Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
C8B	732	broad.mit.edu	37	1	57406638	57406638	+	Nonsense_Mutation	SNP	G	A	A	rs41286844	byFrequency	TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57406638G>A	uc001cyp.2	-	9	1349	c.1282C>T	c.(1282-1284)CGA>TGA	p.R428*	C8B_uc010oon.1_Nonsense_Mutation_p.R366*|C8B_uc010ooo.1_Nonsense_Mutation_p.R376*	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	428	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						GCCCCTCCTCGTACCAGGACC	0.587													34	28	---	---	---	---	capture	Nonsense_Mutation	SNP	57406638	57406638	C8B	1	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	2394	201
HRNR	388697	broad.mit.edu	37	1	152187663	152187663	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152187663G>A	uc001ezt.1	-	3	6518	c.6442C>T	c.(6442-6444)CGA>TGA	p.R2148*		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2148					keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATCCGTGTCGTTCACCCCTA	0.587													29	666	---	---	---	---	capture	Nonsense_Mutation	SNP	152187663	152187663	HRNR	1	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	7284	201
MEF2D	4209	broad.mit.edu	37	1	156446904	156446904	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156446904G>A	uc001fpc.2	-	7	1145	c.755C>T	c.(754-756)CCG>CTG	p.P252L	MEF2D_uc001fpb.2_Missense_Mutation_p.P252L|MEF2D_uc001fpd.2_Missense_Mutation_p.P252L|MEF2D_uc001fpe.1_Missense_Mutation_p.P252L|MEF2D_uc009wsa.2_RNA	NM_005920	NP_005911	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	252	Poly-Pro.				apoptosis|muscle organ development|nervous system development|positive regulation of transcription from RNA polymerase II promoter	nucleus	activating transcription factor binding|histone deacetylase binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGGTGGGGGTGGAGACTTGGC	0.607													3	89	---	---	---	---	capture	Missense_Mutation	SNP	156446904	156446904	MEF2D	1	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	9371	201
FCER1A	2205	broad.mit.edu	37	1	159275846	159275846	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159275846G>A	uc001ftq.2	+	5	499	c.400G>A	c.(400-402)GGT>AGT	p.G134S		NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor	134	Ig-like 2.|Extracellular (Potential).					integral to plasma membrane				lung(2)|skin(2)|prostate(1)	5	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	CAGGTGCCATGGTTGGAGGAA	0.468													49	67	---	---	---	---	capture	Missense_Mutation	SNP	159275846	159275846	FCER1A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	5720	201
DUSP27	92235	broad.mit.edu	37	1	167097485	167097485	+	Silent	SNP	C	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167097485C>A	uc001geb.1	+	5	3117	c.3117C>A	c.(3115-3117)CCC>CCA	p.P1039P		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1039					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						GCCCAGAGCCCTACTTCTTCC	0.587													30	53	---	---	---	---	capture	Silent	SNP	167097485	167097485	DUSP27	1	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	4779	201
HMCN1	83872	broad.mit.edu	37	1	185878633	185878633	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185878633T>A	uc001grq.1	+	5	1015	c.786T>A	c.(784-786)AAT>AAA	p.N262K		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	262					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAATTCGCAATCCTTTAGGTG	0.363													42	56	---	---	---	---	capture	Missense_Mutation	SNP	185878633	185878633	HMCN1	1	T	A	A	A	1	0	0	0	0	1	0	0	0	647	50	4	4	7145	201
LAMB3	3914	broad.mit.edu	37	1	209790792	209790792	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209790792G>A	uc001hhg.2	-	20	3581	c.3191C>T	c.(3190-3192)GCG>GTG	p.A1064V	LAMB3_uc009xco.2_Missense_Mutation_p.A1064V|LAMB3_uc001hhh.2_Missense_Mutation_p.A1064V	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	1064	Domain I.|Potential.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GGCACCTTCCGCAAGCTGCTG	0.627													4	126	---	---	---	---	capture	Missense_Mutation	SNP	209790792	209790792	LAMB3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8532	201
LAMB3	3914	broad.mit.edu	37	1	209801465	209801465	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209801465G>C	uc001hhg.2	-	10	1593	c.1203C>G	c.(1201-1203)TGC>TGG	p.C401W	LAMB3_uc009xco.2_Missense_Mutation_p.C401W|LAMB3_uc001hhh.2_Missense_Mutation_p.C401W|LAMB3_uc010psl.1_RNA	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	401	Laminin EGF-like 3.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CATGCTCCTTGCACACACACT	0.642											OREG0014217	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	9	---	---	---	---	capture	Missense_Mutation	SNP	209801465	209801465	LAMB3	1	G	C	C	C	1	0	0	0	0	1	0	0	0	594	46	4	4	8532	201
C1orf107	27042	broad.mit.edu	37	1	210001468	210001468	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:210001468G>C	uc001hhr.1	+	1	136	c.60G>C	c.(58-60)CAG>CAC	p.Q20H	C1orf107_uc009xcu.1_5'UTR	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN	digestive-organ expansion factor homolog	20					multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)		CTAAAAAGCAGAAGAAACATC	0.547											OREG0014221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	52	62	---	---	---	---	capture	Missense_Mutation	SNP	210001468	210001468	C1orf107	1	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	1963	201
C1orf107	27042	broad.mit.edu	37	1	210001493	210001493	+	Nonsense_Mutation	SNP	G	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:210001493G>T	uc001hhr.1	+	1	161	c.85G>T	c.(85-87)GAG>TAG	p.E29*	C1orf107_uc009xcu.1_5'UTR	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN	digestive-organ expansion factor homolog	29					multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)		AGATTTCGGCGAGGAGCATCC	0.547											OREG0014221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	41	---	---	---	---	capture	Nonsense_Mutation	SNP	210001493	210001493	C1orf107	1	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	1963	201
PGBD2	267002	broad.mit.edu	37	1	249212387	249212387	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:249212387G>A	uc001ifh.2	+	3	1751	c.1604G>A	c.(1603-1605)GGG>GAG	p.G535E	PGBD2_uc001ifg.2_Missense_Mutation_p.G284E|PGBD2_uc009xhd.2_Missense_Mutation_p.G532E	NM_170725	NP_733843	Q6P3X8	PGBD2_HUMAN	hypothetical protein LOC267002 isoform a	535										ovary(1)	1	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ACATCTCAAGGGAGGCGAAGC	0.547													43	71	---	---	---	---	capture	Missense_Mutation	SNP	249212387	249212387	PGBD2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11684	201
PGBD2	267002	broad.mit.edu	37	1	249212544	249212544	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:249212544G>T	uc001ifh.2	+	3	1908	c.1761G>T	c.(1759-1761)AGG>AGT	p.R587S	PGBD2_uc001ifg.2_Missense_Mutation_p.R336S|PGBD2_uc009xhd.2_Missense_Mutation_p.R584S	NM_170725	NP_733843	Q6P3X8	PGBD2_HUMAN	hypothetical protein LOC267002 isoform a	587										ovary(1)	1	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AATGCTTCAGGGAGTACCACA	0.478													74	67	---	---	---	---	capture	Missense_Mutation	SNP	249212544	249212544	PGBD2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	555	43	4	4	11684	201
LBX1	10660	broad.mit.edu	37	10	102987489	102987489	+	Silent	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:102987489C>T	uc001ksx.2	-	2	529	c.384G>A	c.(382-384)TCG>TCA	p.S128S	uc010qpy.1_5'Flank	NM_006562	NP_006553	P52954	LBX1_HUMAN	ladybird homeobox 1	128	Homeobox.				muscle organ development		sequence-specific DNA binding				0		Colorectal(252;0.234)		Epithelial(162;3.22e-09)|all cancers(201;1.79e-07)		AGGCCGTGCGCGACTTTCGCC	0.587													54	7	---	---	---	---	capture	Silent	SNP	102987489	102987489	LBX1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8573	201
OR52B2	255725	broad.mit.edu	37	11	6190634	6190634	+	Missense_Mutation	SNP	C	T	T	rs147668114	by1000genomes	TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6190634C>T	uc010qzy.1	-	1	923	c.923G>A	c.(922-924)CGG>CAG	p.R308Q		NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTCAAAGAACCGGTGGGCTAC	0.478													38	58	---	---	---	---	capture	Missense_Mutation	SNP	6190634	6190634	OR52B2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11015	201
INSC	387755	broad.mit.edu	37	11	15260573	15260573	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:15260573G>C	uc001mly.2	+	11	1533	c.1487G>C	c.(1486-1488)CGT>CCT	p.R496P	INSC_uc001mlz.2_Missense_Mutation_p.R449P|INSC_uc001mma.2_Missense_Mutation_p.R449P|INSC_uc010rcs.1_Missense_Mutation_p.R484P|INSC_uc001mmb.2_Missense_Mutation_p.R449P|INSC_uc001mmc.2_Missense_Mutation_p.R407P	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	496					cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						ACCCTGGCTCGTCTCAGCCGA	0.607													3	38	---	---	---	---	capture	Missense_Mutation	SNP	15260573	15260573	INSC	11	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	7687	201
HIPK3	10114	broad.mit.edu	37	11	33362619	33362619	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:33362619C>A	uc001mul.1	+	7	1989	c.1719C>A	c.(1717-1719)AGC>AGA	p.S573R	HIPK3_uc001mum.1_Missense_Mutation_p.S573R|HIPK3_uc009yjv.1_Missense_Mutation_p.S573R	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3 isoform	573					anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						TTGCTTCAAGCAGTACTGCTA	0.318													4	110	---	---	---	---	capture	Missense_Mutation	SNP	33362619	33362619	HIPK3	11	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	7043	201
DGKZ	8525	broad.mit.edu	37	11	46393049	46393049	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46393049G>A	uc001ncn.1	+	9	1344	c.1219G>A	c.(1219-1221)GTG>ATG	p.V407M	DGKZ_uc001nch.1_Missense_Mutation_p.V235M|DGKZ_uc010rgq.1_Missense_Mutation_p.V162M|DGKZ_uc001ncj.1_Missense_Mutation_p.V185M|DGKZ_uc010rgr.1_Missense_Mutation_p.V184M|DGKZ_uc001nck.1_Translation_Start_Site|DGKZ_uc001ncl.2_Missense_Mutation_p.V219M|DGKZ_uc001ncm.2_Missense_Mutation_p.V218M|DGKZ_uc009yky.1_Missense_Mutation_p.V219M|DGKZ_uc010rgs.1_Missense_Mutation_p.V196M	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4	407	Phorbol-ester/DAG-type 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CCACAGCAAGGTGTCCTGCTT	0.701													25	41	---	---	---	---	capture	Missense_Mutation	SNP	46393049	46393049	DGKZ	11	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	4432	201
PEX5	5830	broad.mit.edu	37	12	7343512	7343512	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7343512A>G	uc009zfu.1	+	4	756	c.176A>G	c.(175-177)GAA>GGA	p.E59G	PEX5_uc001qsw.2_Missense_Mutation_p.E59G|PEX5_uc010sgc.1_Missense_Mutation_p.E74G|PEX5_uc001qsu.2_Missense_Mutation_p.E59G|PEX5_uc010sgd.1_Missense_Mutation_p.E80G|PEX5_uc001qsv.2_Missense_Mutation_p.E59G	NM_001131026	NP_001124498	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5 isoform d	59					protein import into peroxisome matrix, translocation|protein targeting to peroxisome|protein tetramerization|protein transport	cytosol|peroxisomal matrix|peroxisomal membrane	peroxisome matrix targeting signal-1 binding|protein C-terminus binding|protein N-terminus binding			ovary(1)	1						GTAGCTTCTGAAGATGAGGTA	0.428													81	107	---	---	---	---	capture	Missense_Mutation	SNP	7343512	7343512	PEX5	12	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	11651	201
CD163	9332	broad.mit.edu	37	12	7651670	7651670	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7651670T>A	uc001qsz.3	-	4	700	c.572A>T	c.(571-573)GAT>GTT	p.D191V	CD163_uc001qta.3_Missense_Mutation_p.D191V|CD163_uc009zfw.2_Missense_Mutation_p.D191V	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	191	SRCR 2.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						AGATGCATGATCTATGTTGAA	0.428													218	315	---	---	---	---	capture	Missense_Mutation	SNP	7651670	7651670	CD163	12	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	2938	201
METTL7A	25840	broad.mit.edu	37	12	51319018	51319018	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51319018C>T	uc001rxb.2	+	1	485	c.197C>T	c.(196-198)GCG>GTG	p.A66V	METTL7A_uc010smv.1_Missense_Mutation_p.A66V	NM_014033	NP_054752	Q9H8H3	MET7A_HUMAN	methyltransferase like 7A precursor	66						endoplasmic reticulum|lipid particle|membrane	methyltransferase activity				0						CAGGAGTTTGCGGGCCCCTCC	0.552													4	92	---	---	---	---	capture	Missense_Mutation	SNP	51319018	51319018	METTL7A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9417	201
TRHDE	29953	broad.mit.edu	37	12	73056901	73056901	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:73056901G>A	uc001sxa.2	+	19	3031	c.3001G>A	c.(3001-3003)GAA>AAA	p.E1001K		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	1001	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GGAAACTGTCGAAGCCAATGT	0.373													65	58	---	---	---	---	capture	Missense_Mutation	SNP	73056901	73056901	TRHDE	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16362	201
NAP1L1	4673	broad.mit.edu	37	12	76447581	76447581	+	Missense_Mutation	SNP	A	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:76447581A>C	uc001sxw.2	-	9	1151	c.739T>G	c.(739-741)TTT>GTT	p.F247V	NAP1L1_uc001sxv.2_Missense_Mutation_p.F205V|NAP1L1_uc001sxz.2_Missense_Mutation_p.F178V|NAP1L1_uc001sxx.2_Missense_Mutation_p.F247V|NAP1L1_uc001sxy.2_Missense_Mutation_p.F184V|NAP1L1_uc010sty.1_Missense_Mutation_p.F204V|NAP1L1_uc010stz.1_Missense_Mutation_p.F64V|NAP1L1_uc010sua.1_Missense_Mutation_p.F247V|NAP1L1_uc001syb.2_Missense_Mutation_p.F247V|NAP1L1_uc001sya.2_Missense_Mutation_p.F205V|NAP1L1_uc001syc.2_Missense_Mutation_p.F258V	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	247					DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				GGTCCATCAAAAGAAAAGGGA	0.333													59	72	---	---	---	---	capture	Missense_Mutation	SNP	76447581	76447581	NAP1L1	12	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	10064	201
CRY1	1407	broad.mit.edu	37	12	107393552	107393552	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107393552C>T	uc001tmi.3	-	7	1773	c.914G>A	c.(913-915)CGC>CAC	p.R305H		NM_004075	NP_004066	Q16526	CRY1_HUMAN	cryptochrome 1 (photolyase-like)	305	FAD-binding.				DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	blue light photoreceptor activity|DNA photolyase activity|double-stranded DNA binding|nucleotide binding|protein binding			ovary(3)	3						TTTATCAAAGCGTGGATTATT	0.433													33	42	---	---	---	---	capture	Missense_Mutation	SNP	107393552	107393552	CRY1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3868	201
PCDH9	5101	broad.mit.edu	37	13	67802035	67802035	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:67802035C>T	uc001vik.2	-	2	1230	c.538G>A	c.(538-540)GAA>AAA	p.E180K	PCDH9_uc001vil.2_Missense_Mutation_p.E180K|PCDH9_uc010thl.1_Missense_Mutation_p.E180K|PCDH9_uc001vin.3_Missense_Mutation_p.E180K	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	180	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TTTAACAATTCATAATGCTGT	0.423													118	178	---	---	---	---	capture	Missense_Mutation	SNP	67802035	67802035	PCDH9	13	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	11421	201
FOXA1	3169	broad.mit.edu	37	14	38060635	38060635	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38060635G>C	uc001wuf.2	-	2	1666	c.1354C>G	c.(1354-1356)CCC>GCC	p.P452A	FOXA1_uc010tpz.1_Missense_Mutation_p.P419A	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	452					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		AGGGCTGAGGGCTCGATGGGG	0.617													4	118	---	---	---	---	capture	Missense_Mutation	SNP	38060635	38060635	FOXA1	14	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	5933	201
LPCAT4	254531	broad.mit.edu	37	15	34653631	34653631	+	Silent	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34653631C>T	uc001zig.2	-	11	1207	c.1113G>A	c.(1111-1113)ACG>ACA	p.T371T		NM_153613	NP_705841	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	371					phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding				0						CACCAGCCACCGTCTGAGGAT	0.587													45	72	---	---	---	---	capture	Silent	SNP	34653631	34653631	LPCAT4	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8829	201
ITGA11	22801	broad.mit.edu	37	15	68612685	68612685	+	Silent	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:68612685G>A	uc002ari.2	-	20	2541	c.2454C>T	c.(2452-2454)TCC>TCT	p.S818S	ITGA11_uc010bib.2_Silent_p.S818S	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	818	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	GCGTGTATGCGGAGCAGTCCT	0.592													7	4	---	---	---	---	capture	Silent	SNP	68612685	68612685	ITGA11	15	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7797	201
SETD1A	9739	broad.mit.edu	37	16	30976386	30976386	+	Silent	SNP	T	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30976386T>C	uc002ead.1	+	7	2009	c.1323T>C	c.(1321-1323)GGT>GGC	p.G441G		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	441	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						CAGAACCTGGTGGAGGCGGGG	0.716													21	29	---	---	---	---	capture	Silent	SNP	30976386	30976386	SETD1A	16	T	C	C	C	1	0	0	0	0	0	0	0	1	756	59	3	3	14023	201
PRSS36	146547	broad.mit.edu	37	16	31159857	31159857	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31159857C>T	uc002ebd.2	-	5	471	c.412G>A	c.(412-414)GCC>ACC	p.A138T	PRSS36_uc010vff.1_5'UTR|PRSS36_uc010vfg.1_Missense_Mutation_p.A138T|PRSS36_uc010vfh.1_Missense_Mutation_p.A138T	NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36 precursor	138	Peptidase S1 1.				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1						GCCAGGTCGGCGCCCAGCTCC	0.756													4	9	---	---	---	---	capture	Missense_Mutation	SNP	31159857	31159857	PRSS36	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12520	201
POLR2A	5430	broad.mit.edu	37	17	7399844	7399844	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7399844G>A	uc002ghf.3	+	4	683	c.449G>A	c.(448-450)GGC>GAC	p.G150D	POLR2A_uc002ghe.2_Missense_Mutation_p.G150D	NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	150					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				CTTTGCAAGGGCAAAAACATA	0.537													4	196	---	---	---	---	capture	Missense_Mutation	SNP	7399844	7399844	POLR2A	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12117	201
KIAA0100	9703	broad.mit.edu	37	17	26967617	26967617	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26967617T>C	uc002hbu.2	-	8	950	c.851A>G	c.(850-852)GAG>GGG	p.E284G	KIAA0100_uc002hbv.2_Missense_Mutation_p.E284G|KIAA0100_uc010crr.1_Missense_Mutation_p.E141G	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	284						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					GCTTGTGTTCTCCATCTTAAC	0.463													3	145	---	---	---	---	capture	Missense_Mutation	SNP	26967617	26967617	KIAA0100	17	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	8076	201
TUBG1	7283	broad.mit.edu	37	17	40766544	40766544	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40766544C>T	uc002ian.2	+	10	1425	c.1027C>T	c.(1027-1029)CGC>TGC	p.R343C		NM_001070	NP_001061	P23258	TBG1_HUMAN	tubulin, gamma 1	343					G2/M transition of mitotic cell cycle|meiotic spindle organization|protein polymerization	condensed nuclear chromosome|cytosol|gamma-tubulin complex|polar microtubule	GTP binding|GTPase activity|protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)		GATCCGGGAACGCAAGTTGGC	0.657													44	44	---	---	---	---	capture	Missense_Mutation	SNP	40766544	40766544	TUBG1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16646	201
TNFRSF11A	8792	broad.mit.edu	37	18	60021766	60021766	+	Silent	SNP	G	A	A	rs139968917		TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:60021766G>A	uc002lin.2	+	4	464	c.426G>A	c.(424-426)CCG>CCA	p.P142P	TNFRSF11A_uc010dpv.2_Silent_p.P142P	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,	142	Extracellular (Potential).|TNFR-Cys 3.				adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity			breast(2)|lung(1)	3		Colorectal(73;0.188)				CCCAGCACCCGTGTACGGGTT	0.647									Paget_Disease_of_Bone				30	45	---	---	---	---	capture	Silent	SNP	60021766	60021766	TNFRSF11A	18	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16167	201
MUC16	94025	broad.mit.edu	37	19	8962003	8962003	+	Silent	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8962003G>A	uc002mkp.2	-	83	43578	c.43374C>T	c.(43372-43374)ATC>ATT	p.I14458I	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.I1258I|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTGCCAAGCCGATGAGGATGA	0.502													19	63	---	---	---	---	capture	Silent	SNP	8962003	8962003	MUC16	19	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	9883	201
LPPR2	64748	broad.mit.edu	37	19	11472001	11472001	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11472001C>T	uc002mre.1	+	6	837	c.500C>T	c.(499-501)ACG>ATG	p.T167M	LPPR2_uc002mrf.1_Missense_Mutation_p.T142M|LPPR2_uc010dxy.1_Translation_Start_Site	NM_022737	NP_073574	Q96GM1	LPPR2_HUMAN	lipid phosphate phosphatase-related protein type	167						integral to membrane	phosphatidate phosphatase activity			large_intestine(1)	1						CCCAACTACACGGCCCTGGGC	0.682													14	86	---	---	---	---	capture	Missense_Mutation	SNP	11472001	11472001	LPPR2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8841	201
CYP4F8	11283	broad.mit.edu	37	19	15726591	15726591	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15726591G>A	uc002nbi.2	+	2	228	c.164G>A	c.(163-165)CGG>CAG	p.R55Q	CYP4F8_uc010xoi.1_Missense_Mutation_p.R55Q|CYP4F8_uc010xoj.1_Missense_Mutation_p.G17R	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,	55					prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						CCGCAGCCCCGGAAACAGAAC	0.642													39	42	---	---	---	---	capture	Missense_Mutation	SNP	15726591	15726591	CYP4F8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4151	201
KIRREL2	84063	broad.mit.edu	37	19	36351843	36351843	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36351843G>A	uc002ocb.3	+	8	1173	c.961G>A	c.(961-963)GTG>ATG	p.V321M	KIRREL2_uc002obz.3_Missense_Mutation_p.V321M|KIRREL2_uc002oca.3_Missense_Mutation_p.V271M|KIRREL2_uc002occ.3_Missense_Mutation_p.V268M|KIRREL2_uc002ocd.3_Missense_Mutation_p.V318M	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	321	Extracellular (Potential).|Ig-like C2-type 4.				cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCCGGAGCCCGTGTCCGTGGA	0.672													16	49	---	---	---	---	capture	Missense_Mutation	SNP	36351843	36351843	KIRREL2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8247	201
SLC17A7	57030	broad.mit.edu	37	19	49934369	49934369	+	Missense_Mutation	SNP	G	A	A	rs17855709		TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49934369G>A	uc002pnp.2	-	11	1464	c.1292C>T	c.(1291-1293)CCG>CTG	p.P431L	SLC17A7_uc002pno.2_Missense_Mutation_p.P93L	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7	431	Cytoplasmic (Potential).				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		GGCGTAGCGCGGGGCTATGTC	0.607													35	3	---	---	---	---	capture	Missense_Mutation	SNP	49934369	49934369	SLC17A7	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14315	201
HK2	3099	broad.mit.edu	37	2	75081480	75081480	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:75081480C>T	uc002snd.2	+	2	2050	c.124C>T	c.(124-126)CGG>TGG	p.R42W		NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2	42	Regulatory.				apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						GATCTCTAAGCGGTTCCGCAA	0.512													6	482	---	---	---	---	capture	Missense_Mutation	SNP	75081480	75081480	HK2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	7116	201
UGGT1	56886	broad.mit.edu	37	2	128944331	128944331	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128944331G>A	uc002tps.2	+	39	4612	c.4434G>A	c.(4432-4434)TGG>TGA	p.W1478*	UGGT1_uc002tpr.2_Nonsense_Mutation_p.W1454*	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	1478	Glucosyltransferase (By similarity).				'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						GTGAAACGTGGTGTGATGACG	0.413													144	154	---	---	---	---	capture	Nonsense_Mutation	SNP	128944331	128944331	UGGT1	2	G	A	A	A	1	0	0	0	0	0	1	0	0	572	44	5	2	16823	201
TTN	7273	broad.mit.edu	37	2	179571370	179571370	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179571370C>T	uc010zfg.1	-	99	25723	c.25499G>A	c.(25498-25500)CGT>CAT	p.R8500H	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R5161H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9427							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGAAAACACGACCTCCTTG	0.443													143	161	---	---	---	---	capture	Missense_Mutation	SNP	179571370	179571370	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	201
AQP12B	653437	broad.mit.edu	37	2	241621969	241621969	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241621969C>T	uc010fzj.2	-	1	349	c.286G>A	c.(286-288)GTG>ATG	p.V96M	AQP12B_uc002vzt.2_Intron	NM_001102467	NP_001095937	A6NM10	AQ12B_HUMAN	aquaporin 12B	84						integral to membrane	transporter activity				0		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		TGCAGGGACACGGTGGGGTTG	0.687													29	27	---	---	---	---	capture	Missense_Mutation	SNP	241621969	241621969	AQP12B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	818	201
SULF2	55959	broad.mit.edu	37	20	46386007	46386007	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:46386007C>T	uc002xto.2	-	2	431	c.101G>A	c.(100-102)AGG>AAG	p.R34K	SULF2_uc002xtr.2_Missense_Mutation_p.R34K|SULF2_uc002xtq.2_Missense_Mutation_p.R34K|SULF2_uc010ghv.1_Missense_Mutation_p.R34K	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	34					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						CCTCTGAAACCTGCCTTTCAG	0.647													7	12	---	---	---	---	capture	Missense_Mutation	SNP	46386007	46386007	SULF2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	15261	201
SLCO4A1	28231	broad.mit.edu	37	20	61291766	61291766	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61291766C>T	uc002ydb.1	+	4	1095	c.890C>T	c.(889-891)ACG>ATG	p.T297M	SLCO4A1_uc002ydc.1_RNA	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family	297	Extracellular (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)			TTCCACAGGACGGAGCTGACC	0.687													12	40	---	---	---	---	capture	Missense_Mutation	SNP	61291766	61291766	SLCO4A1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14621	201
KRTAP10-5	386680	broad.mit.edu	37	21	46000294	46000294	+	Silent	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46000294C>T	uc002zfl.1	-	1	188	c.162G>A	c.(160-162)GCG>GCA	p.A54A	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198694	NP_941967	P60370	KR105_HUMAN	keratin associated protein 10-5	54	22 X 5 AA repeats of C-C-X(3).|2.					keratin filament					0						GCTCACAGGCCGCCTGGCAGC	0.493													20	37	---	---	---	---	capture	Silent	SNP	46000294	46000294	KRTAP10-5	21	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8432	201
C1QTNF6	114904	broad.mit.edu	37	22	37581311	37581311	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37581311C>T	uc003aqw.1	-	1	684	c.179G>A	c.(178-180)CGC>CAC	p.R60H	C1QTNF6_uc003aqx.1_Missense_Mutation_p.R79H|C1QTNF6_uc003aqy.1_Missense_Mutation_p.R79H|C1QTNF6_uc003aqz.1_RNA	NM_182486	NP_872292	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	60						collagen					0						GGCGTGGGGGCGGCCGGAGGA	0.632													3	31	---	---	---	---	capture	Missense_Mutation	SNP	37581311	37581311	C1QTNF6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1949	201
DCLK3	85443	broad.mit.edu	37	3	36779774	36779774	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:36779774C>T	uc003cgi.2	-	2	868	c.377G>A	c.(376-378)GGG>GAG	p.G126E		NM_033403	NP_208382	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	126						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						AATCTCCACCCCAAGATGCTT	0.567													125	211	---	---	---	---	capture	Missense_Mutation	SNP	36779774	36779774	DCLK3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	4252	201
SLC6A20	54716	broad.mit.edu	37	3	45801400	45801400	+	Silent	SNP	G	A	A	rs143985135		TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45801400G>A	uc011bai.1	-	10	1702	c.1578C>T	c.(1576-1578)AGC>AGT	p.S526S	SLC6A20_uc003cow.2_Silent_p.S176S|SLC6A20_uc011baj.1_Silent_p.S489S	NM_020208	NP_064593	Q9NP91	S6A20_HUMAN	solute carrier family 6, member 20 isoform 1	526	Extracellular (Potential).				cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		GGATGTAGTCGCTCAGGTAGA	0.592													90	109	---	---	---	---	capture	Silent	SNP	45801400	45801400	SLC6A20	3	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	14576	201
NIT2	56954	broad.mit.edu	37	3	100057936	100057936	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:100057936C>T	uc003dtv.2	+	2	87	c.13C>T	c.(13-15)CGC>TGC	p.R5C	NIT2_uc011bha.1_Missense_Mutation_p.R5C	NM_020202	NP_064587	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	5	CN hydrolase.				nitrogen compound metabolic process		omega-amidase activity			ovary(1)	1						CTCAGCTTTCCGCTTGGCCCT	0.403													161	189	---	---	---	---	capture	Missense_Mutation	SNP	100057936	100057936	NIT2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10341	201
DLG1	1739	broad.mit.edu	37	3	196921382	196921382	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196921382C>G	uc003fxo.3	-	5	587	c.397G>C	c.(397-399)GAA>CAA	p.E133Q	DLG1_uc011bud.1_5'UTR|DLG1_uc003fxn.3_Missense_Mutation_p.E133Q|DLG1_uc011bue.1_Missense_Mutation_p.E133Q|DLG1_uc010ial.2_Missense_Mutation_p.E133Q|DLG1_uc011buf.1_RNA|DLG1_uc003fxp.2_RNA|DLG1_uc010iam.1_Missense_Mutation_p.E133Q	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1	133					actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TGAACCAATTCTGGACCTATC	0.353													60	57	---	---	---	---	capture	Missense_Mutation	SNP	196921382	196921382	DLG1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	4512	201
SLIT2	9353	broad.mit.edu	37	4	20543202	20543202	+	Silent	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:20543202C>T	uc003gpr.1	+	20	2307	c.2103C>T	c.(2101-2103)CCC>CCT	p.P701P	SLIT2_uc003gps.1_Silent_p.P693P	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	701	LRRCT 3.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						AAGAAATACCCATCCAGGATG	0.443													72	100	---	---	---	---	capture	Silent	SNP	20543202	20543202	SLIT2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	14632	201
N4BP2	55728	broad.mit.edu	37	4	40119548	40119548	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40119548G>A	uc003guy.3	+	8	2062	c.1724G>A	c.(1723-1725)CGT>CAT	p.R575H	N4BP2_uc010ifq.2_Missense_Mutation_p.R495H|N4BP2_uc010ifr.2_Missense_Mutation_p.R495H	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	575						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						CATTATCAACGTTTTGTTTCA	0.363													47	61	---	---	---	---	capture	Missense_Mutation	SNP	40119548	40119548	N4BP2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10020	201
PCDH10	57575	broad.mit.edu	37	4	134084209	134084209	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:134084209G>T	uc003iha.2	+	4	3701	c.2875G>T	c.(2875-2877)GTC>TTC	p.V959F		NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	959	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		GCCTTCTTTTGTCCCTTCTGA	0.488													68	76	---	---	---	---	capture	Missense_Mutation	SNP	134084209	134084209	PCDH10	4	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	11410	201
DCLK2	166614	broad.mit.edu	37	4	151170830	151170830	+	Silent	SNP	C	G	G			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:151170830C>G	uc003ilm.3	+	15	2167	c.2067C>G	c.(2065-2067)GTC>GTG	p.V689V	DCLK2_uc003iln.3_Silent_p.V688V|DCLK2_uc003ilo.3_Silent_p.V706V|DCLK2_uc003ilp.3_RNA	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2 isoform a	689					intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)					GGGTCTCCGTCATCATGGTGA	0.532													69	96	---	---	---	---	capture	Silent	SNP	151170830	151170830	DCLK2	4	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	4251	201
AP3S1	1176	broad.mit.edu	37	5	115177778	115177778	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:115177778G>A	uc003krl.2	+	1	160	c.44G>A	c.(43-45)CGG>CAG	p.R15Q	AP3S1_uc003krk.2_5'UTR|AP3S1_uc003krm.2_Missense_Mutation_p.R15Q|ATG12_uc003krh.2_5'Flank|ATG12_uc003kri.2_5'Flank|ATG12_uc003krj.2_5'Flank	NM_001284	NP_001275	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1	15					insulin receptor signaling pathway|intracellular protein transport|vesicle-mediated transport	AP-type membrane coat adaptor complex|cytoplasmic vesicle membrane|Golgi apparatus|transport vesicle	protein binding|protein transporter activity				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		GGGAAGCCGCGGCTCTCCAAG	0.692													7	2	---	---	---	---	capture	Missense_Mutation	SNP	115177778	115177778	AP3S1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	742	201
DOCK2	1794	broad.mit.edu	37	5	169506008	169506008	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169506008C>T	uc003maf.2	+	49	5104	c.5024C>T	c.(5023-5025)ACG>ATG	p.T1675M	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.T1167M|DOCK2_uc003mah.2_Missense_Mutation_p.T231M	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1675					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCACCCAAGACGCCGAGAGTG	0.557													94	147	---	---	---	---	capture	Missense_Mutation	SNP	169506008	169506008	DOCK2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4643	201
WDR27	253769	broad.mit.edu	37	6	170036474	170036474	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:170036474T>C	uc003qwx.2	-	19	2516	c.1996A>G	c.(1996-1998)ATT>GTT	p.I666V	WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Missense_Mutation_p.I666V|WDR27_uc003qwy.2_Missense_Mutation_p.I539V			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;	636										pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		TACCTCTTAATCTCATCTTTG	0.378													34	46	---	---	---	---	capture	Missense_Mutation	SNP	170036474	170036474	WDR27	6	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	17165	201
FAM126A	84668	broad.mit.edu	37	7	23023600	23023600	+	Nonsense_Mutation	SNP	G	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23023600G>T	uc003svm.3	-	3	371	c.116C>A	c.(115-117)TCA>TAA	p.S39*	FAM126A_uc003svn.3_5'UTR|FAM126A_uc011jyr.1_Intron	NM_032581	NP_115970	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	39						cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1						ATAGAGAGATGAAACTAAAGA	0.259													37	113	---	---	---	---	capture	Nonsense_Mutation	SNP	23023600	23023600	FAM126A	7	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	5383	201
MUC17	140453	broad.mit.edu	37	7	100683180	100683180	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100683180G>A	uc003uxp.1	+	3	8536	c.8483G>A	c.(8482-8484)GGC>GAC	p.G2828D	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2828	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|45.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TCTGAGGCTGGCACCCTTTCA	0.498													9	659	---	---	---	---	capture	Missense_Mutation	SNP	100683180	100683180	MUC17	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9884	201
ARFGEF1	10565	broad.mit.edu	37	8	68140317	68140317	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:68140317T>C	uc003xxo.1	-	25	3862	c.3472A>G	c.(3472-3474)ACG>GCG	p.T1158A	ARFGEF1_uc003xxl.1_Missense_Mutation_p.T612A|ARFGEF1_uc003xxn.1_Missense_Mutation_p.T141A	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	1158					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GGGTGTGTCGTGGAAAGTAAT	0.318													61	74	---	---	---	---	capture	Missense_Mutation	SNP	68140317	68140317	ARFGEF1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	845	201
SLC39A4	55630	broad.mit.edu	37	8	145642115	145642115	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145642115G>A	uc003zcq.2	-	1	159	c.59C>T	c.(58-60)GCG>GTG	p.A20V	SLC39A4_uc003zco.2_5'Flank|SLC39A4_uc003zcp.2_5'Flank	NM_130849	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter),	20						cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GGACGCCGTCGCCGTCACCAC	0.662													7	8	---	---	---	---	capture	Missense_Mutation	SNP	145642115	145642115	SLC39A4	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14512	201
PAPPA	5069	broad.mit.edu	37	9	118997909	118997909	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:118997909G>A	uc004bjn.2	+	7	3106	c.2725G>A	c.(2725-2727)GTA>ATA	p.V909I	PAPPA_uc011lxp.1_Missense_Mutation_p.V604I|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	909					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TAGGAAATTCGTAGACATGTA	0.517													123	162	---	---	---	---	capture	Missense_Mutation	SNP	118997909	118997909	PAPPA	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11336	201
LAMC3	10319	broad.mit.edu	37	9	133907535	133907535	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133907535C>T	uc004caa.1	+	3	880	c.782C>T	c.(781-783)GCC>GTC	p.A261V		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	261	Laminin N-terminal.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TACTATTATGCCGTGTCCGAC	0.612													4	191	---	---	---	---	capture	Missense_Mutation	SNP	133907535	133907535	LAMC3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8536	201
GABRQ	55879	broad.mit.edu	37	X	151820044	151820044	+	Silent	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151820044C>T	uc004ffp.1	+	8	977	c.957C>T	c.(955-957)CTC>CTT	p.L319L		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	319						cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGGATAAGCTCCCCAACATTT	0.448													113	8	---	---	---	---	capture	Silent	SNP	151820044	151820044	GABRQ	23	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	6117	201
PCDH11Y	83259	broad.mit.edu	37	Y	5605715	5605715	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:5605715C>T	uc004fqo.2	+	5	4489	c.3755C>T	c.(3754-3756)TCT>TTT	p.S1252F		NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	1252	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						AGCCACAGCTCTTCTCTGCCA	0.552													153	11	---	---	---	---	capture	Missense_Mutation	SNP	5605715	5605715	PCDH11Y	24	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	11412	201
PIK3R2	5296	broad.mit.edu	37	19	18277106	18277106	+	Frame_Shift_Del	DEL	T	-	-			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18277106delT	uc002nia.1	+	12	2065	c.1553delT	c.(1552-1554)ATGfs	p.M518fs	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	518					fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6						GAGAAAGAGATGCAAAGGTGA	0.428													21	48	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	18277106	18277106	PIK3R2	19	T	-	-	-	1	0	1	0	1	0	0	0	0	663	51	5	5	11822	201
ICK	22858	broad.mit.edu	37	6	52883129	52883129	+	Frame_Shift_Del	DEL	T	-	-			TCGA-27-2523-01	TCGA-27-2523-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52883129delT	uc003pbh.2	-	8	1152	c.662delA	c.(661-663)AAGfs	p.K221fs	ICK_uc003pbi.2_Frame_Shift_Del_p.K221fs|ICK_uc003pbj.2_Frame_Shift_Del_p.K221fs	NM_016513	NP_057597	Q9UPZ9	ICK_HUMAN	intestinal cell kinase	221	Protein kinase.				intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)					TATCATTACCTTTTTTGGTGT	0.502													7	483	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	52883129	52883129	ICK	6	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	7409	201
