Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CELA3B	23436	broad.mit.edu	37	1	22313121	22313121	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22313121G>A	uc001bfk.2	+	7	855	c.740G>A	c.(739-741)CGC>CAC	p.R247H	CELA3B_uc009vqf.2_Intron	NM_007352	NP_031378	P08861	CEL3B_HUMAN	elastase 3B, pancreatic preproprotein	247	Peptidase S1.				cholesterol metabolic process|proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						TGCAACACCCGCAGGAAGCCC	0.622													37	65	---	---	---	---	capture	Missense_Mutation	SNP	22313121	22313121	CELA3B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3182	205
ZNF683	257101	broad.mit.edu	37	1	26691223	26691223	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26691223G>A	uc001bmg.1	-	4	932	c.814C>T	c.(814-816)CGA>TGA	p.R272*	ZNF683_uc001bmh.1_Nonsense_Mutation_p.R272*|ZNF683_uc009vsj.1_Nonsense_Mutation_p.R272*	NM_173574	NP_775845	Q8IZ20	ZN683_HUMAN	zinc finger protein 683	272					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		CCTGGATTTCGGGCCTGGGAA	0.652													35	51	---	---	---	---	capture	Nonsense_Mutation	SNP	26691223	26691223	ZNF683	1	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	17968	205
SPTA1	6708	broad.mit.edu	37	1	158614117	158614117	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158614117C>T	uc001fst.1	-	30	4463	c.4264G>A	c.(4264-4266)GAC>AAC	p.D1422N		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1422	Spectrin 14.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GAACTTTTGTCATCTGACCTC	0.443													49	85	---	---	---	---	capture	Missense_Mutation	SNP	158614117	158614117	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	15008	205
OBSCN	84033	broad.mit.edu	37	1	228468436	228468436	+	Silent	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228468436C>T	uc009xez.1	+	30	8180	c.8136C>T	c.(8134-8136)GAC>GAT	p.D2712D	OBSCN_uc001hsn.2_Silent_p.D2712D|OBSCN_uc001hsp.1_Silent_p.D411D|OBSCN_uc001hsq.1_Translation_Start_Site	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2712	Ig-like 26.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCCCTGAAGACGCCGGCCTGT	0.692													4	36	---	---	---	---	capture	Silent	SNP	228468436	228468436	OBSCN	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10717	205
JMJD1C	221037	broad.mit.edu	37	10	64954062	64954062	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:64954062T>A	uc001jmn.2	-	14	6018	c.5718A>T	c.(5716-5718)CAA>CAT	p.Q1906H	JMJD1C_uc001jml.2_Missense_Mutation_p.Q1687H|JMJD1C_uc001jmm.2_Missense_Mutation_p.Q1618H|JMJD1C_uc010qiq.1_Missense_Mutation_p.Q1724H|JMJD1C_uc009xpi.2_Missense_Mutation_p.Q1724H|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc009xpk.1_Missense_Mutation_p.Q804H	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	1906					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					CAGGTATAATTTGGGTTGGCA	0.333													52	59	---	---	---	---	capture	Missense_Mutation	SNP	64954062	64954062	JMJD1C	10	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	7873	205
PDCD11	22984	broad.mit.edu	37	10	105204397	105204397	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105204397A>G	uc001kwy.1	+	35	5489	c.5402A>G	c.(5401-5403)TAT>TGT	p.Y1801C		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	1801	HAT 3.				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TGGTCGGTCTATATCGACATG	0.597													60	47	---	---	---	---	capture	Missense_Mutation	SNP	105204397	105204397	PDCD11	10	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	11520	205
CHID1	66005	broad.mit.edu	37	11	902312	902312	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:902312C>T	uc001lsl.2	-	4	441	c.280G>A	c.(280-282)GAT>AAT	p.D94N	CHID1_uc010qwu.1_Missense_Mutation_p.D124N|CHID1_uc010qwv.1_Missense_Mutation_p.D155N|CHID1_uc001lsn.2_Missense_Mutation_p.D119N|CHID1_uc001lsm.2_Missense_Mutation_p.D94N|CHID1_uc001lso.2_Missense_Mutation_p.D94N|CHID1_uc001lsp.2_Missense_Mutation_p.D94N|CHID1_uc010qww.1_Missense_Mutation_p.D94N	NM_023947	NP_076436	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1 isoform a	94					chitin catabolic process|innate immune response	extracellular region|lysosome	cation binding|chitinase activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		TTGGTGACATCGTAGCCATGG	0.562													27	57	---	---	---	---	capture	Missense_Mutation	SNP	902312	902312	CHID1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3310	205
WT1	7490	broad.mit.edu	37	11	32413578	32413578	+	Nonsense_Mutation	SNP	G	A	A	rs121907909		TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:32413578G>A	uc001mtn.1	-	9	1568	c.1372C>T	c.(1372-1374)CGA>TGA	p.R458*	WT1_uc001mtl.1_Nonsense_Mutation_p.R246*|WT1_uc001mtm.1_Nonsense_Mutation_p.R229*|WT1_uc001mto.1_Nonsense_Mutation_p.R458*|WT1_uc001mtp.1_Nonsense_Mutation_p.R441*|WT1_uc001mtq.1_Nonsense_Mutation_p.R441*|WT1_uc009yjs.1_RNA	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D	390	C2H2-type 3.				adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	p.R390*(9)|p.V380_S410del(1)	EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			GAGAACTTTCGCTGACAAGTT	0.458			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				123	268	---	---	---	---	capture	Nonsense_Mutation	SNP	32413578	32413578	WT1	11	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	17289	205
OR5W2	390148	broad.mit.edu	37	11	55681478	55681478	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55681478A>T	uc010rir.1	-	1	581	c.581T>A	c.(580-582)GTC>GAC	p.V194D		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TAACTCATTGACCTGTGTATC	0.393													60	116	---	---	---	---	capture	Missense_Mutation	SNP	55681478	55681478	OR5W2	11	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	11089	205
FOXM1	2305	broad.mit.edu	37	12	2975658	2975658	+	Silent	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:2975658G>A	uc001qlf.2	-	5	1141	c.876C>T	c.(874-876)CAC>CAT	p.H292H	FOXM1_uc001qle.2_Silent_p.H292H|FOXM1_uc001qlg.2_Silent_p.H292H|FOXM1_uc009zea.2_Silent_p.H291H|FOXM1_uc009zeb.2_Silent_p.H291H	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	forkhead box M1 isoform 2	292	Fork-head.				cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			CAAACATGTCGTGCAGGGAAA	0.502													29	52	---	---	---	---	capture	Silent	SNP	2975658	2975658	FOXM1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5962	205
FAM90A1	55138	broad.mit.edu	37	12	8376154	8376154	+	Splice_Site	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8376154C>T	uc001qui.2	-	6	883	c.324_splice	c.e6-1	p.R108_splice	FAM90A1_uc001quh.2_Splice_Site_p.R108_splice	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138								nucleic acid binding|zinc ion binding			ovary(1)	1				Kidney(36;0.0866)		GTCTTGTGGCCTGCAGAACAG	0.542													16	39	---	---	---	---	capture	Splice_Site	SNP	8376154	8376154	FAM90A1	12	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	5596	205
PTPRO	5800	broad.mit.edu	37	12	15650274	15650274	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:15650274G>A	uc001rcv.1	+	3	619	c.445G>A	c.(445-447)GTT>ATT	p.V149I	PTPRO_uc001rcw.1_Missense_Mutation_p.V149I|PTPRO_uc001rcu.1_Missense_Mutation_p.V149I	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	149	Fibronectin type-III 2.|Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				AAAATATAACGTTTTCACAAG	0.378													80	153	---	---	---	---	capture	Missense_Mutation	SNP	15650274	15650274	PTPRO	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12704	205
ANP32D	23519	broad.mit.edu	37	12	48866783	48866783	+	Missense_Mutation	SNP	A	C	C			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48866783A>C	uc010slt.1	+	1	336	c.336A>C	c.(334-336)TTA>TTC	p.L112F		NM_012404	NP_036536	O95626	AN32D_HUMAN	acidic nuclear phosphoprotein 32D	112								p.L112_E113>*(1)		ovary(1)|central_nervous_system(1)	2						TGAAAAAGTTAGAAAACCTCG	0.408													48	84	---	---	---	---	capture	Missense_Mutation	SNP	48866783	48866783	ANP32D	12	A	C	C	C	1	0	0	0	0	1	0	0	0	193	15	4	4	702	205
NR4A1	3164	broad.mit.edu	37	12	52451031	52451031	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52451031G>A	uc001rzs.2	+	6	1663	c.1349G>A	c.(1348-1350)CGC>CAC	p.R450H	NR4A1_uc010sno.1_Missense_Mutation_p.R463H|NR4A1_uc001rzt.2_Missense_Mutation_p.R450H|NR4A1_uc009zmc.2_Missense_Mutation_p.A64T	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	450	Ligand-binding (Potential).				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		TTCATCCTCCGCCTGGCGTAC	0.612													13	17	---	---	---	---	capture	Missense_Mutation	SNP	52451031	52451031	NR4A1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10539	205
EFS	10278	broad.mit.edu	37	14	23829158	23829158	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23829158C>T	uc001wjo.2	-	4	1137	c.529G>A	c.(529-531)GCC>ACC	p.A177T	EFS_uc001wjp.2_Missense_Mutation_p.A84T|EFS_uc010tnm.1_Missense_Mutation_p.A84T	NM_005864	NP_005855	O43281	EFS_HUMAN	embryonal Fyn-associated substrate isoform 1	177	Pro-rich.				cell adhesion|intracellular signal transduction	cytoplasm	SH3 domain binding			large_intestine(1)	1	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		GGCTGCGGGGCAACCCGGGTC	0.652													41	76	---	---	---	---	capture	Missense_Mutation	SNP	23829158	23829158	EFS	14	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	4914	205
CPPED1	55313	broad.mit.edu	37	16	12798557	12798557	+	Silent	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:12798557G>A	uc002dca.3	-	3	750	c.639C>T	c.(637-639)ATC>ATT	p.I213I	CPPED1_uc002dcb.3_Intron|CPPED1_uc002dbz.3_RNA	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain	213							hydrolase activity|metal ion binding				0						CGTCCTCGTCGATGCTCTCCA	0.602													46	83	---	---	---	---	capture	Silent	SNP	12798557	12798557	CPPED1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	3787	205
EFNB3	1949	broad.mit.edu	37	17	7612770	7612770	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7612770G>A	uc002gis.2	+	5	1296	c.899G>A	c.(898-900)GGC>GAC	p.G300D		NM_001406	NP_001397	Q15768	EFNB3_HUMAN	ephrin-B3 precursor	300	Cytoplasmic (Potential).				cell-cell signaling|interspecies interaction between organisms	integral to plasma membrane	ephrin receptor binding|transmembrane-ephrin receptor activity			ovary(1)	1		all_cancers(10;1.14e-06)|Prostate(122;0.081)				CTGCGGGGTGGCGGGGCTGCA	0.667													29	62	---	---	---	---	capture	Missense_Mutation	SNP	7612770	7612770	EFNB3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4912	205
DNAH2	146754	broad.mit.edu	37	17	7626952	7626952	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7626952G>A	uc002giu.1	+	2	187	c.173G>A	c.(172-174)CGG>CAG	p.R58Q	DNAH2_uc002git.2_Missense_Mutation_p.R58Q|DNAH2_uc010vuk.1_Missense_Mutation_p.R58Q	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	58	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTAGAGCCACGGTTGGAGGGA	0.393													18	49	---	---	---	---	capture	Missense_Mutation	SNP	7626952	7626952	DNAH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4559	205
ULK2	9706	broad.mit.edu	37	17	19705231	19705231	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19705231C>T	uc002gwm.3	-	16	1809	c.1300G>A	c.(1300-1302)GCA>ACA	p.A434T	ULK2_uc002gwn.2_Missense_Mutation_p.A434T	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	434					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CGTACCACTGCAGATCTGAAA	0.468													133	235	---	---	---	---	capture	Missense_Mutation	SNP	19705231	19705231	ULK2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	16858	205
UNC45B	146862	broad.mit.edu	37	17	33482349	33482349	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33482349G>A	uc002hja.2	+	7	771	c.674G>A	c.(673-675)CGA>CAA	p.R225Q	UNC45B_uc002hjb.2_Missense_Mutation_p.R225Q|UNC45B_uc002hjc.2_Missense_Mutation_p.R225Q|UNC45B_uc010cto.2_Missense_Mutation_p.R225Q	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	225	ARM 2.				cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				CGGATAGACCGAATCTGTAGC	0.562													40	93	---	---	---	---	capture	Missense_Mutation	SNP	33482349	33482349	UNC45B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16871	205
KRTAP4-7	100132476	broad.mit.edu	37	17	39240908	39240908	+	Silent	SNP	T	C	C			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240908T>C	uc010wfn.1	+	1	450	c.450T>C	c.(448-450)TGT>TGC	p.C150C		NM_033061	NP_149050			keratin associated protein 4-7												0						CCTTGTGCTGTGCCTCCTCTT	0.567													3	12	---	---	---	---	capture	Silent	SNP	39240908	39240908	KRTAP4-7	17	T	C	C	C	1	0	0	0	0	0	0	0	1	764	59	3	3	8475	205
RNF43	54894	broad.mit.edu	37	17	56439918	56439918	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56439918C>T	uc002iwf.2	-	5	2630	c.674G>A	c.(673-675)CGC>CAC	p.R225H	RNF43_uc010wnv.1_Missense_Mutation_p.R184H|RNF43_uc002iwh.3_Missense_Mutation_p.R225H|RNF43_uc002iwg.3_Missense_Mutation_p.R225H|RNF43_uc010dcw.2_Missense_Mutation_p.R98H	NM_017763	NP_060233	Q68DV7	RNF43_HUMAN	ring finger protein 43 precursor	225	Cytoplasmic (Potential).			R -> H (in Ref. 2; BAH12429).		endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCTGCTGTGGCGGGGGCGGCA	0.597													29	33	---	---	---	---	capture	Missense_Mutation	SNP	56439918	56439918	RNF43	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13387	205
BPTF	2186	broad.mit.edu	37	17	65889572	65889572	+	Silent	SNP	T	C	C			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65889572T>C	uc002jgf.2	+	6	2203	c.2142T>C	c.(2140-2142)TTT>TTC	p.F714F	BPTF_uc002jge.2_Silent_p.F840F|BPTF_uc010wqm.1_Silent_p.F777F	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	840	Interaction with MAZ.				brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			ACAATTATTTTAAATTGGGTC	0.373													41	54	---	---	---	---	capture	Silent	SNP	65889572	65889572	BPTF	17	T	C	C	C	1	0	0	0	0	0	0	0	1	790	61	3	3	1483	205
DSC1	1823	broad.mit.edu	37	18	28736074	28736074	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28736074G>A	uc002kwn.2	-	4	665	c.403C>T	c.(403-405)CGA>TGA	p.R135*	DSC1_uc002kwm.2_Nonsense_Mutation_p.R135*	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	135	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			GGAGCCCATCGTCTCTTGCTG	0.413													45	108	---	---	---	---	capture	Nonsense_Mutation	SNP	28736074	28736074	DSC1	18	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	4720	205
ALPK2	115701	broad.mit.edu	37	18	56171191	56171191	+	Missense_Mutation	SNP	A	C	C			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56171191A>C	uc002lhj.3	-	11	6433	c.6219T>G	c.(6217-6219)AGT>AGG	p.S2073R		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	2073	Alpha-type protein kinase.						ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						GGAGGCAGCCACTTGTTTTCT	0.522													93	204	---	---	---	---	capture	Missense_Mutation	SNP	56171191	56171191	ALPK2	18	A	C	C	C	1	0	0	0	0	1	0	0	0	76	6	4	4	545	205
SERPINB10	5273	broad.mit.edu	37	18	61585273	61585273	+	Silent	SNP	C	T	T	rs61761878	byFrequency	TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61585273C>T	uc010xev.1	+	4	399	c.309C>T	c.(307-309)AAC>AAT	p.N103N	SERPINB10_uc010xew.1_Silent_p.N103N	NM_005024	NP_005015	P48595	SPB10_HUMAN	serine (or cysteine) proteinase inhibitor, clade	103						cytoplasm|nucleus	serine-type endopeptidase inhibitor activity			lung(1)|kidney(1)|skin(1)	3		Esophageal squamous(42;0.131)				TCAAGCCCAACGATGACTACT	0.353													50	53	---	---	---	---	capture	Silent	SNP	61585273	61585273	SERPINB10	18	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13990	205
C3	718	broad.mit.edu	37	19	6681977	6681977	+	Missense_Mutation	SNP	T	G	G			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6681977T>G	uc002mfm.2	-	35	4387	c.4325A>C	c.(4324-4326)AAC>ACC	p.N1442T	C3_uc002mfl.2_Missense_Mutation_p.N178T	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1442	Properdin-binding.				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		GATGAGGGTGTTCCTATCGGA	0.532													75	237	---	---	---	---	capture	Missense_Mutation	SNP	6681977	6681977	C3	19	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	2184	205
LILRA2	11027	broad.mit.edu	37	19	55086977	55086977	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55086977G>A	uc002qgg.3	+	5	999	c.910G>A	c.(910-912)GAG>AAG	p.E304K	LILRA2_uc010ern.2_Missense_Mutation_p.E304K|LILRA2_uc002qgf.2_Missense_Mutation_p.E304K|LILRA2_uc010yfe.1_Missense_Mutation_p.E304K|LILRA2_uc010yff.1_Missense_Mutation_p.E292K|LILRA2_uc010ero.2_Missense_Mutation_p.E292K|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	304	Ig-like C2-type 3.|Extracellular (Potential).				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		CCTCTCCTCCGAGTGGTCGGC	0.677													32	131	---	---	---	---	capture	Missense_Mutation	SNP	55086977	55086977	LILRA2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8705	205
SLC4A5	57835	broad.mit.edu	37	2	74479508	74479508	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74479508C>T	uc002sko.1	-	11	1278	c.1276G>A	c.(1276-1278)GTG>ATG	p.V426M	SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.V426M|SLC4A5_uc010ffc.1_Missense_Mutation_p.V426M|SLC4A5_uc002skp.1_Missense_Mutation_p.V362M|SLC4A5_uc002sks.1_Missense_Mutation_p.V426M	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a	426	Cytoplasmic (Potential).					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						AGGGAGAACACAGATTTCCTG	0.433													16	72	---	---	---	---	capture	Missense_Mutation	SNP	74479508	74479508	SLC4A5	2	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	14549	205
UGGT1	56886	broad.mit.edu	37	2	128935427	128935427	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128935427G>A	uc002tps.2	+	33	3824	c.3646G>A	c.(3646-3648)GTG>ATG	p.V1216M	UGGT1_uc002tpr.2_Missense_Mutation_p.V1192M	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	1216					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						GGCAGATATGGTGAACGAAGA	0.398													75	168	---	---	---	---	capture	Missense_Mutation	SNP	128935427	128935427	UGGT1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	16823	205
SP110	3431	broad.mit.edu	37	2	231067312	231067312	+	Missense_Mutation	SNP	C	T	T	rs144163010		TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:231067312C>T	uc002vqh.3	-	9	1271	c.1031G>A	c.(1030-1032)CGA>CAA	p.R344Q	SP110_uc002vqg.3_Missense_Mutation_p.R344Q|SP110_uc002vqi.3_Missense_Mutation_p.R344Q|SP110_uc010fxk.2_Missense_Mutation_p.R342Q|SP110_uc010fxj.2_Intron	NM_004509	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform a	344					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TCTCGACTTTCGGGCACATTC	0.478													54	107	---	---	---	---	capture	Missense_Mutation	SNP	231067312	231067312	SP110	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14853	205
KIF1A	547	broad.mit.edu	37	2	241657468	241657468	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241657468G>A	uc002vzy.2	-	46	5175	c.5029C>T	c.(5029-5031)CGG>TGG	p.R1677W	KIF1A_uc010fzk.2_Missense_Mutation_p.R1778W|KIF1A_uc002vzw.2_Missense_Mutation_p.R338W|KIF1A_uc002vzx.2_Missense_Mutation_p.R404W	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles	1677					anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CGGCCCTACCGTATGGTCCCG	0.662													4	4	---	---	---	---	capture	Missense_Mutation	SNP	241657468	241657468	KIF1A	2	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	8205	205
NTSR1	4923	broad.mit.edu	37	20	61386135	61386135	+	Silent	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61386135C>T	uc002ydf.2	+	2	1184	c.813C>T	c.(811-813)GCC>GCT	p.A271A		NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1	271	Cytoplasmic (Potential).					endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			GCCAGGCGGCCGAGCAGGGCC	0.632													29	87	---	---	---	---	capture	Silent	SNP	61386135	61386135	NTSR1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10617	205
WDR48	57599	broad.mit.edu	37	3	39126186	39126186	+	Silent	SNP	T	G	G			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39126186T>G	uc003cit.2	+	13	1342	c.1332T>G	c.(1330-1332)TCT>TCG	p.S444S	WDR48_uc011ayt.1_Silent_p.S435S|WDR48_uc011ayu.1_Silent_p.S362S|WDR48_uc011ayv.1_Silent_p.S169S|WDR48_uc003ciu.2_RNA	NM_020839	NP_065890	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	444					interspecies interaction between organisms|protein deubiquitination	lysosome|nucleus	protein binding			ovary(1)|breast(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CCTGGGTTTCTGCAAAAGATG	0.363													28	86	---	---	---	---	capture	Silent	SNP	39126186	39126186	WDR48	3	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	17182	205
FBXL5	26234	broad.mit.edu	37	4	15626935	15626935	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15626935C>A	uc003goc.1	-	9	1893	c.1790G>T	c.(1789-1791)GGA>GTA	p.G597V	FBXL5_uc010idw.1_Missense_Mutation_p.G510V|FBXL5_uc003gob.1_Missense_Mutation_p.G471V|FBXL5_uc010idx.1_Missense_Mutation_p.G596V|FBXL5_uc003god.1_Missense_Mutation_p.G580V|FBXL5_uc010idy.1_Missense_Mutation_p.G597V	NM_012161	NP_036293	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5 isoform	597	LRR 5.				iron ion homeostasis|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|SCF ubiquitin ligase complex	iron ion binding|protein binding|ubiquitin-protein ligase activity				0						AAGTACACGTCCAGTCTCTTG	0.393													34	71	---	---	---	---	capture	Missense_Mutation	SNP	15626935	15626935	FBXL5	4	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	5668	205
NIPAL1	152519	broad.mit.edu	37	4	48037778	48037778	+	Silent	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48037778G>A	uc003gxw.2	+	6	888	c.822G>A	c.(820-822)CCG>CCA	p.P274P		NM_207330	NP_997213	Q6NVV3	NIPA3_HUMAN	NIPA-like domain containing 1	274	Helical; (Potential).					integral to membrane					0						ACAAACATCCGCTGGTCTTTG	0.428													6	125	---	---	---	---	capture	Silent	SNP	48037778	48037778	NIPAL1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10331	205
BMP3	651	broad.mit.edu	37	4	81967723	81967723	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:81967723G>T	uc003hmg.3	+	2	1468	c.1148G>T	c.(1147-1149)GGC>GTC	p.G383V		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	383					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						GCAGATATTGGCTGGAGTGAA	0.478													119	114	---	---	---	---	capture	Missense_Mutation	SNP	81967723	81967723	BMP3	4	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	1449	205
NDST4	64579	broad.mit.edu	37	4	115998108	115998108	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:115998108A>G	uc003ibu.2	-	2	764	c.85T>C	c.(85-87)TCT>CCT	p.S29P	NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	29	Helical; Signal-anchor for type II membrane protein; (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAATAGGCAGAAATGACAATG	0.358													19	44	---	---	---	---	capture	Missense_Mutation	SNP	115998108	115998108	NDST4	4	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	10165	205
UGT3A2	167127	broad.mit.edu	37	5	36035914	36035914	+	Silent	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36035914G>A	uc003jjz.1	-	7	1551	c.1458C>T	c.(1456-1458)CTC>CTT	p.L486L	UGT3A2_uc011cos.1_Silent_p.L452L|UGT3A2_uc011cot.1_Silent_p.L184L	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	486	Helical; (Potential).			L -> F (in Ref. 1; AAQ88782).		integral to membrane	glucuronosyltransferase activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CAAAAACGTCGAGCAGGTACT	0.612													30	33	---	---	---	---	capture	Silent	SNP	36035914	36035914	UGT3A2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	16846	205
SLCO6A1	133482	broad.mit.edu	37	5	101816115	101816115	+	Missense_Mutation	SNP	C	T	T	rs111320089	byFrequency;by1000genomes	TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101816115C>T	uc003knn.2	-	2	554	c.382G>A	c.(382-384)GTC>ATC	p.V128I	SLCO6A1_uc003kno.2_Missense_Mutation_p.V128I|SLCO6A1_uc003knp.2_Missense_Mutation_p.V128I|SLCO6A1_uc003knq.2_Missense_Mutation_p.V128I	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	128	Extracellular (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CCAATGCTGACATCTATAAGA	0.328													52	88	---	---	---	---	capture	Missense_Mutation	SNP	101816115	101816115	SLCO6A1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	14624	205
PCDHB5	26167	broad.mit.edu	37	5	140516912	140516912	+	Silent	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140516912C>T	uc003liq.2	+	1	2113	c.1896C>T	c.(1894-1896)CGC>CGT	p.R632R		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	632	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAGCGAGCGCGACGCGGCCA	0.692													39	45	---	---	---	---	capture	Silent	SNP	140516912	140516912	PCDHB5	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11448	205
ABLIM3	22885	broad.mit.edu	37	5	148586637	148586637	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148586637A>G	uc003lpy.2	+	6	766	c.515A>G	c.(514-516)CAC>CGC	p.H172R	ABLIM3_uc003lpz.1_Missense_Mutation_p.H172R|ABLIM3_uc003lqa.1_Missense_Mutation_p.H180R|ABLIM3_uc003lqb.2_Missense_Mutation_p.H172R|ABLIM3_uc003lqc.1_Missense_Mutation_p.H172R|ABLIM3_uc003lqd.1_Missense_Mutation_p.H172R|ABLIM3_uc003lqf.2_Missense_Mutation_p.H172R|ABLIM3_uc003lqe.1_Missense_Mutation_p.H172R	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	172	LIM zinc-binding 3.				axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGCAGTGGCACGTCAGCTGC	0.612													21	61	---	---	---	---	capture	Missense_Mutation	SNP	148586637	148586637	ABLIM3	5	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	96	205
GABRA1	2554	broad.mit.edu	37	5	161300296	161300296	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161300296C>A	uc010jiw.2	+	6	897	c.429C>A	c.(427-429)AAC>AAA	p.N143K	GABRA1_uc010jix.2_Missense_Mutation_p.N143K|GABRA1_uc010jiy.2_Missense_Mutation_p.N143K|GABRA1_uc003lyx.3_Missense_Mutation_p.N143K|GABRA1_uc010jiz.2_Missense_Mutation_p.N143K|GABRA1_uc010jja.2_Missense_Mutation_p.N143K|GABRA1_uc010jjb.2_Missense_Mutation_p.N143K	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	143	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	CCATGCCCAACAAACTCCTGC	0.473													20	58	---	---	---	---	capture	Missense_Mutation	SNP	161300296	161300296	GABRA1	5	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	6102	205
RARS	5917	broad.mit.edu	37	5	167919770	167919770	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167919770A>G	uc003lzx.2	+	3	328	c.287A>G	c.(286-288)GAA>GGA	p.E96G	RARS_uc011deo.1_5'UTR	NM_002887	NP_002878	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	96					arginyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|skin(1)	3	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		CCAGATTTGGAAAATCCTCCT	0.418													7	200	---	---	---	---	capture	Missense_Mutation	SNP	167919770	167919770	RARS	5	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	12953	205
SLC35D3	340146	broad.mit.edu	37	6	137245675	137245675	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:137245675G>T	uc003qhe.2	+	2	1257	c.1092G>T	c.(1090-1092)AGG>AGT	p.R364S		NM_001008783	NP_001008783	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	364					carbohydrate transport	integral to membrane				ovary(1)|central_nervous_system(1)	2	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		AAGAGGTCAGGGGCAGCCCCC	0.637													8	36	---	---	---	---	capture	Missense_Mutation	SNP	137245675	137245675	SLC35D3	6	G	T	T	T	1	0	0	0	0	1	0	0	0	555	43	4	4	14475	205
SYNE1	23345	broad.mit.edu	37	6	152751311	152751311	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152751311A>T	uc010kiw.2	-	36	5326	c.4724T>A	c.(4723-4725)CTT>CAT	p.L1575H	SYNE1_uc003qot.3_Missense_Mutation_p.L1582H|SYNE1_uc003qou.3_Missense_Mutation_p.L1575H|SYNE1_uc010kjb.1_Missense_Mutation_p.L1558H|SYNE1_uc003qow.2_Missense_Mutation_p.L870H	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1575	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGGAACAGCAAGTTTATCTTC	0.303										HNSCC(10;0.0054)			12	18	---	---	---	---	capture	Missense_Mutation	SNP	152751311	152751311	SYNE1	6	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	15333	205
C7orf26	79034	broad.mit.edu	37	7	6630085	6630085	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6630085G>C	uc003sqo.1	+	1	171	c.171G>C	c.(169-171)AAG>AAC	p.K57N	uc011jwy.1_5'Flank|C7orf26_uc003sqp.1_Missense_Mutation_p.K57N|C7orf26_uc003sqq.1_5'UTR	NM_024067	NP_076972	Q96N11	CG026_HUMAN	hypothetical protein LOC79034	57										ovary(1)	1		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		AGGTGCCCAAGGAGCGCAGCG	0.562													4	14	---	---	---	---	capture	Missense_Mutation	SNP	6630085	6630085	C7orf26	7	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	2358	205
DNAH11	8701	broad.mit.edu	37	7	21603893	21603893	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21603893C>T	uc003svc.2	+	6	1103	c.1072C>T	c.(1072-1074)CGC>TGC	p.R358C		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	358	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CCCACAGACACGCATATTAAT	0.443									Kartagener_syndrome				50	142	---	---	---	---	capture	Missense_Mutation	SNP	21603893	21603893	DNAH11	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4557	205
EGFR	1956	broad.mit.edu	37	7	55220274	55220274	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55220274C>T	uc003tqk.2	+	6	910	c.664C>T	c.(664-666)CGC>TGC	p.R222C	EGFR_uc003tqh.2_Missense_Mutation_p.R222C|EGFR_uc003tqi.2_Missense_Mutation_p.R222C|EGFR_uc003tqj.2_Missense_Mutation_p.R222C|EGFR_uc010kzg.1_Missense_Mutation_p.R177C|EGFR_uc011kco.1_Missense_Mutation_p.R169C|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	222	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.R222C(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GTGCTCCGGGCGCTGCCGTGG	0.597		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			719	171	---	---	---	---	capture	Missense_Mutation	SNP	55220274	55220274	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4922	205
SPAM1	6677	broad.mit.edu	37	7	123593667	123593667	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123593667G>A	uc003vld.2	+	4	445	c.43G>A	c.(43-45)GTT>ATT	p.V15I	SPAM1_uc003vle.2_Missense_Mutation_p.V15I|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.V15I|SPAM1_uc010lku.2_Missense_Mutation_p.V15I	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	15					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	CAGAAGCTTTGTTAAATCAAG	0.373													35	83	---	---	---	---	capture	Missense_Mutation	SNP	123593667	123593667	SPAM1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14878	205
CUL1	8454	broad.mit.edu	37	7	148484161	148484161	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148484161C>G	uc010lpg.2	+	13	1954	c.1428C>G	c.(1426-1428)CAC>CAG	p.H476Q	CUL1_uc003wey.2_Missense_Mutation_p.H476Q|CUL1_uc003wez.2_Missense_Mutation_p.H366Q|CUL1_uc003wfa.2_Missense_Mutation_p.H137Q	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	476					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GGCTCGTCCACCAGAACAGTG	0.448													42	83	---	---	---	---	capture	Missense_Mutation	SNP	148484161	148484161	CUL1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	233	18	4	4	4014	205
FAM75A6	389730	broad.mit.edu	37	9	43627428	43627428	+	Missense_Mutation	SNP	G	A	A	rs11261835	by1000genomes	TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:43627428G>A	uc011lrb.1	-	4	1288	c.1259C>T	c.(1258-1260)CCC>CTC	p.P420L		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	420						integral to membrane					0						GTGCAGAGAGGGGAGGCCCCA	0.498													10	299	---	---	---	---	capture	Missense_Mutation	SNP	43627428	43627428	FAM75A6	9	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	5568	205
ENG	2022	broad.mit.edu	37	9	130579436	130579436	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130579436T>C	uc004bsj.3	-	13	2146	c.1733A>G	c.(1732-1734)GAC>GGC	p.D578G	ENG_uc011mam.1_Missense_Mutation_p.D389G|ENG_uc004bsk.3_Missense_Mutation_p.D578G|uc004bsl.1_RNA	NM_001114753	NP_001108225	P17813	EGLN_HUMAN	endoglin isoform 1 precursor	578	Extracellular (Potential).				artery morphogenesis|BMP signaling pathway|cell adhesion|cell chemotaxis|central nervous system vasculogenesis|chronological cell aging|detection of hypoxia|extracellular matrix disassembly|heart looping|negative regulation of endothelial cell proliferation|negative regulation of nitric-oxide synthase activity|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of protein autophosphorylation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|patterning of blood vessels|positive regulation of BMP signaling pathway|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of systemic arterial blood pressure|positive regulation of transcription from RNA polymerase II promoter|regulation of cell adhesion|regulation of cell proliferation|regulation of transcription, DNA-dependent|regulation of transforming growth factor beta receptor signaling pathway|smooth muscle tissue development|transforming growth factor beta receptor signaling pathway|venous blood vessel morphogenesis|wound healing	cell surface|external side of plasma membrane|extracellular space|membrane fraction	activin binding|galactose binding|glycosaminoglycan binding|protein homodimerization activity|transforming growth factor beta binding|transforming growth factor beta receptor activity|transforming growth factor beta receptor, cytoplasmic mediator activity|transmembrane receptor activity|type I transforming growth factor beta receptor binding|type II transforming growth factor beta receptor binding				0						ACCAGACAGGTCAGGGCTGAT	0.572									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				18	14	---	---	---	---	capture	Missense_Mutation	SNP	130579436	130579436	ENG	9	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	5072	205
CACNA1B	774	broad.mit.edu	37	9	141006952	141006952	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:141006952A>G	uc004cog.2	+	39	5676	c.5531A>G	c.(5530-5532)CAT>CGT	p.H1844R	CACNA1B_uc004coi.2_Missense_Mutation_p.H1056R|CACNA1B_uc004cok.1_RNA|CACNA1B_uc010ncp.1_Missense_Mutation_p.H124R	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	1844	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	GTACCACCCCATAAGCGTAAG	0.577													13	31	---	---	---	---	capture	Missense_Mutation	SNP	141006952	141006952	CACNA1B	9	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	2515	205
CXorf22	170063	broad.mit.edu	37	X	35938122	35938122	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35938122G>A	uc004ddj.2	+	1	265	c.206G>A	c.(205-207)CGC>CAC	p.R69H	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	69										large_intestine(1)|lung(1)|ovary(1)	3						AATATTTGCCGCTGGAACCAG	0.582													26	16	---	---	---	---	capture	Missense_Mutation	SNP	35938122	35938122	CXorf22	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4062	205
CNTN2	6900	broad.mit.edu	37	1	205033757	205033758	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205033757_205033758delTG	uc001hbr.2	+	12	1667_1668	c.1398_1399delTG	c.(1396-1401)ACTGTAfs	p.T466fs	CNTN2_uc001hbq.1_Frame_Shift_Del_p.T357fs|CNTN2_uc001hbs.2_Frame_Shift_Del_p.T254fs	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	466_467	Ig-like C2-type 5.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ACAGAGTGACTGTAACTCCAGA	0.525													30	163	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	205033757	205033758	CNTN2	1	TG	-	-	-	1	0	1	0	1	0	0	0	0	704	55	5	5	3606	205
ATM	472	broad.mit.edu	37	11	108143569	108143572	+	Frame_Shift_Del	DEL	TCAA	-	-			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108143569_108143572delTCAA	uc001pkb.1	+	22	3659_3662	c.3274_3277delTCAA	c.(3274-3279)TCAATCfs	p.S1092fs	ATM_uc009yxr.1_Frame_Shift_Del_p.S1092fs	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1092_1093					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		GGCTGCAGAGTCAATCAATAGGTA	0.363			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			49	169	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	108143569	108143572	ATM	11	TCAA	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	1100	205
RAI14	26064	broad.mit.edu	37	5	34811182	34811182	+	Frame_Shift_Del	DEL	G	-	-			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:34811182delG	uc003jir.2	+	8	712	c.516delG	c.(514-516)CTGfs	p.L172fs	RAI14_uc010iur.2_Frame_Shift_Del_p.L172fs|RAI14_uc011coj.1_Frame_Shift_Del_p.L172fs|RAI14_uc010ius.1_Frame_Shift_Del_p.L101fs|RAI14_uc003jis.2_Frame_Shift_Del_p.L175fs|RAI14_uc003jit.2_Frame_Shift_Del_p.L172fs|RAI14_uc011cok.1_Frame_Shift_Del_p.L164fs	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	172	ANK 5.					cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					ACTTTCTCCTGGATCATGGAG	0.418													188	378	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	34811182	34811182	RAI14	5	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	12903	205
HIST1H2BE	8344	broad.mit.edu	37	6	26184206	26184207	+	In_Frame_Ins	INS	-	ATC	ATC			TCGA-27-2528-01	TCGA-27-2528-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26184206_26184207insATC	uc003ngt.2	+	1	183_184	c.183_184insATC	c.(181-186)insATC	p.62_63insI		NM_003523	NP_003514	P62807	H2B1C_HUMAN	histone cluster 1, H2be	62_63					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0						AAGCCATGGGGATCATGAATTC	0.574													88	257	---	---	---	---	capture_indel	In_Frame_Ins	INS	26184206	26184207	HIST1H2BE	6	-	ATC	ATC	ATC	1	0	1	1	0	0	0	0	0	522	41	5	5	7069	205
