680501G>A	uc003nrg.3	-	5	1658	c.1218C>T	c.(1216-1218)GAC>GAT	p.D406D	MDC1_uc003nrf.3_Silent_p.D60D|MDC1_uc011dmp.1_Silent_p.D278D|MDC1_uc003nrh.1_Silent_p.D278D|MDC1_uc003nri.2_Silent_p.D406D	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	406	Required for nuclear localization (NLS1).				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						CTTCTTCCTCGTCATCTGTAT	0.522								Other_conserved_DNA_damage_response_genes					11	118	---	---	---	---	capture	Silent	SNP	30680501	30680501	MDC1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9316	200
LTA	4049	broad.mit.edu	37	6	31540609	31540609	+	Silent	SNP	T	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31540609T>C	uc011dnu.1	+	2	303	c.90T>C	c.(88-90)CCT>CCC	p.P30P	LTA_uc003nue.1_Silent_p.P30P|LTA_uc003nuf.2_5'Flank|LTA_uc003nuh.2_5'Flank|LTA_uc003nug.2_5'Flank|LTA_uc010jsr.2_5'Flank|TNF_uc003nui.2_5'Flank	NM_001159740	NP_001153212	P01374	TNFB_HUMAN	lymphotoxin alpha precursor	30					cell-cell signaling|induction of apoptosis|signal transduction	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0					Etanercept(DB00005)	TTCTGCTGCCTGGGGCCCAGG	0.632													4	90	---	---	---	---	capture	Silent	SNP	31540609	31540609	LTA	6	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	8983	200
GRM4	2914	broad.mit.edu	37	6	34003985	34003985	+	Silent	SNP	G	A	A			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34003985G>A	uc003oir.3	-	8	2072	c.1902C>T	c.(1900-1902)TTC>TTT	p.F634F	GRM4_uc011dsn.1_Silent_p.F587F|GRM4_uc010jvh.2_Silent_p.F634F|GRM4_uc010jvi.2_Silent_p.F326F|GRM4_uc003oio.2_Silent_p.F326F|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Silent_p.F494F|GRM4_uc003oiq.2_Silent_p.F501F|GRM4_uc011dsm.1_Silent_p.F465F	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	634	Helical; Name=2; (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	CATAGCACAGGAAGATGCCTG	0.592													23	39	---	---	---	---	capture	Silent	SNP	34003985	34003985	GRM4	6	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	6732	200
LAMA2	3908	broad.mit.edu	37	6	129663557	129663557	+	Nonsense_Mutation	SNP	G	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:129663557G>T	uc003qbn.2	+	30	4486	c.4381G>T	c.(4381-4383)GGA>TGA	p.G1461*	LAMA2_uc003qbo.2_Nonsense_Mutation_p.G1461*	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1461	Laminin EGF-like 15.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AATTGTCAAGGGATTGCCAAA	0.403													23	195	---	---	---	---	capture	Nonsense_Mutation	SNP	129663557	129663557	LAMA2	6	G	T	T	T	1	0	0	0	0	0	1	0	0	559	43	5	4	8526	200
HIVEP2	3097	broad.mit.edu	37	6	143093267	143093267	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:143093267T>C	uc003qjd.2	-	5	3352	c.2609A>G	c.(2608-2610)CAG>CGG	p.Q870R		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	870					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GGACTGCTGCTGCACCTGCTG	0.557													47	54	---	---	---	---	capture	Missense_Mutation	SNP	143093267	143093267	HIVEP2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	7112	200
ARID1B	57492	broad.mit.edu	37	6	157488293	157488293	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:157488293C>T	uc003qqn.2	+	9	2938	c.2786C>T	c.(2785-2787)GCG>GTG	p.A929V	ARID1B_uc003qqo.2_Missense_Mutation_p.A942V|ARID1B_uc003qqp.2_Missense_Mutation_p.A929V|ARID1B_uc010kjl.2_Missense_Mutation_p.A127V	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	987					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TACAGCATGGCGCCCGCCATG	0.597													4	146	---	---	---	---	capture	Missense_Mutation	SNP	157488293	157488293	ARID1B	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	907	200
ITGB8	3696	broad.mit.edu	37	7	20420296	20420296	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20420296A>G	uc003suu.2	+	5	1348	c.643A>G	c.(643-645)AAT>GAT	p.N215D	ITGB8_uc011jyh.1_Missense_Mutation_p.N80D|ITGB8_uc003sut.2_Missense_Mutation_p.N215D	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	215	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						CAGTGACTACAATTTAGACTG	0.388													66	110	---	---	---	---	capture	Missense_Mutation	SNP	20420296	20420296	ITGB8	7	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	7824	200
MTERF	7978	broad.mit.edu	37	7	91503603	91503603	+	Missense_Mutation	SNP	G	A	A	rs148973867		TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:91503603G>A	uc003ulb.1	-	2	549	c.505C>T	c.(505-507)CGG>TGG	p.R169W	MTERF_uc010let.1_Intron|MTERF_uc003ulc.1_Missense_Mutation_p.R169W|MTERF_uc011khm.1_Missense_Mutation_p.R149W|MTERF_uc010leu.1_Missense_Mutation_p.R149W	NM_006980	NP_008911	Q99551	MTERF_HUMAN	mitochondrial transcription termination factor	169	Interaction with DNA.			R->A: Strongly reduces affinity for DNA. Strongly reduces transcription termination.	DNA geometric change|regulation of transcription, DNA-dependent|termination of mitochondrial transcription	mitochondrial nucleoid	double-stranded DNA binding				0	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			TTATTGGACCGAAAAAAGGAT	0.398													5	240	---	---	---	---	capture	Missense_Mutation	SNP	91503603	91503603	MTERF	7	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	9828	200
ORC5L	5001	broad.mit.edu	37	7	103835638	103835638	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103835638G>T	uc003vcb.2	-	5	617	c.506C>A	c.(505-507)ACT>AAT	p.T169N	ORC5L_uc011klp.1_Missense_Mutation_p.T37N|ORC5L_uc003vcc.2_Missense_Mutation_p.T169N|ORC5L_uc003vcd.2_Missense_Mutation_p.T169N	NM_002553	NP_002544	O43913	ORC5_HUMAN	origin recognition complex subunit 5 isoform 1	169					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding				0						AAAGCATCCAGTATTTGGACG	0.343													51	111	---	---	---	---	capture	Missense_Mutation	SNP	103835638	103835638	ORC5L	7	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	11169	200
STAR	6770	broad.mit.edu	37	8	38005844	38005844	+	Silent	SNP	A	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:38005844A>G	uc003xkv.1	-	3	444	c.180T>C	c.(178-180)GGT>GGC	p.G60G	STAR_uc010lwc.1_Silent_p.G22G	NM_001007243	NP_001007244	P49675	STAR_HUMAN	steroidogenic acute regulatory protein isoform	60					C21-steroid hormone biosynthetic process	mitochondrial intermembrane space	cholesterol transporter activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		CTAGCCGAGAACCTGGATACA	0.577													12	21	---	---	---	---	capture	Silent	SNP	38005844	38005844	STAR	8	A	G	G	G	1	0	0	0	0	0	0	0	1	15	2	3	3	15144	200
GDF6	392255	broad.mit.edu	37	8	97157751	97157751	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:97157751G>C	uc003yhp.2	-	2	508	c.408C>G	c.(406-408)GAC>GAG	p.D136E		NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN	growth differentiation factor 6 precursor	136					activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(1)|breast(1)|pancreas(1)	3	Breast(36;2.67e-05)					GCGAGAGATCGTCTGCGAGAT	0.557													6	31	---	---	---	---	capture	Missense_Mutation	SNP	97157751	97157751	GDF6	8	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	6257	200
IFNW1	3467	broad.mit.edu	37	9	21141019	21141019	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21141019C>G	uc003zol.1	-	1	1126	c.551G>C	c.(550-552)AGA>ACA	p.R184T		NM_002177	NP_002168	P05000	IFNW1_HUMAN	interferon, omega 1 precursor	184					cell cycle arrest|defense response|response to virus	extracellular space	cytokine activity|cytokine receptor binding				0				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		ACTTCTCAGTCTTTCTTGCAT	0.383													37	27	---	---	---	---	capture	Missense_Mutation	SNP	21141019	21141019	IFNW1	9	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	7477	200
IFNW1	3467	broad.mit.edu	37	9	21141108	21141108	+	Silent	SNP	C	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21141108C>G	uc003zol.1	-	1	1037	c.462G>C	c.(460-462)CTG>CTC	p.L154L		NM_002177	NP_002168	P05000	IFNW1_HUMAN	interferon, omega 1 precursor	154					cell cycle arrest|defense response|response to virus	extracellular space	cytokine activity|cytokine receptor binding				0				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TCTTCTCTTTCAGGTAGACAC	0.473													39	18	---	---	---	---	capture	Silent	SNP	21141108	21141108	IFNW1	9	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	7477	200
TMEM2	23670	broad.mit.edu	37	9	74324239	74324239	+	Missense_Mutation	SNP	C	T	T	rs147272925	byFrequency;by1000genomes	TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:74324239C>T	uc011lsa.1	-	17	3461	c.2921G>A	c.(2920-2922)CGC>CAC	p.R974H	TMEM2_uc010mos.2_Missense_Mutation_p.R911H|TMEM2_uc011lsb.1_RNA	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	974						integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GCTTGGATGGCGGATCAGGTA	0.448													61	35	---	---	---	---	capture	Missense_Mutation	SNP	74324239	74324239	TMEM2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16004	200
ZNF618	114991	broad.mit.edu	37	9	116811982	116811982	+	Silent	SNP	G	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116811982G>T	uc004bid.2	+	15	2499	c.2400G>T	c.(2398-2400)CCG>CCT	p.P800P	ZNF618_uc004bic.2_Silent_p.P707P|ZNF618_uc011lxi.1_Silent_p.P767P|ZNF618_uc011lxj.1_Silent_p.P768P|ZNF618_uc010mvb.2_Silent_p.P390P	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	800					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGGTGCACCCGGCCCACAAGG	0.612													7	75	---	---	---	---	capture	Silent	SNP	116811982	116811982	ZNF618	9	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	17920	200
DEC1	50514	broad.mit.edu	37	9	118162691	118162691	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:118162691C>G	uc004bjk.1	+	6	586	c.67C>G	c.(67-69)CTT>GTT	p.L23V	DEC1_uc004bjl.1_Intron	NM_017418	NP_059114	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1	23					negative regulation of cell proliferation					ovary(1)	1						tgagggccttcttgccgtgtt	0.000													10	90	---	---	---	---	capture	Missense_Mutation	SNP	118162691	118162691	DEC1	9	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	4339	200
ASTN2	23245	broad.mit.edu	37	9	119204775	119204775	+	Silent	SNP	G	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:119204775G>T	uc004bjs.1	-	21	3656	c.3555C>A	c.(3553-3555)ACC>ACA	p.T1185T	ASTN2_uc004bjr.1_Silent_p.T1181T|ASTN2_uc004bjt.1_Silent_p.T1134T|ASTN2_uc004bjp.1_Silent_p.T278T|ASTN2_uc004bjq.1_Silent_p.T237T|ASTN2_uc011lxr.1_Silent_p.T237T|ASTN2_uc011lxs.1_Silent_p.T237T|ASTN2_uc011lxt.1_Silent_p.T237T|ASTN2_uc004bjo.1_5'UTR	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	1185	Extracellular (Potential).|Fibronectin type-III.					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CCGTCCTCAGGGTCACCGTGC	0.512													75	43	---	---	---	---	capture	Silent	SNP	119204775	119204775	ASTN2	9	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	1056	200
GLT6D1	360203	broad.mit.edu	37	9	138517954	138517954	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138517954C>T	uc010nbd.1	-	4	472	c.218G>A	c.(217-219)CGG>CAG	p.R73Q		NM_182974	NP_892019	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1	73	Lumenal (Potential).				carbohydrate metabolic process	integral to membrane	transferase activity, transferring hexosyl groups			ovary(1)	1		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		AGTGATATTCCGCCTTCTGTA	0.498													6	70	---	---	---	---	capture	Missense_Mutation	SNP	138517954	138517954	GLT6D1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6404	200
MAGEB16	139604	broad.mit.edu	37	X	35820799	35820799	+	Silent	SNP	A	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35820799A>G	uc010ngt.1	+	2	765	c.486A>G	c.(484-486)CTA>CTG	p.L162L		NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	162	MAGE.									lung(3)|ovary(2)|breast(1)|skin(1)	7						CTGAGCACCTAGAGATGATAT	0.468													78	6	---	---	---	---	capture	Silent	SNP	35820799	35820799	MAGEB16	23	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	9088	200
WDR13	64743	broad.mit.edu	37	X	48458765	48458765	+	Silent	SNP	C	T	T			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48458765C>T	uc004dkh.1	+	6	729	c.582C>T	c.(580-582)GAC>GAT	p.D194D	WDR13_uc010nif.1_Silent_p.D72D|WDR13_uc004dki.1_Silent_p.D102D|WDR13_uc004dkj.1_Silent_p.D194D|WDR13_uc004dkk.1_Silent_p.D102D|WDR13_uc004dkl.3_Silent_p.D102D|WDR13_uc011mme.1_Silent_p.D72D	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13 protein	194	WD 1.					cytoplasm|nucleus				ovary(2)	2						GCTCACTCGACGGCAGCATCT	0.632													37	6	---	---	---	---	capture	Silent	SNP	48458765	48458765	WDR13	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17156	200
ATRX	546	broad.mit.edu	37	X	76875916	76875916	+	Nonsense_Mutation	SNP	G	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76875916G>C	uc004ecp.3	-	20	5451	c.5219C>G	c.(5218-5220)TCA>TGA	p.S1740*	ATRX_uc004ecq.3_Nonsense_Mutation_p.S1702*|ATRX_uc004eco.3_Nonsense_Mutation_p.S1525*	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1740	Helicase ATP-binding.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	CCTCCTCCTTGATCGTATAGA	0.333			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						60	9	---	---	---	---	capture	Nonsense_Mutation	SNP	76875916	76875916	ATRX	23	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	1199	200
TP53	7157	broad.mit.edu	37	17	7577149	7577149	+	Frame_Shift_Del	DEL	A	-	-			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577149delA	uc002gim.2	-	8	983	c.789delT	c.(787-789)AATfs	p.N263fs	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Del_p.N263fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.N131fs|TP53_uc010cng.1_Frame_Shift_Del_p.N131fs|TP53_uc002gii.1_Frame_Shift_Del_p.N131fs|TP53_uc010cnh.1_Frame_Shift_Del_p.N263fs|TP53_uc010cni.1_Frame_Shift_Del_p.N263fs|TP53_uc002gij.2_Frame_Shift_Del_p.N263fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	263	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		GN -> PD (in a sporadic cancer; somatic mutation).|N -> S (in a sporadic cancer; somatic mutation).|N -> K (in a sporadic cancer; somatic mutation).|N -> D (in sporadic cancers; somatic mutation).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.N263fs*82(3)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.N263D(2)|p.N263I(2)|p.G262_S269delGNLLGRNS(2)|p.N263H(2)|p.E258fs*71(1)|p.S261_L264>R(1)|p.N263fs*84(1)|p.N263K(1)|p.G262fs*2(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTCCCAGTAGATTACCACTAC	0.517		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			52	3	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	7577149	7577149	TP53	17	A	-	-	-	1	0	1	0	1	0	0	0	0	154	12	5	5	16264	200
CIC	23152	broad.mit.edu	37	19	42795881	42795881	+	Frame_Shift_Del	DEL	C	-	-			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42795881delC	uc002otf.1	+	11	2910	c.2870delC	c.(2869-2871)GCCfs	p.A957fs		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	957	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				CAGAATGGTGCCCAGCCCCCC	0.602			T	DUX4	soft tissue sarcoma								17	68	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	42795881	42795881	CIC	19	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	3389	200
GRLF1	2909	broad.mit.edu	37	19	47503900	47503901	+	Frame_Shift_Ins	INS	-	C	C			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47503900_47503901insC	uc010ekv.2	+	6	4455_4456	c.4455_4456insC	c.(4453-4458)ATGCAGfs	p.M1485fs		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	1485_1486	Pro-rich.				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		AGTCCCCAATGCAGCCACTGCT	0.649													4	7	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	47503900	47503901	GRLF1	19	-	C	C	C	1	0	1	1	0	0	0	0	0	598	46	5	5	6728	200
ZNF71	58491	broad.mit.edu	37	19	57132720	57132721	+	Frame_Shift_Ins	INS	-	G	G			TCGA-27-2521-01	TCGA-27-2521-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57132720_57132721insG	uc002qnm.3	+	3	303_304	c.65_66insG	c.(64-66)ACGfs	p.T22fs		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	22						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		GGGGAGGCCACGGGGGGACCCA	0.554													50	11	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	57132720	57132721	ZNF71	19	-	G	G	G	1	0	1	1	0	0	0	0	0	247	19	5	5	17990	200
