Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FLG	2312	broad.mit.edu	37	1	152280065	152280065	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152280065T>C	uc001ezu.1	-	3	7333	c.7297A>G	c.(7297-7299)ACC>GCC	p.T2433A		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2433	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGTGCTGGTCCCGGTCCGT	0.597									Ichthyosis				37	258	---	---	---	---	capture	Missense_Mutation	SNP	152280065	152280065	FLG	1	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	5867	212
HMCN1	83872	broad.mit.edu	37	1	186057366	186057366	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186057366C>T	uc001grq.1	+	62	9764	c.9535C>T	c.(9535-9537)CCA>TCA	p.P3179S		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3179	Ig-like C2-type 30.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CACTGGGATCCCACCTCCCAC	0.433													3	40	---	---	---	---	capture	Missense_Mutation	SNP	186057366	186057366	HMCN1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7145	212
PTEN	5728	broad.mit.edu	37	10	89711900	89711900	+	Missense_Mutation	SNP	G	A	A	rs121913294		TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711900G>A	uc001kfb.2	+	7	1549	c.518G>A	c.(517-519)CGC>CAC	p.R173H		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	173	Phosphatase tensin-type.		R -> C (in endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3; retains ability to bind phospholipid membranes).|R -> P (loss of phosphatase activity towards Ins(1,3,4,5)P4).|R -> H (loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R173C(32)|p.R173H(22)|p.R55fs*1(4)|p.V166fs*17(3)|p.?(3)|p.G165fs*9(3)|p.R173fs*10(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G165_K342del(1)|p.G165_*404del(1)|p.R173R(1)|p.R173P(1)|p.R172fs*5(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGTCAGAGGCGCTATGTGTAT	0.348	R173H(RL952_ENDOMETRIUM)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			16	100	---	---	---	---	capture	Missense_Mutation	SNP	89711900	89711900	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12633	212
POLL	27343	broad.mit.edu	37	10	103342623	103342623	+	Missense_Mutation	SNP	C	T	T	rs146112511		TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103342623C>T	uc001ktg.1	-	6	1857	c.1091G>A	c.(1090-1092)CGC>CAC	p.R364H	DPCD_uc010qpz.1_Intron|POLL_uc001ktd.1_Missense_Mutation_p.R37H|POLL_uc001kte.1_Missense_Mutation_p.R56H|POLL_uc001kth.1_Missense_Mutation_p.R89H|POLL_uc001kti.1_Missense_Mutation_p.R364H|POLL_uc001ktj.1_Missense_Mutation_p.R364H|POLL_uc001ktf.2_Missense_Mutation_p.R272H|POLL_uc001ktk.1_Missense_Mutation_p.R103H|POLL_uc010qqa.1_Missense_Mutation_p.R103H|POLL_uc010qqb.1_RNA|POLL_uc001ktm.2_Missense_Mutation_p.R364H|POLL_uc001ktl.2_Missense_Mutation_p.R276H|POLL_uc010qqc.1_Missense_Mutation_p.R56H	NM_013274	NP_037406	Q9UGP5	DPOLL_HUMAN	DNA-directed DNA polymerase lambda	364					DNA replication|nucleotide-excision repair|somatic hypermutation of immunoglobulin genes	nucleus	DNA binding|DNA-directed DNA polymerase activity|lyase activity|metal ion binding				0		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		GGCCTGGCTGCGGATGTCTTC	0.552								DNA_polymerases_(catalytic_subunits)					3	54	---	---	---	---	capture	Missense_Mutation	SNP	103342623	103342623	POLL	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12108	212
C10orf96	374355	broad.mit.edu	37	10	118084588	118084588	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118084588G>A	uc001lck.2	+	2	316	c.65G>A	c.(64-66)CGT>CAT	p.R22H		NM_198515	NP_940917	P0C7W6	CJ096_HUMAN	hypothetical protein LOC374355	22	Potential.									ovary(2)	2		Lung NSC(174;0.204)|all_lung(145;0.248)		all cancers(201;0.014)		GAGAGTCGCCGTTTGATGCGA	0.557													10	22	---	---	---	---	capture	Missense_Mutation	SNP	118084588	118084588	C10orf96	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1614	212
LPXN	9404	broad.mit.edu	37	11	58318640	58318640	+	Silent	SNP	C	T	T			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58318640C>T	uc001nmw.2	-	5	529	c.384G>A	c.(382-384)CTG>CTA	p.L128L	LPXN_uc009ymp.2_5'UTR|LPXN_uc010rkj.1_Silent_p.L133L|LPXN_uc010rkk.1_Silent_p.L108L|LPXN_uc010rkl.1_RNA	NM_004811	NP_004802	O60711	LPXN_HUMAN	leupaxin isoform 2	128					cell adhesion|protein complex assembly|signal transduction	cytoplasm	zinc ion binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				GCATTGAGTCCAGGGAGGCCT	0.557													3	25	---	---	---	---	capture	Silent	SNP	58318640	58318640	LPXN	11	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	8845	212
AHNAK	79026	broad.mit.edu	37	11	62296010	62296010	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62296010A>G	uc001ntl.2	-	5	6179	c.5879T>C	c.(5878-5880)GTG>GCG	p.V1960A	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1960					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AACATCAGGCACCTCCACACC	0.507													33	172	---	---	---	---	capture	Missense_Mutation	SNP	62296010	62296010	AHNAK	11	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	414	212
C11orf65	160140	broad.mit.edu	37	11	108302505	108302505	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108302505G>A	uc001pkh.2	-	3	212	c.142C>T	c.(142-144)CGT>TGT	p.R48C	C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_RNA	NM_152587	NP_689800	Q8NCR3	CK065_HUMAN	hypothetical protein LOC160140	48										ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		ACTATCTGACGTGGTTCTCCT	0.299													7	88	---	---	---	---	capture	Missense_Mutation	SNP	108302505	108302505	C11orf65	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1641	212
OR8D1	283159	broad.mit.edu	37	11	124180280	124180280	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124180280C>T	uc010sag.1	-	1	383	c.383G>A	c.(382-384)AGC>AAC	p.S128N		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		AAGCAGTGGGCTACAGATGGC	0.498													3	11	---	---	---	---	capture	Missense_Mutation	SNP	124180280	124180280	OR8D1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	11135	212
ZBTB39	9880	broad.mit.edu	37	12	57396726	57396726	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57396726A>G	uc001sml.1	-	2	2062	c.1976T>C	c.(1975-1977)CTC>CCC	p.L659P	RDH16_uc010sqx.1_5'Flank	NM_014830	NP_055645	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	659					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						GCGGTACATGAGGGCCCCCGA	0.557													3	91	---	---	---	---	capture	Missense_Mutation	SNP	57396726	57396726	ZBTB39	12	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	17420	212
CUX2	23316	broad.mit.edu	37	12	111748209	111748209	+	Silent	SNP	C	T	T			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111748209C>T	uc001tsa.1	+	15	1776	c.1623C>T	c.(1621-1623)GGC>GGT	p.G541G		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	541						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						GTGGTGGGGGCGGAGCGGCGG	0.721													3	8	---	---	---	---	capture	Silent	SNP	111748209	111748209	CUX2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4025	212
RIMBP2	23504	broad.mit.edu	37	12	130898833	130898833	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130898833C>T	uc001uil.2	-	14	2653	c.2489G>A	c.(2488-2490)CGC>CAC	p.R830H		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	830						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGGAGAAAGGCGGTCTCGCCC	0.572													6	53	---	---	---	---	capture	Missense_Mutation	SNP	130898833	130898833	RIMBP2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13255	212
NID2	22795	broad.mit.edu	37	14	52507433	52507433	+	Silent	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:52507433G>A	uc001wzo.2	-	8	2196	c.1962C>T	c.(1960-1962)TAC>TAT	p.Y654Y	NID2_uc010tqs.1_Silent_p.Y654Y|NID2_uc010tqt.1_Silent_p.Y654Y|NID2_uc001wzp.2_Silent_p.Y654Y	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	654	Nidogen G2 beta-barrel.					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					TTGCTGAGACGTAAGGCACCT	0.443													9	85	---	---	---	---	capture	Silent	SNP	52507433	52507433	NID2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10322	212
RBM25	58517	broad.mit.edu	37	14	73578303	73578303	+	Silent	SNP	T	C	C			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:73578303T>C	uc001xno.2	+	16	2293	c.2085T>C	c.(2083-2085)TTT>TTC	p.F695F	RBM25_uc010ttu.1_Silent_p.F695F|RBM25_uc001xnp.2_Silent_p.F490F	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	695					apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		ATAGTGTCTTTAACAAATTTG	0.403													20	60	---	---	---	---	capture	Silent	SNP	73578303	73578303	RBM25	14	T	C	C	C	1	0	0	0	0	0	0	0	1	790	61	3	3	13020	212
ADAM10	102	broad.mit.edu	37	15	58904096	58904096	+	Missense_Mutation	SNP	A	C	C			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:58904096A>C	uc002afd.1	-	12	2050	c.1606T>G	c.(1606-1608)TGT>GGT	p.C536G	ADAM10_uc010bgc.1_RNA|ADAM10_uc010ugz.1_Missense_Mutation_p.C235G|ADAM10_uc002afe.1_Intron|ADAM10_uc002aff.1_Missense_Mutation_p.C73G	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor	536	Extracellular (Potential).|Disintegrin.				cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		AAGCCATTACATATTCCTTCC	0.448													8	50	---	---	---	---	capture	Missense_Mutation	SNP	58904096	58904096	ADAM10	15	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	234	212
SNX29	92017	broad.mit.edu	37	16	12220512	12220512	+	Silent	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:12220512G>A	uc002dby.3	+	5	326	c.270G>A	c.(268-270)GTG>GTA	p.V90V	SNX29_uc010uyx.1_Silent_p.V117V	NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	90	Potential.				cell communication		phosphatidylinositol binding			ovary(1)	1						AGGCCACTGTGGCCATGATGA	0.488													4	20	---	---	---	---	capture	Silent	SNP	12220512	12220512	SNX29	16	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	14790	212
GTF3C1	2975	broad.mit.edu	37	16	27480738	27480738	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27480738C>T	uc002dov.1	-	32	4988	c.4948G>A	c.(4948-4950)GGC>AGC	p.G1650S	GTF3C1_uc002dou.2_Missense_Mutation_p.G1650S	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	1650						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						GAGTAGTAGCCCCTCATCAGC	0.602													3	26	---	---	---	---	capture	Missense_Mutation	SNP	27480738	27480738	GTF3C1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6801	212
KRTAP4-5	85289	broad.mit.edu	37	17	39305619	39305619	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39305619G>T	uc002hwb.2	-	1	436	c.401C>A	c.(400-402)TCT>TAT	p.S134Y		NM_033188	NP_149445	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	139	24.|27 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ttcacagcaagaggggtggca	0.313													3	13	---	---	---	---	capture	Missense_Mutation	SNP	39305619	39305619	KRTAP4-5	17	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	8474	212
CTAGE1	64693	broad.mit.edu	37	18	19997766	19997766	+	Silent	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19997766G>A	uc002ktv.1	-	1	113	c.9C>T	c.(7-9)CCC>CCT	p.P3P		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	3						integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GATGAGAATCGGGTCTCATAC	0.507													6	21	---	---	---	---	capture	Silent	SNP	19997766	19997766	CTAGE1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3957	212
SERPINB4	6318	broad.mit.edu	37	18	61325755	61325755	+	Missense_Mutation	SNP	T	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61325755T>A	uc002ljg.2	-	4	487	c.461A>T	c.(460-462)CAA>CTA	p.Q154L	SERPINB3_uc002lji.2_Missense_Mutation_p.Q154L|SERPINB3_uc010dqa.2_Missense_Mutation_p.Q154L|SERPINB3_uc010dqb.2_3'UTR			P48594	SPB4_HUMAN	SubName: Full=Squamous cell carcinoma antigen 2;	154					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						ACCATTCGTTTGACTTTCCAC	0.448													3	49	---	---	---	---	capture	Missense_Mutation	SNP	61325755	61325755	SERPINB4	18	T	A	A	A	1	0	0	0	0	1	0	0	0	819	63	4	4	13996	212
OR7A5	26659	broad.mit.edu	37	19	14938368	14938368	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14938368G>A	uc002mzw.2	-	1	909	c.686C>T	c.(685-687)TCA>TTA	p.S229L	OR7A5_uc010xoa.1_Missense_Mutation_p.S229L	NM_017506	NP_059976	Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A,	229	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(2)	2						CTGAGCTGATGAGATTGCATG	0.448													10	55	---	---	---	---	capture	Missense_Mutation	SNP	14938368	14938368	OR7A5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11120	212
HIPK4	147746	broad.mit.edu	37	19	40890043	40890043	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40890043T>C	uc002onp.2	-	2	754	c.469A>G	c.(469-471)ATT>GTT	p.I157V		NM_144685	NP_653286	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	157	Protein kinase.					cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CCGAAGTCAATCACCTGTCGG	0.627													12	78	---	---	---	---	capture	Missense_Mutation	SNP	40890043	40890043	HIPK4	19	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	7044	212
SPTBN4	57731	broad.mit.edu	37	19	41060491	41060491	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41060491G>A	uc002ony.2	+	24	5109	c.5023G>A	c.(5023-5025)GAA>AAA	p.E1675K	SPTBN4_uc002onx.2_Missense_Mutation_p.E1675K|SPTBN4_uc002onz.2_Missense_Mutation_p.E1675K|SPTBN4_uc010egx.2_Missense_Mutation_p.E418K|SPTBN4_uc010egy.1_Missense_Mutation_p.E351K|SPTBN4_uc002ooa.2_Missense_Mutation_p.E351K	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1675	Spectrin 14.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAACTACGAGGAAAGCATCGC	0.662													3	7	---	---	---	---	capture	Missense_Mutation	SNP	41060491	41060491	SPTBN4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	15013	212
KLK13	26085	broad.mit.edu	37	19	51563780	51563780	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51563780T>C	uc002pvn.2	-	2	192	c.149A>G	c.(148-150)CAG>CGG	p.Q50R	KLK13_uc002pvl.2_RNA|KLK13_uc002pvm.2_RNA|KLK13_uc002pvo.2_RNA|KLK13_uc002pvp.2_RNA|KLK13_uc010eon.2_Missense_Mutation_p.Q50R|KLK13_uc002pvq.2_RNA|KLK13_uc010eoo.2_Intron|KLK13_uc002pvr.2_Missense_Mutation_p.Q50R	NM_015596	NP_056411	Q9UKR3	KLK13_HUMAN	kallikrein 13 precursor	50	Peptidase S1.				proteolysis		protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		TAGGGCAGCCTGCCAGGGCTG	0.602													3	90	---	---	---	---	capture	Missense_Mutation	SNP	51563780	51563780	KLK13	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	8321	212
NLRP4	147945	broad.mit.edu	37	19	56372800	56372800	+	Silent	SNP	C	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56372800C>A	uc002qmd.3	+	4	2327	c.1905C>A	c.(1903-1905)ACC>ACA	p.T635T	NLRP4_uc002qmf.2_Silent_p.T560T|NLRP4_uc010etf.2_Silent_p.T466T	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	635							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CTGTGCTCACCACCAGCGGGC	0.592													7	43	---	---	---	---	capture	Silent	SNP	56372800	56372800	NLRP4	19	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	10386	212
LRPPRC	10128	broad.mit.edu	37	2	44203309	44203309	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44203309G>A	uc002rtr.2	-	6	768	c.710C>T	c.(709-711)GCC>GTC	p.A237V	LRPPRC_uc010yob.1_Missense_Mutation_p.A137V|LRPPRC_uc010faw.1_Missense_Mutation_p.A211V	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	237	PPR 4.				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TGTCACAAGGGCACTGAATAC	0.398													3	30	---	---	---	---	capture	Missense_Mutation	SNP	44203309	44203309	LRPPRC	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8881	212
TTN	7273	broad.mit.edu	37	2	179633437	179633437	+	Silent	SNP	A	G	G			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179633437A>G	uc010zfg.1	-	38	9350	c.9126T>C	c.(9124-9126)GCT>GCC	p.A3042A	TTN_uc010zfh.1_Silent_p.A2996A|TTN_uc010zfi.1_Silent_p.A2996A|TTN_uc010zfj.1_Silent_p.A2996A|TTN_uc002unb.2_Silent_p.A3042A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	3042							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGCTTTTCCAGCCACAAAGG	0.388													3	46	---	---	---	---	capture	Silent	SNP	179633437	179633437	TTN	2	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	16617	212
MUC4	4585	broad.mit.edu	37	3	195516052	195516052	+	Missense_Mutation	SNP	G	A	A	rs142259629	by1000genomes	TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195516052G>A	uc011bto.1	-	2	2859	c.2399C>T	c.(2398-2400)GCG>GTG	p.A800V	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.A682V	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	805	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGCTGTGCCCGCTGAGGTGGT	0.587													21	100	---	---	---	---	capture	Missense_Mutation	SNP	195516052	195516052	MUC4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9888	212
LIN54	132660	broad.mit.edu	37	4	83905798	83905798	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:83905798G>C	uc003hnx.3	-	2	578	c.200C>G	c.(199-201)ACA>AGA	p.T67R	LIN54_uc003hnz.3_Intron|LIN54_uc003hny.3_Intron|LIN54_uc010ijt.2_Missense_Mutation_p.T67R|LIN54_uc010iju.2_5'UTR|LIN54_uc010ijv.2_Intron	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a	67					cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)				ACTGTACACTGTGATTGGTTC	0.428													20	88	---	---	---	---	capture	Missense_Mutation	SNP	83905798	83905798	LIN54	4	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	8729	212
CLCN3	1182	broad.mit.edu	37	4	170610366	170610366	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:170610366C>G	uc003isi.2	+	5	1100	c.591C>G	c.(589-591)ATC>ATG	p.I197M	CLCN3_uc003ish.2_Missense_Mutation_p.I197M|CLCN3_uc011cjz.1_Missense_Mutation_p.I180M|CLCN3_uc011cka.1_Missense_Mutation_p.I197M|CLCN3_uc003isj.1_Missense_Mutation_p.I170M	NM_001829	NP_001820	P51790	CLCN3_HUMAN	chloride channel 3 isoform b	197					endosomal lumen acidification	cell surface|early endosome membrane|Golgi membrane|integral to membrane|late endosome membrane|transport vesicle membrane	antiporter activity|ATP binding|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|voltage-gated chloride channel activity			breast(2)|ovary(1)	3		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		CAGAATTAATCATAGGTCAAG	0.353													13	64	---	---	---	---	capture	Missense_Mutation	SNP	170610366	170610366	CLCN3	4	C	G	G	G	1	0	0	0	0	1	0	0	0	369	29	4	4	3429	212
LRRC16A	55604	broad.mit.edu	37	6	25606465	25606465	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25606465G>A	uc011djw.1	+	35	4187	c.3811G>A	c.(3811-3813)GTC>ATC	p.V1271I	LRRC16A_uc010jpx.2_Missense_Mutation_p.V1226I|LRRC16A_uc010jpy.2_Missense_Mutation_p.V1265I	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1271					actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						AGCACGGCCCGTCATCCCGCA	0.607													3	23	---	---	---	---	capture	Missense_Mutation	SNP	25606465	25606465	LRRC16A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8887	212
CHN2	1124	broad.mit.edu	37	7	29407575	29407575	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:29407575G>A	uc003szz.2	+	3	553	c.116G>A	c.(115-117)CGT>CAT	p.R39H	CHN2_uc011jzs.1_Missense_Mutation_p.R114H|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_RNA|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Missense_Mutation_p.R52H|CHN2_uc010kvd.2_Missense_Mutation_p.R39H|CHN2_uc011jzu.1_Missense_Mutation_p.R24H	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2	39					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						GAGGCACCTCGTCCCAAGAGA	0.413													7	46	---	---	---	---	capture	Missense_Mutation	SNP	29407575	29407575	CHN2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3328	212
SAMD9	54809	broad.mit.edu	37	7	92731863	92731863	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92731863G>A	uc003umf.2	-	3	3804	c.3548C>T	c.(3547-3549)CCG>CTG	p.P1183L	SAMD9_uc003umg.2_Missense_Mutation_p.P1183L	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1183						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TTTTGACTTCGGATACAATCT	0.378													28	182	---	---	---	---	capture	Missense_Mutation	SNP	92731863	92731863	SAMD9	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13718	212
BEND2	139105	broad.mit.edu	37	X	18195711	18195711	+	Silent	SNP	C	T	T	rs150572716		TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18195711C>T	uc004cyj.3	-	10	1762	c.1608G>A	c.(1606-1608)CCG>CCA	p.P536P	BEND2_uc010nfb.2_Silent_p.P445P	NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	536	BEN 1.							p.P536P(1)		ovary(3)|kidney(1)|central_nervous_system(1)	5						CCATTTTGTTCGGGTCGAGGG	0.388													108	349	---	---	---	---	capture	Silent	SNP	18195711	18195711	BEND2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	1387	212
YY2	404281	broad.mit.edu	37	X	21875351	21875351	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2510-01	TCGA-28-2510-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21875351C>T	uc011mjp.1	+	1	749	c.749C>T	c.(748-750)CCT>CTT	p.P250L	MBTPS2_uc004dae.2_Intron|MBTPS2_uc010nfr.2_Intron|YY2_uc010nfq.2_Missense_Mutation_p.P468L|MBTPS2_uc004dab.2_Intron	NM_206923	NP_996806	O15391	TYY2_HUMAN	YY2 transcription factor	250	Mediates transcriptional repression.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|plasma membrane	DNA binding|zinc ion binding			breast(1)|skin(1)	2						AAAGGAGAACCTCCCAAAACA	0.502													98	218	---	---	---	---	capture	Missense_Mutation	SNP	21875351	21875351	YY2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	17390	212
