Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MTOR	2475	broad.mit.edu	37	1	11188183	11188183	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11188183C>T	uc001asd.2	-	43	6032	c.5911G>A	c.(5911-5913)GCC>ACC	p.A1971T	MTOR_uc001asc.2_Missense_Mutation_p.A176T	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1971	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						TAGATGAGGGCCTGAGGGAAA	0.458													16	98	---	---	---	---	capture	Missense_Mutation	SNP	11188183	11188183	MTOR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9864	210
C1QC	714	broad.mit.edu	37	1	22973963	22973963	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22973963C>T	uc001bgc.3	+	3	528	c.425C>T	c.(424-426)GCG>GTG	p.A142V	C1QC_uc001bga.3_Missense_Mutation_p.A142V|C1QC_uc001bgb.2_Missense_Mutation_p.A142V	NM_172369	NP_758957	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	142	C1q.				complement activation, classical pathway|innate immune response|negative regulation of granulocyte differentiation|negative regulation of macrophage differentiation	collagen					0		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGATTCAACGCGGTCCTCACC	0.567													25	77	---	---	---	---	capture	Missense_Mutation	SNP	22973963	22973963	C1QC	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1939	210
SPOCD1	90853	broad.mit.edu	37	1	32279589	32279589	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32279589C>T	uc001bts.1	-	2	1404	c.1346G>A	c.(1345-1347)AGG>AAG	p.R449K	SPOCD1_uc001btu.2_Missense_Mutation_p.R449K|SPOCD1_uc001btv.2_Intron	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	449					transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TTCCTCTGGCCTGTCCTGGTG	0.567													55	171	---	---	---	---	capture	Missense_Mutation	SNP	32279589	32279589	SPOCD1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	14970	210
LPAR3	23566	broad.mit.edu	37	1	85331474	85331474	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85331474G>A	uc001dkl.2	-	1	369	c.330C>T	c.(328-330)GAC>GAT	p.D110D	LPAR3_uc009wcj.1_Silent_p.D110D	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	110	Helical; Name=3; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						TCAAGCTACTGTCCAGAAGCC	0.493													97	259	---	---	---	---	capture	Silent	SNP	85331474	85331474	LPAR3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	8822	210
WDR63	126820	broad.mit.edu	37	1	85564213	85564213	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85564213C>G	uc001dkt.2	+	13	1542	c.1351C>G	c.(1351-1353)CCT>GCT	p.P451A	WDR63_uc009wcl.2_Missense_Mutation_p.P412A	NM_145172	NP_660155	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	451										upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TATTTTTCAGCCTATGTTTCT	0.318													44	137	---	---	---	---	capture	Missense_Mutation	SNP	85564213	85564213	WDR63	1	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	17195	210
ADAM30	11085	broad.mit.edu	37	1	120438173	120438173	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120438173G>A	uc001eij.2	-	1	941	c.787C>T	c.(787-789)CGC>TGC	p.R263C		NM_021794	NP_068566	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30 preproprotein	263	Peptidase M12B.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		TATCCAACGCGTATTTTGTTA	0.358													54	150	---	---	---	---	capture	Missense_Mutation	SNP	120438173	120438173	ADAM30	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	248	210
FLG	2312	broad.mit.edu	37	1	152277058	152277058	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152277058C>T	uc001ezu.1	-	3	10340	c.10304G>A	c.(10303-10305)CGT>CAT	p.R3435H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3435	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGGTGTCCACGAATGGTGTC	0.602									Ichthyosis				150	459	---	---	---	---	capture	Missense_Mutation	SNP	152277058	152277058	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5867	210
PTEN	5728	broad.mit.edu	37	10	89690805	89690805	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89690805G>A	uc001kfb.2	+	5	1243	c.212G>A	c.(211-213)TGT>TAT	p.C71Y		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	71	Phosphatase tensin-type.		C -> Y (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.L70fs*7(4)|p.R55fs*1(4)|p.?(2)|p.C71fs*6(2)|p.Y27fs*1(2)|p.C71Y(2)|p.Y27_N212>Y(2)|p.C71fs*28(1)|p.F56fs*2(1)|p.C71W(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TCTTTTAGTTGTGCTGAAAGA	0.259		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			21	51	---	---	---	---	capture	Missense_Mutation	SNP	89690805	89690805	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	12633	210
CPN1	1369	broad.mit.edu	37	10	101835788	101835788	+	Silent	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:101835788C>T	uc001kql.2	-	2	560	c.300G>A	c.(298-300)TCG>TCA	p.S100S		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	100	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		ACAGAAACTCCGACAGCTGCA	0.582													28	79	---	---	---	---	capture	Silent	SNP	101835788	101835788	CPN1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3774	210
GTF2H1	2965	broad.mit.edu	37	11	18369172	18369172	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18369172C>G	uc001moi.2	+	9	1569	c.875C>G	c.(874-876)TCT>TGT	p.S292C	GTF2H1_uc001moh.2_Missense_Mutation_p.S292C|GTF2H1_uc009yhm.2_Missense_Mutation_p.S176C|GTF2H1_uc001moj.2_5'UTR	NM_001142307	NP_001135779	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1,	292				S -> P (in Ref. 2; BAB15621).	mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0						GCTTCCAATTCTAAATCCATA	0.358								NER					19	76	---	---	---	---	capture	Missense_Mutation	SNP	18369172	18369172	GTF2H1	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	6790	210
NUMA1	4926	broad.mit.edu	37	11	71729878	71729878	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71729878T>C	uc001orl.1	-	10	905	c.733A>G	c.(733-735)ACC>GCC	p.T245A	NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Missense_Mutation_p.T245A|NUMA1_uc001orm.1_Missense_Mutation_p.T245A|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Missense_Mutation_p.T245A|NUMA1_uc001oro.1_Missense_Mutation_p.T245A|NUMA1_uc009ysy.1_Missense_Mutation_p.T245A|NUMA1_uc001orp.2_Missense_Mutation_p.T245A|NUMA1_uc001orq.2_Missense_Mutation_p.T245A	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	245	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CCCTTCTCGGTGAGGAGCTTG	0.577			T	RARA	APL								3	192	---	---	---	---	capture	Missense_Mutation	SNP	71729878	71729878	NUMA1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	10657	210
MMP3	4314	broad.mit.edu	37	11	102713433	102713433	+	Missense_Mutation	SNP	G	A	A	rs151123532		TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102713433G>A	uc001phj.1	-	2	385	c.320C>T	c.(319-321)CCG>CTG	p.P107L		NM_002422	NP_002413	P08254	MMP3_HUMAN	matrix metalloproteinase 3 preproprotein	107					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			lung(1)|kidney(1)	2		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)|Simvastatin(DB00641)	CCTCCACTTCGGGATGCCAGG	0.473													58	75	---	---	---	---	capture	Missense_Mutation	SNP	102713433	102713433	MMP3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9578	210
KDM5A	5927	broad.mit.edu	37	12	416884	416884	+	Silent	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:416884C>T	uc001qif.1	-	23	4029	c.3666G>A	c.(3664-3666)AGG>AGA	p.R1222R	KDM5A_uc001qie.1_Silent_p.R1222R	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	1222					chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TAGTCTCTAGCCTGGGCCTTC	0.478			T 	NUP98	AML								32	87	---	---	---	---	capture	Silent	SNP	416884	416884	KDM5A	12	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	8055	210
RERGL	79785	broad.mit.edu	37	12	18237478	18237478	+	Missense_Mutation	SNP	C	T	T	rs61757396	byFrequency;by1000genomes	TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18237478C>T	uc001rdq.2	-	5	502	c.308G>A	c.(307-309)CGG>CAG	p.R103Q	RERGL_uc001rdr.2_Missense_Mutation_p.R102Q	NM_024730	NP_079006	Q9H628	RERGL_HUMAN	RERG/RAS-like	103	Small GTPase-like.				signal transduction	membrane	GTP binding|GTPase activity				0						TTGTGGCTCCCGGATTCTGTA	0.383													20	124	---	---	---	---	capture	Missense_Mutation	SNP	18237478	18237478	RERGL	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13128	210
LMO7	4008	broad.mit.edu	37	13	76301190	76301190	+	Missense_Mutation	SNP	G	A	A	rs140368500	byFrequency	TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:76301190G>A	uc010thv.1	+	4	1582	c.322G>A	c.(322-324)GTC>ATC	p.V108I	LMO7_uc001vjt.1_Missense_Mutation_p.V56I	NM_005358	NP_005349	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 1	108	CH.					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TAAACCTGGCGTCATTAAGAA	0.303													26	55	---	---	---	---	capture	Missense_Mutation	SNP	76301190	76301190	LMO7	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8775	210
C14orf39	317761	broad.mit.edu	37	14	60938273	60938273	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:60938273G>A	uc001xez.3	-	6	618	c.508C>T	c.(508-510)CGA>TGA	p.R170*	C14orf39_uc010apo.2_Intron	NM_174978	NP_777638	Q08AQ4	Q08AQ4_HUMAN	hypothetical protein LOC317761	170										ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTAATACCTCGAAATTTCATA	0.249													8	86	---	---	---	---	capture	Nonsense_Mutation	SNP	60938273	60938273	C14orf39	14	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	1758	210
RYR3	6263	broad.mit.edu	37	15	33855071	33855071	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33855071C>T	uc001zhi.2	+	11	1076	c.1006C>T	c.(1006-1008)CGA>TGA	p.R336*	RYR3_uc010bar.2_Nonsense_Mutation_p.R336*	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	336	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAGTCACAAGCGAGACATAGA	0.398													32	83	---	---	---	---	capture	Nonsense_Mutation	SNP	33855071	33855071	RYR3	15	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	13662	210
EXD1	161829	broad.mit.edu	37	15	41488149	41488149	+	Missense_Mutation	SNP	T	G	G			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41488149T>G	uc001znk.2	-	6	638	c.447A>C	c.(445-447)GAA>GAC	p.E149D	EXD1_uc010ucv.1_Missense_Mutation_p.E207D	NM_152596	NP_689809	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	149					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1						TTCTCTTGTCTTCTAGTATCA	0.378													45	116	---	---	---	---	capture	Missense_Mutation	SNP	41488149	41488149	EXD1	15	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	5252	210
CLCN7	1186	broad.mit.edu	37	16	1507256	1507256	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1507256T>C	uc002clv.2	-	9	931	c.821A>G	c.(820-822)AAG>AGG	p.K274R	CLCN7_uc002clw.2_Missense_Mutation_p.K250R	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	274						integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				TCAACTCACCTTGAAATCTCG	0.592													26	59	---	---	---	---	capture	Missense_Mutation	SNP	1507256	1507256	CLCN7	16	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	3433	210
MKL2	57496	broad.mit.edu	37	16	14234551	14234551	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:14234551C>G	uc010uza.1	+	3	243	c.88C>G	c.(88-90)CAT>GAT	p.H30D	MKL2_uc002dcg.2_Missense_Mutation_p.H30D	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein	Error:Variant_position_missing_in_Q9ULH7_after_alignment					cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						AGCTGTGGCTCATGAATTCCA	0.488													3	188	---	---	---	---	capture	Missense_Mutation	SNP	14234551	14234551	MKL2	16	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	9514	210
SETD1A	9739	broad.mit.edu	37	16	30977133	30977133	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30977133C>G	uc002ead.1	+	8	2617	c.1931C>G	c.(1930-1932)CCT>CGT	p.P644R		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	644	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						CCGCCGCCCCCTGAGTACCCC	0.577													17	40	---	---	---	---	capture	Missense_Mutation	SNP	30977133	30977133	SETD1A	16	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	14023	210
KRT36	8689	broad.mit.edu	37	17	39644595	39644595	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39644595C>T	uc002hwt.2	-	3	599	c.599G>A	c.(598-600)CGT>CAT	p.R200H		NM_003771	NP_003762	O76013	KRT36_HUMAN	keratin 36	200	Rod.|Coil 1B.					intermediate filament	protein binding|structural constituent of epidermis				0		Breast(137;0.000286)				CAGGATCCTACGCAGGCCGTT	0.577													26	64	---	---	---	---	capture	Missense_Mutation	SNP	39644595	39644595	KRT36	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8393	210
BCAS3	54828	broad.mit.edu	37	17	58756885	58756885	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:58756885C>T	uc002iyv.3	+	2	176	c.67C>T	c.(67-69)CGC>TGC	p.R23C	BCAS3_uc010wow.1_Missense_Mutation_p.R19C|BCAS3_uc002iyu.3_Missense_Mutation_p.R23C|BCAS3_uc002iyw.3_Missense_Mutation_p.R19C	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	23						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			AGTTGTGGTTCGCCCCCAGGC	0.383													7	396	---	---	---	---	capture	Missense_Mutation	SNP	58756885	58756885	BCAS3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1341	210
ABCA10	10349	broad.mit.edu	37	17	67212489	67212489	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67212489C>A	uc010dfa.1	-	8	1420	c.541G>T	c.(541-543)GGA>TGA	p.G181*	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_5'Flank|ABCA10_uc010dfc.1_Nonsense_Mutation_p.G73*	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	181					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TATGTCAATCCCCAGGAGAGC	0.328													54	211	---	---	---	---	capture	Nonsense_Mutation	SNP	67212489	67212489	ABCA10	17	C	A	A	A	1	0	0	0	0	0	1	0	0	286	22	5	4	29	210
KCNJ16	3773	broad.mit.edu	37	17	68128849	68128849	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:68128849G>A	uc002jin.2	+	5	1107	c.621G>A	c.(619-621)CGG>CGA	p.R207R	KCNJ16_uc002jio.2_Silent_p.R207R|KCNJ16_uc002jip.2_Silent_p.R207R|KCNJ16_uc002jiq.2_Silent_p.R239R	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	207	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					GTGATTTTCGGCCAAACCACG	0.468													4	148	---	---	---	---	capture	Silent	SNP	68128849	68128849	KCNJ16	17	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	7972	210
ZNF556	80032	broad.mit.edu	37	19	2877814	2877814	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2877814G>A	uc002lwp.1	+	4	945	c.858G>A	c.(856-858)CCG>CCA	p.P286P	ZNF556_uc002lwq.2_Silent_p.P285P	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	286					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGGAGACCGTATGAGTGCA	0.517													22	113	---	---	---	---	capture	Silent	SNP	2877814	2877814	ZNF556	19	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17866	210
CCDC105	126402	broad.mit.edu	37	19	15132710	15132710	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15132710G>A	uc002nae.2	+	6	1329	c.1230G>A	c.(1228-1230)CCG>CCA	p.P410P		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	410					microtubule cytoskeleton organization	microtubule				ovary(1)	1						CCCAACTCCCGGAGGCTGCGC	0.632													31	81	---	---	---	---	capture	Silent	SNP	15132710	15132710	CCDC105	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2714	210
CYP4F22	126410	broad.mit.edu	37	19	15648391	15648391	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15648391G>A	uc002nbh.3	+	6	634	c.467G>A	c.(466-468)CGT>CAT	p.R156H		NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,	156						endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						AGCCGGCACCGTCGCCTGCTG	0.542													42	139	---	---	---	---	capture	Missense_Mutation	SNP	15648391	15648391	CYP4F22	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4149	210
FFAR2	2867	broad.mit.edu	37	19	35940986	35940986	+	Silent	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35940986C>T	uc002nzg.2	+	2	450	c.370C>T	c.(370-372)CTG>TTG	p.L124L	FFAR2_uc010eea.2_Silent_p.L124L	NM_005306	NP_005297	O15552	FFAR2_HUMAN	free fatty acid receptor 2	124	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding			central_nervous_system(1)	1	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCGCCGGCCTCTGTATGGAGT	0.577													28	89	---	---	---	---	capture	Silent	SNP	35940986	35940986	FFAR2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	5774	210
MAP4K1	11184	broad.mit.edu	37	19	39098515	39098515	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39098515G>A	uc002oix.1	-	16	1254	c.1146C>T	c.(1144-1146)GAC>GAT	p.D382D	MAP4K1_uc002oiw.1_Translation_Start_Site|MAP4K1_uc002oiy.1_Silent_p.D382D|MAP4K1_uc010xug.1_Silent_p.D44D	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	382					activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGTCCACGTCGTCATAGTCAT	0.597													4	44	---	---	---	---	capture	Silent	SNP	39098515	39098515	MAP4K1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9173	210
DMPK	1760	broad.mit.edu	37	19	46275974	46275974	+	Silent	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46275974C>T	uc002pdd.1	-	9	1843	c.1299G>A	c.(1297-1299)CTG>CTA	p.L433L	DMPK_uc010xxs.1_Silent_p.L334L|DMPK_uc002pde.1_Silent_p.L428L|DMPK_uc002pdf.1_Silent_p.L423L|DMPK_uc002pdg.1_Silent_p.L418L|DMPK_uc002pdh.1_Silent_p.L418L|DMPK_uc002pdi.1_Silent_p.L449L|DMPK_uc010xxt.1_Silent_p.L418L	NM_001081563	NP_001075032	Q09013	DMPK_HUMAN	myotonic dystrophy protein kinase isoform 1	433					regulation of heart contraction		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)	3		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		GCTCGGCCTCCAGTTCCATGG	0.627													7	59	---	---	---	---	capture	Silent	SNP	46275974	46275974	DMPK	19	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	4542	210
ZNF831	128611	broad.mit.edu	37	20	57766702	57766702	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:57766702G>A	uc002yan.2	+	1	628	c.628G>A	c.(628-630)GGG>AGG	p.G210R		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	210						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					CGAGGGCGCCGGGGGCGGCCT	0.677													18	65	---	---	---	---	capture	Missense_Mutation	SNP	57766702	57766702	ZNF831	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	18061	210
IFNGR2	3460	broad.mit.edu	37	21	34799266	34799266	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:34799266T>C	uc002yrp.3	+	4	1136	c.488T>C	c.(487-489)TTT>TCT	p.F163S	IFNGR2_uc002yrq.3_Missense_Mutation_p.F182S|IFNGR2_uc010gma.2_Missense_Mutation_p.F84S|IFNGR2_uc002yrr.3_Missense_Mutation_p.F84S	NM_005534	NP_005525	P38484	INGR2_HUMAN	interferon gamma receptor 2 precursor	163	Extracellular (Potential).|Fibronectin type-III 2.				regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity				0					Interferon gamma-1b(DB00033)	TCCTCTCCCTTTGACATCGCT	0.443													137	472	---	---	---	---	capture	Missense_Mutation	SNP	34799266	34799266	IFNGR2	21	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	7475	210
BPIL2	254240	broad.mit.edu	37	22	32828360	32828360	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32828360G>A	uc003amn.2	-	10	1149	c.1149C>T	c.(1147-1149)TTC>TTT	p.F383F	BPIL2_uc010gwo.2_Intron|BPIL2_uc011amb.1_Silent_p.F107F	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	383						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						CCAGACTTACGAAGTCCATGG	0.517													14	57	---	---	---	---	capture	Silent	SNP	32828360	32828360	BPIL2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	1480	210
MYH9	4627	broad.mit.edu	37	22	36696181	36696181	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:36696181G>A	uc003apg.2	-	23	3199	c.2968C>T	c.(2968-2970)CTG>TTG	p.L990L	MYH9_uc003aph.1_Silent_p.L854L	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	990	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						ACCTTGGCCAGCTTGCAGTTC	0.662			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				28	95	---	---	---	---	capture	Silent	SNP	36696181	36696181	MYH9	22	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	9952	210
TMEM184B	25829	broad.mit.edu	37	22	38617546	38617546	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38617546C>T	uc003avf.1	-	9	1378	c.1154G>A	c.(1153-1155)CGC>CAC	p.R385H	TMEM184B_uc003avg.1_Missense_Mutation_p.R385H|TMEM184B_uc003avh.1_Missense_Mutation_p.R319H	NM_012264	NP_036396	Q9Y519	T184B_HUMAN	transmembrane protein 184B	385						integral to membrane					0	Melanoma(58;0.045)					GCTGTGGGAGCGGGAGAGGCC	0.652													5	29	---	---	---	---	capture	Missense_Mutation	SNP	38617546	38617546	TMEM184B	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15988	210
MEI1	150365	broad.mit.edu	37	22	42191460	42191460	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42191460G>C	uc003baz.1	+	29	3605	c.3580G>C	c.(3580-3582)GGT>CGT	p.G1194R	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_RNA|MEI1_uc003bbb.1_Missense_Mutation_p.G580R|MEI1_uc003bbc.1_Missense_Mutation_p.G562R|MEI1_uc010gym.1_Missense_Mutation_p.G527R|MEI1_uc003bbd.1_Intron|MEI1_uc010gyn.1_RNA|MEI1_uc003bbe.1_RNA|MEI1_uc003bbf.2_Missense_Mutation_p.G208R|MEI1_uc003bbg.2_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1	1194							binding			central_nervous_system(1)|skin(1)	2						TGAAGAGGTGGGTGATGTTCT	0.557													21	83	---	---	---	---	capture	Missense_Mutation	SNP	42191460	42191460	MEI1	22	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	9378	210
PANX2	56666	broad.mit.edu	37	22	50617532	50617532	+	Silent	SNP	C	T	T	rs145485598		TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50617532C>T	uc003bjn.3	+	3	1860	c.1860C>T	c.(1858-1860)AAC>AAT	p.N620N	PANX2_uc003bjp.3_Silent_p.N486N|PANX2_uc003bjo.3_Silent_p.N620N	NM_052839	NP_443071	Q96RD6	PANX2_HUMAN	pannexin 2 isoform 1	620	Cytoplasmic (Potential).				protein hexamerization|synaptic transmission	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity			breast(1)	1		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		TGAGCCGAAACGCCACACACC	0.716													9	12	---	---	---	---	capture	Silent	SNP	50617532	50617532	PANX2	22	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11325	210
FBLN2	2199	broad.mit.edu	37	3	13679189	13679189	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13679189G>A	uc011avb.1	+	17	3450	c.3325G>A	c.(3325-3327)GCG>ACG	p.A1109T	FBLN2_uc011auz.1_Missense_Mutation_p.A1135T|FBLN2_uc011ava.1_Missense_Mutation_p.A1156T|FBLN2_uc011avc.1_Missense_Mutation_p.A1156T	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	1109	Domain III.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CATTGGCCCCGCGCCAGCCTT	0.622													12	35	---	---	---	---	capture	Missense_Mutation	SNP	13679189	13679189	FBLN2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5645	210
SCN10A	6336	broad.mit.edu	37	3	38833608	38833608	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38833608G>A	uc003ciq.2	-	2	322	c.322C>T	c.(322-324)CGG>TGG	p.R108W		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	108					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	CACAGGGCCCGAGTGGCACTA	0.463													67	226	---	---	---	---	capture	Missense_Mutation	SNP	38833608	38833608	SCN10A	3	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	13805	210
CCDC71	64925	broad.mit.edu	37	3	49200468	49200468	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49200468T>C	uc003cwg.3	-	2	1312	c.1174A>G	c.(1174-1176)AGG>GGG	p.R392G		NM_022903	NP_075054	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	392										ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCCTCAGCCCTTTTCCTCTTC	0.572													4	326	---	---	---	---	capture	Missense_Mutation	SNP	49200468	49200468	CCDC71	3	T	C	C	C	1	0	0	0	0	1	0	0	0	726	56	3	3	2818	210
GPR128	84873	broad.mit.edu	37	3	100365559	100365559	+	Silent	SNP	T	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:100365559T>C	uc003duc.2	+	10	1525	c.1257T>C	c.(1255-1257)GCT>GCC	p.A419A	GPR128_uc011bhc.1_Silent_p.A120A	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	419	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						CTAATTTTGCTGTATTAATGG	0.413													27	89	---	---	---	---	capture	Silent	SNP	100365559	100365559	GPR128	3	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	6575	210
PHLDB2	90102	broad.mit.edu	37	3	111603461	111603461	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111603461G>C	uc010hqa.2	+	2	948	c.537G>C	c.(535-537)ATG>ATC	p.M179I	PHLDB2_uc003dyc.2_Missense_Mutation_p.M206I|PHLDB2_uc003dyd.2_Missense_Mutation_p.M179I|PHLDB2_uc003dyg.2_Missense_Mutation_p.M179I|PHLDB2_uc003dyh.2_Missense_Mutation_p.M179I|PHLDB2_uc003dye.3_Missense_Mutation_p.M179I|PHLDB2_uc003dyf.3_Missense_Mutation_p.M179I	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	179						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						TCCTGGCCATGTGGAATGGAA	0.537													3	118	---	---	---	---	capture	Missense_Mutation	SNP	111603461	111603461	PHLDB2	3	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	11755	210
CASR	846	broad.mit.edu	37	3	122003132	122003132	+	Silent	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122003132C>T	uc003eev.3	+	7	2703	c.2331C>T	c.(2329-2331)ATC>ATT	p.I777I	CASR_uc003eew.3_Silent_p.I787I	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	777	Helical; Name=5; (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GCTTCCTGATCGGCTACACCT	0.582													16	42	---	---	---	---	capture	Silent	SNP	122003132	122003132	CASR	3	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	2658	210
UGT2B28	54490	broad.mit.edu	37	4	70146911	70146911	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70146911G>T	uc003hej.2	+	1	695	c.693G>T	c.(691-693)AAG>AAT	p.K231N	UGT2B28_uc010ihr.2_Missense_Mutation_p.K231N	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	231					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	ATATGAAGAAGTGGGATCAGT	0.323													45	174	---	---	---	---	capture	Missense_Mutation	SNP	70146911	70146911	UGT2B28	4	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	16842	210
INTS12	57117	broad.mit.edu	37	4	106604288	106604288	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:106604288C>T	uc003hxw.2	-	8	1249	c.991G>A	c.(991-993)GTG>ATG	p.V331M	INTS12_uc010ilr.2_Missense_Mutation_p.V331M	NM_020395	NP_065128	Q96CB8	INT12_HUMAN	integrator complex subunit 12	331	Ser-rich.				snRNA processing	integrator complex	protein binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		GTCAAACCCACAGGTTTCTGG	0.448													87	262	---	---	---	---	capture	Missense_Mutation	SNP	106604288	106604288	INTS12	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	7700	210
CDH18	1016	broad.mit.edu	37	5	19544080	19544080	+	Missense_Mutation	SNP	A	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19544080A>T	uc003jgc.2	-	8	1665	c.1288T>A	c.(1288-1290)TTT>ATT	p.F430I	CDH18_uc003jgd.2_Missense_Mutation_p.F430I|CDH18_uc011cnm.1_Missense_Mutation_p.F430I	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	430	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ATGTTGAAAAATCTGTCGTCT	0.353													30	87	---	---	---	---	capture	Missense_Mutation	SNP	19544080	19544080	CDH18	5	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	3074	210
MAP1B	4131	broad.mit.edu	37	5	71490832	71490832	+	Silent	SNP	A	G	G			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71490832A>G	uc003kbw.3	+	5	1891	c.1650A>G	c.(1648-1650)AAA>AAG	p.K550K	MAP1B_uc010iyw.1_Silent_p.K567K|MAP1B_uc010iyx.1_Silent_p.K424K|MAP1B_uc010iyy.1_Silent_p.K424K	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	550						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CAGCCGCAAAACCACTTCCTA	0.493													14	23	---	---	---	---	capture	Silent	SNP	71490832	71490832	MAP1B	5	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	9142	210
HIST1H2BA	255626	broad.mit.edu	37	6	25727356	25727356	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25727356C>T	uc003nfd.2	+	1	220	c.220C>T	c.(220-222)CGT>TGT	p.R74C	HIST1H2AA_uc003nfc.2_5'Flank	NM_170610	NP_733759	Q96A08	H2B1A_HUMAN	histone cluster 1, H2ba	74					nucleosome assembly	nucleosome|nucleus	DNA binding			kidney(1)	1						TATCTTTGAGCGTATAGCGAG	0.483													47	102	---	---	---	---	capture	Missense_Mutation	SNP	25727356	25727356	HIST1H2BA	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7065	210
TRIM10	10107	broad.mit.edu	37	6	30121907	30121907	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30121907G>A	uc003npo.3	-	7	1361	c.1285C>T	c.(1285-1287)CGG>TGG	p.R429W	TRIM10_uc003npn.2_Intron	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN	tripartite motif-containing 10 isoform 1	429	B30.2/SPRY.					cytoplasm	zinc ion binding				0						CTCACCTGCCGGGGCTGCTCC	0.642													6	47	---	---	---	---	capture	Missense_Mutation	SNP	30121907	30121907	TRIM10	6	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16369	210
MICB	4277	broad.mit.edu	37	6	31474137	31474137	+	Silent	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31474137C>T	uc003ntn.3	+	3	659	c.543C>T	c.(541-543)CGC>CGT	p.R181R	MICB_uc011dnm.1_Silent_p.R149R|MICB_uc003nto.3_Silent_p.R138R	NM_005931	NP_005922	Q29980	MICB_HUMAN	MHC class I polypeptide-related sequence B	181	Extracellular (Potential).				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding				0						CACACTATCGCGCTATGCAGG	0.532													25	56	---	---	---	---	capture	Silent	SNP	31474137	31474137	MICB	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9487	210
MEP1A	4224	broad.mit.edu	37	6	46797155	46797155	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46797155G>A	uc010jzh.1	+	10	1033	c.991G>A	c.(991-993)GAG>AAG	p.E331K	MEP1A_uc011dwg.1_Missense_Mutation_p.E53K|MEP1A_uc011dwh.1_Missense_Mutation_p.E359K|MEP1A_uc011dwi.1_Missense_Mutation_p.E231K	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	331	Extracellular (Potential).|MAM.				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			AGCCCTACTGGAGTCTCGGAT	0.532													47	161	---	---	---	---	capture	Missense_Mutation	SNP	46797155	46797155	MEP1A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	9388	210
GPR116	221395	broad.mit.edu	37	6	46845996	46845996	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46845996C>A	uc003oyo.3	-	10	1472	c.1183G>T	c.(1183-1185)GGT>TGT	p.G395C	GPR116_uc003oyp.3_Intron|GPR116_uc003oyq.3_Missense_Mutation_p.G395C|GPR116_uc010jzi.1_Missense_Mutation_p.G67C|GPR116_uc003oyr.2_Missense_Mutation_p.G395C	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	395	Ig-like 2.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			TTAACATTACCCTGACTGCAG	0.373													30	139	---	---	---	---	capture	Missense_Mutation	SNP	46845996	46845996	GPR116	6	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	6567	210
SYNE1	23345	broad.mit.edu	37	6	152527476	152527476	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152527476G>A	uc010kiw.2	-	126	23448	c.22846C>T	c.(22846-22848)CGG>TGG	p.R7616W	SYNE1_uc010kiv.2_Missense_Mutation_p.R2140W|SYNE1_uc003qos.3_Missense_Mutation_p.R2140W|SYNE1_uc003qot.3_Missense_Mutation_p.R7545W|SYNE1_uc003qou.3_Missense_Mutation_p.R7616W|SYNE1_uc003qor.3_Missense_Mutation_p.R516W	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7616	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTTGTTGCCGCAGAAACACT	0.483										HNSCC(10;0.0054)			26	109	---	---	---	---	capture	Missense_Mutation	SNP	152527476	152527476	SYNE1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	15333	210
UNC93A	54346	broad.mit.edu	37	6	167709567	167709567	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167709567C>T	uc003qvq.2	+	3	492	c.317C>T	c.(316-318)CCG>CTG	p.P106L	UNC93A_uc003qvr.2_Missense_Mutation_p.P106L	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1	106	Helical; (Potential).					integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GGGGCCGCCCCGCTGTGGTCT	0.557													41	126	---	---	---	---	capture	Missense_Mutation	SNP	167709567	167709567	UNC93A	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16878	210
SDK1	221935	broad.mit.edu	37	7	4153883	4153883	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4153883T>C	uc003smx.2	+	25	3939	c.3800T>C	c.(3799-3801)GTG>GCG	p.V1267A	SDK1_uc010kso.2_Missense_Mutation_p.V543A	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1267	Fibronectin type-III 6.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGCGAGGTGGTGCGGGGCCGG	0.637													6	23	---	---	---	---	capture	Missense_Mutation	SNP	4153883	4153883	SDK1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	13861	210
ZNF679	168417	broad.mit.edu	37	7	63727109	63727109	+	Silent	SNP	T	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:63727109T>A	uc003tsx.2	+	5	1367	c.1098T>A	c.(1096-1098)ACT>ACA	p.T366T		NM_153363	NP_699194	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	366	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TCTCCTCAACTCTTAATACTC	0.378													5	47	---	---	---	---	capture	Silent	SNP	63727109	63727109	ZNF679	7	T	A	A	A	1	0	0	0	0	0	0	0	1	691	54	4	4	17964	210
MUC17	140453	broad.mit.edu	37	7	100696360	100696360	+	Silent	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100696360C>T	uc003uxp.1	+	10	13250	c.13197C>T	c.(13195-13197)GTC>GTT	p.V4399V	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4399	Helical; (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GGGCAGGGGTCGTGCTGATGC	0.587													30	113	---	---	---	---	capture	Silent	SNP	100696360	100696360	MUC17	7	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	9884	210
OR2A1	346528	broad.mit.edu	37	7	143929644	143929644	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143929644G>A	uc011kub.1	-	1	293	c.293C>T	c.(292-294)ACG>ATG	p.T98M		NM_001005287	NP_001005287	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Melanoma(164;0.14)					AAAGGTCTGCGTCATGCAACC	0.572													45	43	---	---	---	---	capture	Missense_Mutation	SNP	143929644	143929644	OR2A1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10878	210
NOBOX	135935	broad.mit.edu	37	7	144098530	144098530	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144098530G>A	uc011kue.1	-	4	453	c.453C>T	c.(451-453)ACC>ACT	p.T151T		NM_001080413	NP_001073882	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	151					cell differentiation|oogenesis	nucleus	sequence-specific DNA binding			ovary(1)	1	Melanoma(164;0.14)					CATCAGCCCCGGTGGCTTCTC	0.637													8	42	---	---	---	---	capture	Silent	SNP	144098530	144098530	NOBOX	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10419	210
CALB1	793	broad.mit.edu	37	8	91094855	91094855	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:91094855T>C	uc003yel.1	-	1	253	c.71A>G	c.(70-72)GAC>GGC	p.D24G	CALB1_uc003yem.1_Intron|CALB1_uc011lge.1_5'Flank	NM_004929	NP_004920	P05937	CALB1_HUMAN	calbindin 1	24	1.|EF-hand 1.					nucleus	calcium ion binding|vitamin D binding			pancreas(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.00953)			ACCGTCAGCGTCGAAATGGAG	0.502													3	189	---	---	---	---	capture	Missense_Mutation	SNP	91094855	91094855	CALB1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	2549	210
ASAP1	50807	broad.mit.edu	37	8	131140283	131140283	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:131140283C>T	uc003yta.1	-	15	1299	c.1271G>A	c.(1270-1272)CGT>CAT	p.R424H	ASAP1_uc003ysz.1_Missense_Mutation_p.R235H|ASAP1_uc011liw.1_Missense_Mutation_p.R417H	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	424					cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CTGCTCTCCACGGAAGGCCAT	0.458													20	88	---	---	---	---	capture	Missense_Mutation	SNP	131140283	131140283	ASAP1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1001	210
ANKS6	203286	broad.mit.edu	37	9	101530471	101530471	+	Missense_Mutation	SNP	T	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101530471T>A	uc004ayu.2	-	11	2055	c.2034A>T	c.(2032-2034)TTA>TTT	p.L678F	ANKS6_uc004ayt.2_Missense_Mutation_p.L377F|ANKS6_uc004ayv.1_Missense_Mutation_p.L140F|ANKS6_uc004ayw.1_Missense_Mutation_p.L260F|ANKS6_uc004ayx.1_RNA|ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	678	Ser-rich.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)				TCTGCTCCAATAATCCGGCTG	0.582													17	80	---	---	---	---	capture	Missense_Mutation	SNP	101530471	101530471	ANKS6	9	T	A	A	A	1	0	0	0	0	1	0	0	0	634	49	4	4	686	210
SMC2	10592	broad.mit.edu	37	9	106889054	106889054	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:106889054G>A	uc004bbv.2	+	19	2872	c.2584G>A	c.(2584-2586)GCT>ACT	p.A862T	SMC2_uc004bbw.2_Missense_Mutation_p.A862T|SMC2_uc011lvl.1_Missense_Mutation_p.A862T|SMC2_uc004bbx.2_Missense_Mutation_p.A862T|SMC2_uc004bby.2_5'Flank	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	862	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						AGCTGAGGTGGCTAAAAATAA	0.338													4	104	---	---	---	---	capture	Missense_Mutation	SNP	106889054	106889054	SMC2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14675	210
COL27A1	85301	broad.mit.edu	37	9	117014903	117014903	+	Missense_Mutation	SNP	G	A	A	rs141446597		TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117014903G>A	uc011lxl.1	+	26	3064	c.3064G>A	c.(3064-3066)GTG>ATG	p.V1022M	COL27A1_uc004bii.2_RNA	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	1022	Pro-rich.|Collagen-like 7.|Triple-helical region.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						ACCCCCAGGCGTGCCTGGACC	0.607													51	176	---	---	---	---	capture	Missense_Mutation	SNP	117014903	117014903	COL27A1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3650	210
FAM47B	170062	broad.mit.edu	37	X	34962109	34962109	+	Silent	SNP	G	A	A			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:34962109G>A	uc004ddi.1	+	1	1179	c.1161G>A	c.(1159-1161)CCG>CCA	p.P387P		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	387										ovary(3)|breast(1)	4						AATCCTGTCCGCGGCCTTTTG	0.567													27	19	---	---	---	---	capture	Silent	SNP	34962109	34962109	FAM47B	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5518	210
DEPDC7	91614	broad.mit.edu	37	11	33049298	33049299	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:33049298_33049299delTC	uc001mub.2	+	3	623_624	c.531_532delTC	c.(529-534)AATCTGfs	p.N177fs	DEPDC7_uc010reh.1_Frame_Shift_Del_p.N177fs|DEPDC7_uc001muc.2_Frame_Shift_Del_p.N168fs	NM_001077242	NP_001070710	Q96QD5	DEPD7_HUMAN	novel 58.3 KDA protein isoform 1	177_178					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|skin(1)	2						TGTGggaaaatctgagtttaaa	0.287													23	54	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	33049298	33049299	DEPDC7	11	TC	-	-	-	1	0	1	0	1	0	0	0	0	647	50	5	5	4402	210
NF1	4763	broad.mit.edu	37	17	29496924	29496927	+	Frame_Shift_Del	DEL	TGTT	-	-			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29496924_29496927delTGTT	uc002hgg.2	+	5	828_831	c.495_498delTGTT	c.(493-498)ACTGTTfs	p.T165fs	NF1_uc002hge.1_Frame_Shift_Del_p.T165fs|NF1_uc002hgf.1_Frame_Shift_Del_p.T165fs|NF1_uc002hgh.2_Frame_Shift_Del_p.T165fs|NF1_uc010csn.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	165_166					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.C167fs*10(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGGAATTAACTGTTTGTTCAGAAG	0.225			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			25	64	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	29496924	29496927	NF1	17	TGTT	-	-	-	1	0	1	0	1	0	0	0	0	704	55	5	5	10263	210
HIST1H2BE	8344	broad.mit.edu	37	6	26184091	26184093	+	In_Frame_Del	DEL	AGA	-	-			TCGA-28-2502-01	TCGA-28-2502-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26184091_26184093delAGA	uc003ngt.2	+	1	68_70	c.68_70delAGA	c.(67-72)CAGAAG>CAG	p.K25del		NM_003523	NP_003514	P62807	H2B1C_HUMAN	histone cluster 1, H2be	25					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0						ACCAAGGCGCAGAAGAAGGACGG	0.576													49	181	---	---	---	---	capture_indel	In_Frame_Del	DEL	26184091	26184093	HIST1H2BE	6	AGA	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	7069	210
