Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TAS1R1	80835	broad.mit.edu	37	1	6639227	6639227	+	Silent	SNP	A	G	G			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6639227A>G	uc001ant.2	+	6	2109	c.2109A>G	c.(2107-2109)CCA>CCG	p.P703P	TAS1R1_uc001anu.2_Silent_p.P449P|TAS1R1_uc001anv.2_Intron|TAS1R1_uc001anw.2_3'UTR|ZBTB48_uc009vmc.1_5'Flank|ZBTB48_uc001anx.2_5'Flank|ZBTB48_uc009vmd.1_5'Flank	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	703	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TGTGGACCCCACTGCCTGCTA	0.577													7	62	---	---	---	---	capture	Silent	SNP	6639227	6639227	TAS1R1	1	A	G	G	G	1	0	0	0	0	0	0	0	1	67	6	3	3	15450	202
PABPC4	8761	broad.mit.edu	37	1	40029374	40029374	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40029374G>A	uc010oiv.1	-	12	2430	c.1532C>T	c.(1531-1533)GCT>GTT	p.A511V	PABPC4_uc001cdl.2_Missense_Mutation_p.A527V|PABPC4_uc001cdm.2_Missense_Mutation_p.A498V	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2	511	Poly-Ala.				blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGCAGCAACAGCAGCGCGTGG	0.572													31	72	---	---	---	---	capture	Missense_Mutation	SNP	40029374	40029374	PABPC4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	11270	202
WDR47	22911	broad.mit.edu	37	1	109553699	109553699	+	Silent	SNP	T	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109553699T>A	uc001dwj.2	-	5	1345	c.969A>T	c.(967-969)GGA>GGT	p.G323G	WDR47_uc001dwl.2_Silent_p.G330G|WDR47_uc001dwi.2_Silent_p.G323G|WDR47_uc001dwk.2_Silent_p.G295G|WDR47_uc010ovf.1_Silent_p.G250G	NM_001142551	NP_001136023	O94967	WDR47_HUMAN	WD repeat domain 47 isoform 3	323										ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		GACTGGTTAGTCCACAGGTGA	0.448													191	292	---	---	---	---	capture	Silent	SNP	109553699	109553699	WDR47	1	T	A	A	A	1	0	0	0	0	0	0	0	1	743	58	4	4	17181	202
RPTN	126638	broad.mit.edu	37	1	152127651	152127651	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152127651G>A	uc001ezs.1	-	3	1989	c.1924C>T	c.(1924-1926)CAG>TAG	p.Q642*		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	642	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						CCGTTCTGCTGTGAGTCCCTA	0.483													46	179	---	---	---	---	capture	Nonsense_Mutation	SNP	152127651	152127651	RPTN	1	G	A	A	A	1	0	0	0	0	0	1	0	0	624	48	5	2	13556	202
PLXNA2	5362	broad.mit.edu	37	1	208205103	208205103	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:208205103C>T	uc001hgz.2	-	29	5815	c.5057G>A	c.(5056-5058)GGC>GAC	p.G1686D	PLXNA2_uc001hgy.2_5'Flank	NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	1686	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CTGCAGGGTGCCCTGGAGGAG	0.572													3	39	---	---	---	---	capture	Missense_Mutation	SNP	208205103	208205103	PLXNA2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12023	202
KIAA1217	56243	broad.mit.edu	37	10	24832950	24832950	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:24832950C>A	uc001iru.3	+	19	5154	c.4751C>A	c.(4750-4752)GCT>GAT	p.A1584D	KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irw.2_Intron|KIAA1217_uc001irz.2_Intron|KIAA1217_uc001irx.2_Missense_Mutation_p.A1267D|KIAA1217_uc001iry.2_Intron|KIAA1217_uc001isa.1_Missense_Mutation_p.A420D	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	1584					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						CAACTCGCCGCTCTCACTCAA	0.473													43	49	---	---	---	---	capture	Missense_Mutation	SNP	24832950	24832950	KIAA1217	10	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	8138	202
AGAP7	653268	broad.mit.edu	37	10	51464835	51464835	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:51464835C>T	uc001jio.2	-	7	1747	c.1621G>A	c.(1621-1623)GAA>AAA	p.E541K	PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	NM_001077685	NP_001071153	Q5VUJ5	AGAP7_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	541	Arf-GAP.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						ATCCACCGTTCCTTCTCTTCC	0.572													4	173	---	---	---	---	capture	Missense_Mutation	SNP	51464835	51464835	AGAP7	10	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	373	202
PTEN	5728	broad.mit.edu	37	10	89692904	89692904	+	Nonsense_Mutation	SNP	C	T	T	rs121909224		TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692904C>T	uc001kfb.2	+	6	1419	c.388C>T	c.(388-390)CGA>TGA	p.R130*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type.		R -> L (in CD and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> Q (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).	R->M: Does not affect the ability to inhibit AKT/PKB activation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R130G(65)|p.R130*(61)|p.R130Q(43)|p.R130fs*4(12)|p.R130L(7)|p.R130P(4)|p.R55fs*1(4)|p.K128_R130del(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.R130R(1)|p.F56fs*2(1)|p.G129fs*50(1)|p.G129fs*51(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGGAAAGGGACGAACTGGTGT	0.403	R130G(OV56_OVARY)|R130G(KMBC2_URINARY_TRACT)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			73	52	---	---	---	---	capture	Nonsense_Mutation	SNP	89692904	89692904	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12633	202
OR51B2	79345	broad.mit.edu	37	11	5344773	5344773	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5344773G>A	uc001mao.1	-	1	810	c.755C>T	c.(754-756)ACA>ATA	p.T252I	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	252	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCCATCACTGTAACATAGAA	0.393													49	89	---	---	---	---	capture	Missense_Mutation	SNP	5344773	5344773	OR51B2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	10993	202
OR52D1	390066	broad.mit.edu	37	11	5510785	5510785	+	Silent	SNP	C	G	G			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5510785C>G	uc010qzg.1	+	1	849	c.849C>G	c.(847-849)CTC>CTG	p.L283L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005163	NP_001005163	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGCTAATCTCTATGTGCTGG	0.493													40	57	---	---	---	---	capture	Silent	SNP	5510785	5510785	OR52D1	11	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	11018	202
SLC17A6	57084	broad.mit.edu	37	11	22363249	22363249	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22363249C>A	uc001mqk.2	+	2	675	c.262C>A	c.(262-264)CGC>AGC	p.R88S		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	88	Helical; (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						CTTCGGTATCCGCTGCAACCT	0.642													35	41	---	---	---	---	capture	Missense_Mutation	SNP	22363249	22363249	SLC17A6	11	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	14314	202
CD5	921	broad.mit.edu	37	11	60885944	60885944	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60885944C>A	uc009ynk.2	+	3	495	c.392C>A	c.(391-393)ACC>AAC	p.T131N		NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor	131	Extracellular (Potential).|SRCR 1.				cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		CTGGGCCTGACCTGCTTAGGT	0.607													43	64	---	---	---	---	capture	Missense_Mutation	SNP	60885944	60885944	CD5	11	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	2992	202
OR2AT4	341152	broad.mit.edu	37	11	74799893	74799893	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74799893A>T	uc010rro.1	-	1	866	c.866T>A	c.(865-867)ATT>AAT	p.I289N		NM_001005285	NP_001005285	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT,	289	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GGGGTTGAGAATTGGTGTGAG	0.488													4	198	---	---	---	---	capture	Missense_Mutation	SNP	74799893	74799893	OR2AT4	11	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	10891	202
MLL	4297	broad.mit.edu	37	11	118382698	118382698	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118382698G>C	uc001pta.2	+	31	11118	c.11095G>C	c.(11095-11097)GAA>CAA	p.E3699Q	MLL_uc001ptb.2_Missense_Mutation_p.E3702Q	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3699	FYR C-terminal.				apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TAAAGTCCAGGAAGCTCGATC	0.418			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								3	170	---	---	---	---	capture	Missense_Mutation	SNP	118382698	118382698	MLL	11	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	9532	202
OR8G2	26492	broad.mit.edu	37	11	124095935	124095935	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124095935T>C	uc010saf.1	+	1	538	c.538T>C	c.(538-540)TTT>CTT	p.F180L		NM_001007249	NP_001007250	Q15614	OR8G2_HUMAN	olfactory receptor, family 8, subfamily G,	180						integral to membrane	olfactory receptor activity				0		Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.91e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GTTGAGACTCTTTTTGTGCAA	0.428													10	737	---	---	---	---	capture	Missense_Mutation	SNP	124095935	124095935	OR8G2	11	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11139	202
ERP27	121506	broad.mit.edu	37	12	15073953	15073953	+	Silent	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:15073953G>A	uc001rco.2	-	4	384	c.363C>T	c.(361-363)GAC>GAT	p.D121D		NM_152321	NP_689534	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27 kDa precursor	121	Thioredoxin.					endoplasmic reticulum lumen				breast(1)	1						CAATGTCTTCGTCCTCTAAAT	0.333													51	105	---	---	---	---	capture	Silent	SNP	15073953	15073953	ERP27	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5196	202
LST-3TM12	338821	broad.mit.edu	37	12	21175884	21175884	+	Silent	SNP	T	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21175884T>C	uc010sin.1	+	4	441	c.441T>C	c.(439-441)TCT>TCC	p.S147S	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Silent_p.S194S	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	147						membrane	transporter activity				0						TGGGGATTTCTTACATTGATG	0.383													58	89	---	---	---	---	capture	Silent	SNP	21175884	21175884	LST-3TM12	12	T	C	C	C	1	0	0	0	0	0	0	0	1	717	56	3	3	8981	202
ABCD2	225	broad.mit.edu	37	12	40012546	40012546	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40012546T>C	uc001rmb.2	-	1	1298	c.872A>G	c.(871-873)TAT>TGT	p.Y291C		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	291	ABC transmembrane type-1.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						ATACCGCAAATAGCCTTTTCT	0.413													117	178	---	---	---	---	capture	Missense_Mutation	SNP	40012546	40012546	ABCD2	12	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	61	202
AMHR2	269	broad.mit.edu	37	12	53823327	53823327	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53823327G>A	uc001scx.1	+	8	1136	c.1058G>A	c.(1057-1059)GGC>GAC	p.G353D	AMHR2_uc009zmy.1_Missense_Mutation_p.G353D	NM_020547	NP_065434	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II isoform	353	Cytoplasmic (Potential).|Protein kinase.				Mullerian duct regression		ATP binding|hormone binding|metal ion binding			ovary(1)|skin(1)	2					Adenosine triphosphate(DB00171)	GGAGACCTGGGCCTTGCCTTG	0.572									Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)				50	68	---	---	---	---	capture	Missense_Mutation	SNP	53823327	53823327	AMHR2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	573	202
LUM	4060	broad.mit.edu	37	12	91497971	91497971	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:91497971G>A	uc001tbm.2	-	3	1377	c.988C>T	c.(988-990)CGT>TGT	p.R330C	LUM_uc001tbn.2_RNA	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	330					collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						TTAGCAACACGTAGACATTCA	0.383													39	94	---	---	---	---	capture	Missense_Mutation	SNP	91497971	91497971	LUM	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9000	202
CORO1C	23603	broad.mit.edu	37	12	109052586	109052586	+	Silent	SNP	G	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109052586G>C	uc001tnj.2	-	5	654	c.558C>G	c.(556-558)GGC>GGG	p.G186G	CORO1C_uc009zva.2_Silent_p.G239G|CORO1C_uc010sxf.1_Silent_p.G149G	NM_014325	NP_055140	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C isoform 1	186	WD 3.				actin cytoskeleton organization|phagocytosis|signal transduction	actin cytoskeleton	actin filament binding			skin(3)	3						AGATCAGACTGCCATTCCGGT	0.433													66	119	---	---	---	---	capture	Silent	SNP	109052586	109052586	CORO1C	12	G	C	C	C	1	0	0	0	0	0	0	0	1	587	46	4	4	3720	202
TRPV4	59341	broad.mit.edu	37	12	110226433	110226433	+	Silent	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110226433G>A	uc001tpj.1	-	12	2075	c.1980C>T	c.(1978-1980)TGC>TGT	p.C660C	TRPV4_uc001tpg.1_Silent_p.C626C|TRPV4_uc001tph.1_Silent_p.C613C|TRPV4_uc001tpi.1_Silent_p.C553C|TRPV4_uc001tpk.1_Silent_p.C660C|TRPV4_uc001tpl.1_Silent_p.C600C	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	660					actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						CGCTGTCACGGCACGAGGGGT	0.597													4	207	---	---	---	---	capture	Silent	SNP	110226433	110226433	TRPV4	12	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	16481	202
TRPV4	59341	broad.mit.edu	37	12	110238470	110238470	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110238470C>T	uc001tpj.1	-	4	901	c.806G>A	c.(805-807)CGT>CAT	p.R269H	TRPV4_uc001tpg.1_Missense_Mutation_p.R235H|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Missense_Mutation_p.R269H|TRPV4_uc001tpl.1_Missense_Mutation_p.R269H	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	269	Cytoplasmic (Potential).		R -> H (in CMT2C and DSMAC).|R -> C (in CMT2C).		actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GAAGCGCCCACGGGCCTGGGC	0.632													48	71	---	---	---	---	capture	Missense_Mutation	SNP	110238470	110238470	TRPV4	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16481	202
RB1	5925	broad.mit.edu	37	13	48951053	48951053	+	Splice_Site	SNP	G	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48951053G>C	uc001vcb.2	+	13	1382	c.1216_splice	c.e13-1	p.N406_splice	RB1_uc010act.1_Splice_Site_p.N107_splice	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(10)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ACCTCCTAAAGAACTGCACAG	0.318		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			6	95	---	---	---	---	capture	Splice_Site	SNP	48951053	48951053	RB1	13	G	C	C	C	1	0	0	0	0	0	0	1	0	429	33	5	4	12993	202
LEO1	123169	broad.mit.edu	37	15	52258194	52258194	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:52258194T>C	uc002abo.2	-	2	582	c.566A>G	c.(565-567)GAT>GGT	p.D189G	LEO1_uc010bfd.2_Missense_Mutation_p.D189G	NM_138792	NP_620147	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component,	189	Asp-rich.				histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding				0				all cancers(107;0.00264)		CTCCTCATCATCTGTGTTCTG	0.433													39	467	---	---	---	---	capture	Missense_Mutation	SNP	52258194	52258194	LEO1	15	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	8646	202
PDILT	204474	broad.mit.edu	37	16	20380898	20380898	+	Silent	SNP	G	A	A	rs150342728	byFrequency	TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20380898G>A	uc002dhc.1	-	8	1255	c.1032C>T	c.(1030-1032)GAC>GAT	p.D344D		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	344					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						TGTACCTGGCGTCAGAGCTCA	0.468													17	209	---	---	---	---	capture	Silent	SNP	20380898	20380898	PDILT	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11577	202
CHD9	80205	broad.mit.edu	37	16	53330872	53330872	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53330872A>G	uc002ehb.2	+	29	5679	c.5515A>G	c.(5515-5517)ACA>GCA	p.T1839A	CHD9_uc002egy.2_Missense_Mutation_p.T1839A|CHD9_uc002ehc.2_Missense_Mutation_p.T1839A|CHD9_uc002ehf.2_Missense_Mutation_p.T953A|CHD9_uc010cbw.2_Missense_Mutation_p.T207A	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1839					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				AAATAGATGGACAAGAAGAGA	0.294													19	139	---	---	---	---	capture	Missense_Mutation	SNP	53330872	53330872	CHD9	16	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	3298	202
ZFHX3	463	broad.mit.edu	37	16	72827367	72827367	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72827367C>T	uc002fck.2	-	9	9887	c.9214G>A	c.(9214-9216)GTA>ATA	p.V3072I	ZFHX3_uc002fcl.2_Missense_Mutation_p.V2158I	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	3072					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				AACTGACGTACGGTGGCTGGG	0.488													24	248	---	---	---	---	capture	Missense_Mutation	SNP	72827367	72827367	ZFHX3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17514	202
RICH2	9912	broad.mit.edu	37	17	12847456	12847456	+	Silent	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:12847456C>T	uc002gnr.3	+	10	1131	c.804C>T	c.(802-804)ATC>ATT	p.I268I	RICH2_uc010vvk.1_Silent_p.I268I|RICH2_uc010vvl.1_Silent_p.I268I|RICH2_uc002gns.3_Silent_p.I68I|RICH2_uc010vvm.1_Silent_p.I268I|RICH2_uc010vvn.1_RNA|RICH2_uc002gnt.1_5'UTR	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2	268	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						GCCGGGAGATCGCCTTCCCCA	0.632													16	33	---	---	---	---	capture	Silent	SNP	12847456	12847456	RICH2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	13249	202
CPD	1362	broad.mit.edu	37	17	28770823	28770823	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:28770823C>A	uc002hfb.1	+	11	2392	c.2377C>A	c.(2377-2379)CAT>AAT	p.H793N	CPD_uc010wbo.1_Missense_Mutation_p.H546N|CPD_uc010wbp.1_RNA	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor	793	Extracellular (Potential).|Carboxypeptidase-like 2.				proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						AATCCAGGTTCATCAGGGCGT	0.378													90	154	---	---	---	---	capture	Missense_Mutation	SNP	28770823	28770823	CPD	17	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	3763	202
CPD	1362	broad.mit.edu	37	17	28770972	28770972	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:28770972C>G	uc002hfb.1	+	11	2541	c.2526C>G	c.(2524-2526)ATC>ATG	p.I842M	CPD_uc010wbo.1_Missense_Mutation_p.I595M|CPD_uc010wbp.1_RNA	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor	842	Extracellular (Potential).|Carboxypeptidase-like 2.				proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						CTTATAAAATCACAGCATCTG	0.423													122	182	---	---	---	---	capture	Missense_Mutation	SNP	28770972	28770972	CPD	17	C	G	G	G	1	0	0	0	0	1	0	0	0	369	29	4	4	3763	202
SLC4A1	6521	broad.mit.edu	37	17	42337808	42337808	+	Missense_Mutation	SNP	C	T	T	rs55735880		TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42337808C>T	uc002igf.3	-	6	598	c.449G>A	c.(448-450)CGA>CAA	p.R150Q	SLC4A1_uc002igg.3_Missense_Mutation_p.R150Q	NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	150	Cytoplasmic.				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CAGCTCCTCTCGGTCCTGAGG	0.607													11	31	---	---	---	---	capture	Missense_Mutation	SNP	42337808	42337808	SLC4A1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14542	202
GJC1	10052	broad.mit.edu	37	17	42882259	42882259	+	Silent	SNP	G	T	T	rs138440006		TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42882259G>T	uc002ihj.2	-	2	1438	c.927C>A	c.(925-927)ATC>ATA	p.I309I	GJC1_uc002ihk.2_Silent_p.I309I|GJC1_uc002ihl.2_Silent_p.I309I|GJC1_uc010czx.2_Silent_p.I309I|GJC1_uc010czy.1_Silent_p.I170I	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	309	Cytoplasmic (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				GCTTGTAGGCGATCTTAGCAT	0.507													112	182	---	---	---	---	capture	Silent	SNP	42882259	42882259	GJC1	17	G	T	T	T	1	0	0	0	0	0	0	0	1	473	37	4	4	6351	202
FMNL1	752	broad.mit.edu	37	17	43322740	43322740	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43322740C>T	uc002iin.2	+	22	3049	c.2849C>T	c.(2848-2850)TCG>TTG	p.S950L	FMNL1_uc002iiq.2_Missense_Mutation_p.S528L|FMNL1_uc010dag.2_RNA|LOC100133991_uc010dah.2_5'Flank	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1	950	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						AGGGCCAACTCGCCCACCATG	0.617													41	79	---	---	---	---	capture	Missense_Mutation	SNP	43322740	43322740	FMNL1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5895	202
C17orf47	284083	broad.mit.edu	37	17	56621327	56621327	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56621327T>A	uc002iwq.1	-	1	357	c.221A>T	c.(220-222)CAG>CTG	p.Q74L		NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN	hypothetical protein LOC284083	74										breast(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGTCCTGACTGGAGGGAGAC	0.567													35	86	---	---	---	---	capture	Missense_Mutation	SNP	56621327	56621327	C17orf47	17	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	1843	202
USP32	84669	broad.mit.edu	37	17	58258719	58258719	+	Missense_Mutation	SNP	C	T	T	rs17405739	by1000genomes	TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:58258719C>T	uc002iyo.1	-	32	4800	c.4514G>A	c.(4513-4515)CGT>CAT	p.R1505H	USP32_uc002iyn.1_Missense_Mutation_p.R1175H	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	1505					protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AGGCTTAATACGAGTATCTTC	0.383													69	152	---	---	---	---	capture	Missense_Mutation	SNP	58258719	58258719	USP32	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16945	202
GAA	2548	broad.mit.edu	37	17	78081639	78081639	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78081639C>T	uc002jxo.2	+	6	1081	c.899C>T	c.(898-900)GCG>GTG	p.A300V	GAA_uc002jxp.2_Missense_Mutation_p.A300V|GAA_uc002jxq.2_Missense_Mutation_p.A300V	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein	300					cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	TTCTACCTGGCGCTGGAGGAC	0.647													9	17	---	---	---	---	capture	Missense_Mutation	SNP	78081639	78081639	GAA	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6089	202
MUC16	94025	broad.mit.edu	37	19	9056586	9056586	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9056586G>T	uc002mkp.2	-	3	31064	c.30860C>A	c.(30859-30861)ACT>AAT	p.T10287N		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10289	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGCAAATGAAGTCATGGCCTC	0.493													20	161	---	---	---	---	capture	Missense_Mutation	SNP	9056586	9056586	MUC16	19	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	9883	202
ADD2	119	broad.mit.edu	37	2	70890611	70890611	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70890611G>C	uc002sgz.2	-	16	2592	c.2127C>G	c.(2125-2127)TTC>TTG	p.F709L	ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_3'UTR|ADD2_uc002sha.2_Missense_Mutation_p.F403L|ADD2_uc002sgx.2_3'UTR	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a	709	Interaction with calmodulin (Potential).				actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3						AGGGGGTTCGGAATTTCTTTT	0.527													6	452	---	---	---	---	capture	Missense_Mutation	SNP	70890611	70890611	ADD2	2	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	305	202
CLASP1	23332	broad.mit.edu	37	2	122216417	122216417	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:122216417C>T	uc002tnc.2	-	13	1703	c.1313G>A	c.(1312-1314)CGG>CAG	p.R438Q	CLASP1_uc002tna.2_5'Flank|CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Missense_Mutation_p.R438Q|CLASP1_uc010yza.1_Missense_Mutation_p.R438Q|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tng.1_Missense_Mutation_p.R438Q	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	438	HEAT 3.				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					CATACTTACCCGAATAATTAA	0.338													47	74	---	---	---	---	capture	Missense_Mutation	SNP	122216417	122216417	CLASP1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3419	202
MBD5	55777	broad.mit.edu	37	2	149220206	149220206	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:149220206G>A	uc002twm.3	+	7	1157	c.169G>A	c.(169-171)GAT>AAT	p.D57N	MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Missense_Mutation_p.D57N	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	57	MBD.					chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CCTGCTTACTGATGGAACATG	0.353													58	91	---	---	---	---	capture	Missense_Mutation	SNP	149220206	149220206	MBD5	2	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	9260	202
PMS1	5378	broad.mit.edu	37	2	190660525	190660525	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:190660525C>T	uc002urh.3	+	3	692	c.163C>T	c.(163-165)CGA>TGA	p.R55*	PMS1_uc010zga.1_Nonsense_Mutation_p.R55*|PMS1_uc010zgb.1_Intron|PMS1_uc002urk.3_Nonsense_Mutation_p.R55*|PMS1_uc002uri.3_Nonsense_Mutation_p.R55*|PMS1_uc010zgc.1_5'UTR|PMS1_uc010zgd.1_Intron|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Nonsense_Mutation_p.R55*|PMS1_uc010frz.2_Nonsense_Mutation_p.R55*|PMS1_uc010zfz.1_Nonsense_Mutation_p.R55*	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	55					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AATTGAGGTGCGAGATAACGG	0.323			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					58	115	---	---	---	---	capture	Nonsense_Mutation	SNP	190660525	190660525	PMS1	2	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	12045	202
DYTN	391475	broad.mit.edu	37	2	207530695	207530695	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207530695G>A	uc002vbr.1	-	10	1156	c.1039C>T	c.(1039-1041)CAG>TAG	p.Q347*		NM_001093730	NP_001087199	A2CJ06	DYTN_HUMAN	dystrotelin	347	Potential.					plasma membrane	zinc ion binding			ovary(1)|central_nervous_system(1)	2				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		CTTTCTTCCTGGGAGGTGTAT	0.408													45	112	---	---	---	---	capture	Nonsense_Mutation	SNP	207530695	207530695	DYTN	2	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	4816	202
WNT10A	80326	broad.mit.edu	37	2	219745829	219745829	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219745829A>T	uc002vjd.1	+	1	575	c.112A>T	c.(112-114)AGG>TGG	p.R38W		NM_025216	NP_079492	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family,	38					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|female gonad development|hair follicle morphogenesis|odontogenesis|regulation of odontogenesis of dentine-containing tooth|sebaceous gland development|skin development|tongue development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			lung(1)|skin(1)	2		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCCATGCCCAGGTGAGCCCT	0.687													3	5	---	---	---	---	capture	Missense_Mutation	SNP	219745829	219745829	WNT10A	2	A	T	T	T	1	0	0	0	0	1	0	0	0	88	7	4	4	17263	202
KCNJ13	3769	broad.mit.edu	37	2	233632952	233632952	+	Silent	SNP	A	G	G			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233632952A>G	uc002vto.2	-	2	1075	c.1032T>C	c.(1030-1032)AAT>AAC	p.N344N	GIGYF2_uc010zmj.1_Intron|GIGYF2_uc002vtg.2_Intron|GIGYF2_uc002vtj.3_Intron|GIGYF2_uc002vti.3_Intron|GIGYF2_uc002vtk.3_Intron|GIGYF2_uc002vth.3_Intron|GIGYF2_uc010zmk.1_Intron|GIGYF2_uc010zml.1_Intron|KCNJ13_uc002vtn.2_3'UTR|KCNJ13_uc002vtp.2_Silent_p.N344N	NM_002242	NP_002233	O60928	IRK13_HUMAN	potassium inwardly-rectifying channel J13	344	Cytoplasmic (By similarity).					voltage-gated potassium channel complex	inward rectifier potassium channel activity				0		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0306)|Lung NSC(271;0.0908)		Epithelial(121;5.9e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0617)		TGCTTTGTCCATTGATGTGGA	0.383													122	167	---	---	---	---	capture	Silent	SNP	233632952	233632952	KCNJ13	2	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	7969	202
SIRPG	55423	broad.mit.edu	37	20	1616837	1616837	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1616837G>A	uc002wfm.1	-	3	810	c.745C>T	c.(745-747)CGA>TGA	p.R249*	SIRPG_uc002wfn.1_Nonsense_Mutation_p.R249*|SIRPG_uc002wfo.1_Intron|uc002wfp.1_Intron	NM_018556	NP_061026	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma isoform 1	249	Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding			ovary(1)	1						CCTCTACCTCGGATGGCCTCA	0.622													39	65	---	---	---	---	capture	Nonsense_Mutation	SNP	1616837	1616837	SIRPG	20	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	14229	202
PLK1S1	55857	broad.mit.edu	37	20	21143753	21143753	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:21143753C>G	uc002wsb.2	+	6	1438	c.1305C>G	c.(1303-1305)AGC>AGG	p.S435R	PLK1S1_uc010zsh.1_Missense_Mutation_p.S332R|PLK1S1_uc010zsi.1_Missense_Mutation_p.S302R|PLK1S1_uc010zsj.1_RNA|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_RNA	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1	435					spindle organization	centrosome	protein kinase binding				0						AAACCCTAAGCTCTCCTGATT	0.368													69	134	---	---	---	---	capture	Missense_Mutation	SNP	21143753	21143753	PLK1S1	20	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	11998	202
PYGB	5834	broad.mit.edu	37	20	25271172	25271172	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:25271172G>T	uc002wup.2	+	16	1992	c.1883G>T	c.(1882-1884)GGC>GTC	p.G628V	uc010gdm.1_5'Flank	NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase	628					glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)	ACCTCCATCGGCGACGTCGTC	0.522													110	184	---	---	---	---	capture	Missense_Mutation	SNP	25271172	25271172	PYGB	20	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	12755	202
SLC32A1	140679	broad.mit.edu	37	20	37356106	37356106	+	Silent	SNP	G	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37356106G>C	uc002xjc.2	+	2	665	c.402G>C	c.(400-402)GTG>GTC	p.V134V		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	134	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	GCATGTTCGTGCTGGGCCTAC	0.647													32	52	---	---	---	---	capture	Silent	SNP	37356106	37356106	SLC32A1	20	G	C	C	C	1	0	0	0	0	0	0	0	1	587	46	4	4	14457	202
CASS4	57091	broad.mit.edu	37	20	55033502	55033502	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:55033502T>A	uc002xxp.2	+	7	2285	c.2060T>A	c.(2059-2061)ATC>AAC	p.I687N	CASS4_uc002xxr.2_Missense_Mutation_p.I687N|CASS4_uc010zze.1_Missense_Mutation_p.I633N|CASS4_uc010gio.2_Missense_Mutation_p.I250N	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	687					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						TTCAAAGCCATCAGCGCATTT	0.577													6	79	---	---	---	---	capture	Missense_Mutation	SNP	55033502	55033502	CASS4	20	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	2659	202
SLCO4A1	28231	broad.mit.edu	37	20	61288142	61288142	+	Silent	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61288142C>T	uc002ydb.1	+	2	541	c.336C>T	c.(334-336)GCC>GCT	p.A112A	SLCO4A1_uc002ydc.1_RNA	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family	112	Helical; Name=1; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)			TGTGTGCGGCCGCATTCCTGC	0.647													25	49	---	---	---	---	capture	Silent	SNP	61288142	61288142	SLCO4A1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14621	202
POTEH	23784	broad.mit.edu	37	22	16287657	16287657	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:16287657T>C	uc010gqp.2	-	1	281	c.229A>G	c.(229-231)AAG>GAG	p.K77E	POTEH_uc002zlg.1_5'Flank|POTEH_uc002zlh.1_5'Flank|POTEH_uc002zlj.1_5'UTR	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3	77										skin(1)	1						ACGTTGCTCTTGCCGCTCCCC	0.587													119	345	---	---	---	---	capture	Missense_Mutation	SNP	16287657	16287657	POTEH	22	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	12168	202
ELFN2	114794	broad.mit.edu	37	22	37769172	37769172	+	Silent	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37769172G>A	uc003asq.3	-	3	3189	c.2403C>T	c.(2401-2403)GAC>GAT	p.D801D		NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	801	Cytoplasmic (Potential).					cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)					GCAGATCCTCGTCCTTGGCGA	0.632													41	72	---	---	---	---	capture	Silent	SNP	37769172	37769172	ELFN2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5013	202
CAND2	23066	broad.mit.edu	37	3	12856711	12856711	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12856711G>T	uc003bxk.2	+	8	1127	c.1078G>T	c.(1078-1080)GCA>TCA	p.A360S	CAND2_uc003bxj.2_Missense_Mutation_p.A267S	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	360	HEAT 8.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4						CAAGTGCATCGCAGCCTTGAT	0.597													45	51	---	---	---	---	capture	Missense_Mutation	SNP	12856711	12856711	CAND2	3	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	2592	202
SLC7A11	23657	broad.mit.edu	37	4	139100426	139100426	+	Silent	SNP	C	A	A	rs145453312	by1000genomes	TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:139100426C>A	uc011chb.1	-	11	1669	c.1389G>T	c.(1387-1389)GCG>GCT	p.A463A		NM_014331	NP_055146	Q9UPY5	XCT_HUMAN	solute carrier family 7, (cationic amino acid	463	Helical; (Potential).				blood coagulation|cellular nitrogen compound metabolic process|leukocyte migration|response to toxin	integral to membrane|plasma membrane	cystine:glutamate antiporter activity|protein binding			skin(1)	1	all_hematologic(180;0.166)				L-Cystine(DB00138)|L-Glutamic Acid(DB00142)|Sulfasalazine(DB00795)	AGAGATAATACGCAGGGACTC	0.423													58	85	---	---	---	---	capture	Silent	SNP	139100426	139100426	SLC7A11	4	C	A	A	A	1	0	0	0	0	0	0	0	1	236	19	4	4	14586	202
CARD6	84674	broad.mit.edu	37	5	40843343	40843343	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40843343C>A	uc003jmg.2	+	2	448	c.373C>A	c.(373-375)CCT>ACT	p.P125T		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	125					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						AATAAAACAGCCTGAAGCCCC	0.403													33	106	---	---	---	---	capture	Missense_Mutation	SNP	40843343	40843343	CARD6	5	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	2626	202
HARS	3035	broad.mit.edu	37	5	140056309	140056309	+	Missense_Mutation	SNP	C	T	T	rs151258227		TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140056309C>T	uc003lgv.2	-	10	1206	c.1124G>A	c.(1123-1125)CGC>CAC	p.R375H	HARS_uc003lgu.2_Missense_Mutation_p.R306H|HARS_uc011czm.1_Missense_Mutation_p.R335H|HARS_uc003lgw.2_Missense_Mutation_p.R355H|HARS_uc011czn.1_Missense_Mutation_p.R315H|HARS_uc010jfu.2_Missense_Mutation_p.R375H|HARS_uc011czo.1_Missense_Mutation_p.R301H|HARS_uc011czp.1_Missense_Mutation_p.R261H|HARS_uc011czq.1_Missense_Mutation_p.R265H	NM_002109	NP_002100	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	375					histidyl-tRNA aminoacylation	cytosol	ATP binding|histidine-tRNA ligase activity			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	TGGCACCTTGCGCCCTTTGGG	0.597													6	276	---	---	---	---	capture	Missense_Mutation	SNP	140056309	140056309	HARS	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6886	202
PCDHB13	56123	broad.mit.edu	37	5	140594357	140594357	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140594357C>T	uc003lja.1	+	1	849	c.662C>T	c.(661-663)CCG>CTG	p.P221L		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	221	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	p.P221L(1)		skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGCTCTCCGCCCAGATCT	0.532													7	170	---	---	---	---	capture	Missense_Mutation	SNP	140594357	140594357	PCDHB13	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11441	202
RREB1	6239	broad.mit.edu	37	6	7229251	7229251	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7229251C>T	uc003mxc.2	+	10	1309	c.919C>T	c.(919-921)CGG>TGG	p.R307W	RREB1_uc003mxb.2_Missense_Mutation_p.R307W|RREB1_uc010jnx.2_Missense_Mutation_p.R307W	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	307					multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				AACAAACCTGCGGAGGTGCAT	0.507													17	15	---	---	---	---	capture	Missense_Mutation	SNP	7229251	7229251	RREB1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	13571	202
TDP2	51567	broad.mit.edu	37	6	24658115	24658115	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:24658115T>C	uc003nej.2	-	4	467	c.442A>G	c.(442-444)ATA>GTA	p.I148V	TDP2_uc003nei.2_Missense_Mutation_p.I36V|TDP2_uc010jpu.1_Missense_Mutation_p.I148V	NM_016614	NP_057698	O95551	TYDP2_HUMAN	TRAF and TNF receptor-associated protein	148					cell surface receptor linked signaling pathway|double-strand break repair	PML body	5'-tyrosyl-DNA phosphodiesterase activity|magnesium ion binding|nuclease activity|protein binding|transcription corepressor activity			ovary(1)|lung(1)	2						TGTAGAAATATCACATCTGGG	0.313								Direct_reversal_of_damage|Editing_and_processing_nucleases					57	94	---	---	---	---	capture	Missense_Mutation	SNP	24658115	24658115	TDP2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	15614	202
MDC1	9656	broad.mit.edu	37	6	30671570	30671570	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30671570G>A	uc003nrg.3	-	10	5830	c.5390C>T	c.(5389-5391)TCT>TTT	p.S1797F	MDC1_uc003nrf.3_Missense_Mutation_p.S428F|MDC1_uc011dmp.1_Missense_Mutation_p.S1404F	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1797	Required for nuclear localization (NLS2).				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						GGTGAACCTAGATCTACCTGC	0.537								Other_conserved_DNA_damage_response_genes					81	187	---	---	---	---	capture	Missense_Mutation	SNP	30671570	30671570	MDC1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	9316	202
DST	667	broad.mit.edu	37	6	56566691	56566691	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56566691G>A	uc003pdf.2	-	7	878	c.850C>T	c.(850-852)CGC>TGC	p.R284C	DST_uc003pcz.3_Missense_Mutation_p.R106C|DST_uc011dxj.1_Missense_Mutation_p.R135C|DST_uc011dxk.1_Missense_Mutation_p.R146C|DST_uc011dxl.1_Missense_Mutation_p.R135C	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	106	CH 1.|Actin-binding.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATACCTGGCGTCTTTTCAAA	0.343													22	43	---	---	---	---	capture	Missense_Mutation	SNP	56566691	56566691	DST	6	G	A	A	A	1	0	0	0	0	1	0	0	0	508	40	1	1	4738	202
PMS2	5395	broad.mit.edu	37	7	6026906	6026906	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6026906C>T	uc003spl.2	-	11	1577	c.1490G>A	c.(1489-1491)GGC>GAC	p.G497D	PMS2_uc003spj.2_Missense_Mutation_p.G391D|PMS2_uc003spk.2_Missense_Mutation_p.G362D|PMS2_uc011jwl.1_Missense_Mutation_p.G362D|PMS2_uc010ktg.2_Missense_Mutation_p.G186D|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Missense_Mutation_p.G497D	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform	497					mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		GGAAGTGCTGCCGTGCCCCGA	0.632			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				4	211	---	---	---	---	capture	Missense_Mutation	SNP	6026906	6026906	PMS2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12046	202
TARP	445347	broad.mit.edu	37	7	38305013	38305013	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38305013C>T	uc003tge.1	-	5	1071	c.694G>A	c.(694-696)GTC>ATC	p.V232I	uc003tfz.1_Intron|TARP_uc003tgb.2_Missense_Mutation_p.V28I|TARP_uc003tgc.1_Missense_Mutation_p.V28I|TARP_uc003tgd.1_Missense_Mutation_p.V28I|TARP_uc010kxi.1_RNA|TARP_uc003tgf.1_RNA|TARP_uc003tgj.1_RNA|TARP_uc003tgh.1_RNA|TARP_uc003tgi.1_RNA|TARP_uc003tgg.1_RNA			A2JGV3	A2JGV3_HUMAN	Homo sapiens TCRgamma alternate reading frame protein (TCRg) mRNA, complete cds.	Error:Variant_position_missing_in_A2JGV3_after_alignment											0						TCATGTCTGACGATACATCTG	0.393													88	225	---	---	---	---	capture	Missense_Mutation	SNP	38305013	38305013	TARP	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15446	202
PCLO	27445	broad.mit.edu	37	7	82584287	82584287	+	Silent	SNP	T	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82584287T>C	uc003uhx.2	-	5	6271	c.5982A>G	c.(5980-5982)AGA>AGG	p.R1994R	PCLO_uc003uhv.2_Silent_p.R1994R	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1925					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GTTCTGAAAGTCTTATCTTTT	0.388													5	477	---	---	---	---	capture	Silent	SNP	82584287	82584287	PCLO	7	T	C	C	C	1	0	0	0	0	0	0	0	1	751	58	3	3	11486	202
TRRAP	8295	broad.mit.edu	37	7	98509724	98509724	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98509724G>A	uc003upp.2	+	18	2296	c.2087G>A	c.(2086-2088)CGC>CAC	p.R696H	TRRAP_uc011kis.1_Missense_Mutation_p.R696H|TRRAP_uc003upr.2_Missense_Mutation_p.R388H	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	696					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTCCTTGATCGCCTGCCAGAA	0.468													90	275	---	---	---	---	capture	Missense_Mutation	SNP	98509724	98509724	TRRAP	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16484	202
PLOD3	8985	broad.mit.edu	37	7	100852149	100852149	+	Silent	SNP	T	C	C			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100852149T>C	uc003uyd.2	-	16	2229	c.1773A>G	c.(1771-1773)TCA>TCG	p.S591S	PLOD3_uc010lhs.2_Silent_p.S156S	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	591					protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	GCCGGCCGCCTGACCACTGGC	0.582													3	104	---	---	---	---	capture	Silent	SNP	100852149	100852149	PLOD3	7	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	12006	202
KIAA1549	57670	broad.mit.edu	37	7	138603251	138603251	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138603251G>A	uc011kql.1	-	2	1170	c.1121C>T	c.(1120-1122)CCA>CTA	p.P374L	KIAA1549_uc003vuk.3_Missense_Mutation_p.P324L|KIAA1549_uc011kqj.1_Missense_Mutation_p.P374L	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	374						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						AACATCAGTTGGTGAAGCAGA	0.507			O	BRAF	pilocytic astrocytoma								13	258	---	---	---	---	capture	Missense_Mutation	SNP	138603251	138603251	KIAA1549	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	8166	202
TRPV5	56302	broad.mit.edu	37	7	142609825	142609825	+	Silent	SNP	A	G	G			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142609825A>G	uc003wby.1	-	13	1875	c.1611T>C	c.(1609-1611)TTT>TTC	p.F537F		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	537					protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					TAACAGTGAGAAAAAGCTCAA	0.502													43	150	---	---	---	---	capture	Silent	SNP	142609825	142609825	TRPV5	7	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	16482	202
ACCN3	9311	broad.mit.edu	37	7	150749681	150749681	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150749681C>T	uc003win.2	+	11	1906	c.1538C>T	c.(1537-1539)GCC>GTC	p.A513V	ACCN3_uc003wio.2_Missense_Mutation_p.P520S|ACCN3_uc003wip.2_Silent_p.C493C|ACCN3_uc003wiq.2_RNA	NM_004769	NP_004760	Q9UHC3	ACCN3_HUMAN	amiloride-sensitive cation channel 3 isoform a	513	Cytoplasmic (Potential).				sensory perception|signal transduction	cytoplasm|integral to plasma membrane	ligand-gated sodium channel activity			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCTCCCTGTGCCGTCACCAAG	0.632													6	221	---	---	---	---	capture	Missense_Mutation	SNP	150749681	150749681	ACCN3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	130	202
ECM2	1842	broad.mit.edu	37	9	95263237	95263237	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95263237A>G	uc004ash.2	-	9	1768	c.1703T>C	c.(1702-1704)ATT>ACT	p.I568T	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Missense_Mutation_p.I546T|ECM2_uc011lty.1_Missense_Mutation_p.I568T|ECM2_uc004asg.2_Missense_Mutation_p.I546T|ECM2_uc010mqz.1_5'UTR	NM_001393	NP_001384	O94769	ECM2_HUMAN	extracellular matrix protein 2 precursor	568	LRR 9.				cell-matrix adhesion		integrin binding			ovary(1)|skin(1)	2						GATCCGTTCAATCTGGTTCCC	0.478													10	144	---	---	---	---	capture	Missense_Mutation	SNP	95263237	95263237	ECM2	9	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	4853	202
RIBC1	158787	broad.mit.edu	37	X	53455349	53455349	+	Silent	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53455349G>A	uc004dsk.2	+	5	471	c.318G>A	c.(316-318)AAG>AAA	p.K106K	RIBC1_uc004dsj.1_Silent_p.K106K|RIBC1_uc011mog.1_Intron	NM_001031745	NP_001026915	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1 isoform 1	106	Potential.										0						AGCAGCTCAAGAACGGGCGTG	0.512													28	14	---	---	---	---	capture	Silent	SNP	53455349	53455349	RIBC1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	13244	202
CT45A5	441521	broad.mit.edu	37	X	134947910	134947910	+	Nonsense_Mutation	SNP	G	A	A	rs146235294	byFrequency	TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134947910G>A	uc004eze.2	-	3	660	c.415C>T	c.(415-417)CGA>TGA	p.R139*	CT45A5_uc011mvu.1_Nonsense_Mutation_p.R139*	NM_001007551	NP_001007552	Q6NSH3	CT455_HUMAN	cancer/testis antigen family 45, member A5	139											0						TACTTACTTCGTCCAAGGCAT	0.383													94	32	---	---	---	---	capture	Nonsense_Mutation	SNP	134947910	134947910	CT45A5	23	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	3953	202
AFF2	2334	broad.mit.edu	37	X	148069012	148069012	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:148069012G>A	uc004fcp.2	+	20	4218	c.3739G>A	c.(3739-3741)GTC>ATC	p.V1247I	AFF2_uc004fcq.2_Missense_Mutation_p.V1237I|AFF2_uc004fcr.2_Missense_Mutation_p.V1208I|AFF2_uc011mxb.1_Missense_Mutation_p.V1212I|AFF2_uc004fcs.2_Missense_Mutation_p.V1212I|AFF2_uc011mxc.1_Missense_Mutation_p.V888I	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	1247					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					TGCCAGCCACGTCAACATCAC	0.498													91	25	---	---	---	---	capture	Missense_Mutation	SNP	148069012	148069012	AFF2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	357	202
NR1H2	7376	broad.mit.edu	37	19	50882004	50882004	+	Frame_Shift_Del	DEL	C	-	-			TCGA-27-2524-01	TCGA-27-2524-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50882004delC	uc010enw.2	+	7	977	c.701delC	c.(700-702)GCCfs	p.A234fs	NR1H2_uc002prv.3_RNA|NR1H2_uc002prz.3_Frame_Shift_Del_p.A233fs|NR1H2_uc002psa.3_Frame_Shift_Del_p.A136fs	NM_007121	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	233	Ligand-binding (Potential).				negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of pinocytosis|negative regulation of transcription, DNA-dependent|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TTGGTGGCGGCCCAACTGCAG	0.612													20	103	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	50882004	50882004	NR1H2	19	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	10524	202
