Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ZFYVE9	9372	broad.mit.edu	37	1	52704095	52704095	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:52704095G>T	uc001cto.2	+	4	1178	c.1006G>T	c.(1006-1008)GGT>TGT	p.G336C	ZFYVE9_uc001ctn.2_Missense_Mutation_p.G336C|ZFYVE9_uc001ctp.2_Missense_Mutation_p.G336C	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	336					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						CCTCCGGTCTGGTTTACCTTT	0.468													19	148	---	---	---	---	capture	Missense_Mutation	SNP	52704095	52704095	ZFYVE9	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	17551	213
FLG	2312	broad.mit.edu	37	1	152275656	152275656	+	Silent	SNP	G	A	A	rs147335121		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152275656G>A	uc001ezu.1	-	3	11742	c.11706C>T	c.(11704-11706)CCC>CCT	p.P3902P		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3902	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGAGGATCCGGGGTGTCTGG	0.517									Ichthyosis				21	111	---	---	---	---	capture	Silent	SNP	152275656	152275656	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5867	213
FLG2	388698	broad.mit.edu	37	1	152329436	152329436	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152329436G>A	uc001ezw.3	-	3	899	c.826C>T	c.(826-828)CGA>TGA	p.R276*	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	276	Ser-rich.|Filaggrin 1.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCATGACTTCGCCTCCCACTG	0.448													40	290	---	---	---	---	capture	Nonsense_Mutation	SNP	152329436	152329436	FLG2	1	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	5868	213
PFDN2	5202	broad.mit.edu	37	1	161072146	161072146	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161072146C>T	uc001fxu.2	-	2	145	c.95G>A	c.(94-96)CGC>CAC	p.R32H		NM_012394	NP_036526	Q9UHV9	PFD2_HUMAN	prefoldin subunit 2	32				GFNRLR -> SFNAF (in Ref. 3; AAF36151).	'de novo' posttranslational protein folding	prefoldin complex	unfolded protein binding				0	all_cancers(52;1.84e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CTGCCGAAGGCGGTTGAAGCC	0.527													3	55	---	---	---	---	capture	Missense_Mutation	SNP	161072146	161072146	PFDN2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11659	213
HMCN1	83872	broad.mit.edu	37	1	186114957	186114957	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186114957G>A	uc001grq.1	+	93	14739	c.14510G>A	c.(14509-14511)CGG>CAG	p.R4837Q	HMCN1_uc001grs.1_Missense_Mutation_p.R406Q	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4837	TSP type-1 6.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GAAAAGACTCGGAAGCGGCTG	0.552													12	108	---	---	---	---	capture	Missense_Mutation	SNP	186114957	186114957	HMCN1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7145	213
CACNA1S	779	broad.mit.edu	37	1	201047161	201047161	+	Missense_Mutation	SNP	G	A	A	rs138364213		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201047161G>A	uc001gvv.2	-	11	1692	c.1465C>T	c.(1465-1467)CGC>TGC	p.R489C		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	489	II.|Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	AAGTACTGGCGCAGGCCCAGC	0.582													13	105	---	---	---	---	capture	Missense_Mutation	SNP	201047161	201047161	CACNA1S	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2523	213
USH2A	7399	broad.mit.edu	37	1	215853692	215853692	+	Silent	SNP	G	A	A	rs55921307	byFrequency	TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215853692G>A	uc001hku.1	-	62	12480	c.12093C>T	c.(12091-12093)TAC>TAT	p.Y4031Y		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4031	Fibronectin type-III 25.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTCTAACCCGTACAGGTGGG	0.388										HNSCC(13;0.011)			22	223	---	---	---	---	capture	Silent	SNP	215853692	215853692	USH2A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16918	213
PTEN	5728	broad.mit.edu	37	10	89693009	89693009	+	Splice_Site	SNP	G	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89693009G>T	uc001kfb.2	+	6	1523	c.492_splice	c.e6+1	p.K164_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.Y27fs*1(2)|p.?(2)|p.K163_V166>NKGE(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGACAAAAAGGTAAGTTATTT	0.313		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			9	94	---	---	---	---	capture	Splice_Site	SNP	89693009	89693009	PTEN	10	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	12633	213
PIK3AP1	118788	broad.mit.edu	37	10	98411291	98411291	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98411291G>A	uc001kmq.2	-	5	958	c.830C>T	c.(829-831)GCG>GTG	p.A277V	PIK3AP1_uc001kmp.2_Missense_Mutation_p.A99V	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	277	DBB.					cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		CACAGGATTCGCGGCATTGGA	0.398													17	140	---	---	---	---	capture	Missense_Mutation	SNP	98411291	98411291	PIK3AP1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11811	213
CNGA4	1262	broad.mit.edu	37	11	6261464	6261464	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6261464C>T	uc001mco.2	+	4	547	c.440C>T	c.(439-441)GCG>GTG	p.A147V	CNGA4_uc010raa.1_Intron|CNGA4_uc001mcn.2_Missense_Mutation_p.A107V	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	147	Extracellular (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTTCTCCGCGCGCCCCGCCTC	0.587													28	173	---	---	---	---	capture	Missense_Mutation	SNP	6261464	6261464	CNGA4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3564	213
OR5D14	219436	broad.mit.edu	37	11	55563770	55563770	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55563770C>A	uc010rim.1	+	1	739	c.739C>A	c.(739-741)CTG>ATG	p.L247M		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	247	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				GGCCTCCCACCTGACTTCTAT	0.453													16	144	---	---	---	---	capture	Missense_Mutation	SNP	55563770	55563770	OR5D14	11	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	11059	213
DDI1	414301	broad.mit.edu	37	11	103908142	103908142	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:103908142C>G	uc001phr.2	+	1	835	c.592C>G	c.(592-594)CTT>GTT	p.L198V	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	198					proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GCAAGAGAGGCTTCGTCTCTA	0.522													19	69	---	---	---	---	capture	Missense_Mutation	SNP	103908142	103908142	DDI1	11	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	4287	213
OR8A1	390275	broad.mit.edu	37	11	124440263	124440263	+	Missense_Mutation	SNP	T	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124440263T>A	uc010san.1	+	1	299	c.299T>A	c.(298-300)GTG>GAG	p.V100E		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	100	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		AAGATGCTGGTGAACTTTGTG	0.463													34	213	---	---	---	---	capture	Missense_Mutation	SNP	124440263	124440263	OR8A1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	11129	213
ANKRD33	341405	broad.mit.edu	37	12	52284606	52284606	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52284606C>A	uc001rzf.3	+	5	1080	c.501C>A	c.(499-501)AGC>AGA	p.S167R	ANKRD33_uc001rzh.3_3'UTR|ANKRD33_uc001rzd.2_Missense_Mutation_p.S292R|ANKRD33_uc001rze.2_Missense_Mutation_p.S188R|ANKRD33_uc001rzg.3_Missense_Mutation_p.S94R|ANKRD33_uc001rzi.3_Missense_Mutation_p.S167R	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1	167											0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		CTACCTTGAGCCTCCCCTTTG	0.557													3	16	---	---	---	---	capture	Missense_Mutation	SNP	52284606	52284606	ANKRD33	12	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	657	213
OR6C3	254786	broad.mit.edu	37	12	55726370	55726370	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55726370C>A	uc010spj.1	+	1	886	c.886C>A	c.(886-888)CAA>AAA	p.Q296K		NM_054104	NP_473445	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C,	296	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GCAAGTAAAACAAGCCTTCAA	0.338													14	90	---	---	---	---	capture	Missense_Mutation	SNP	55726370	55726370	OR6C3	12	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	11096	213
PTPRB	5787	broad.mit.edu	37	12	70933755	70933755	+	Missense_Mutation	SNP	C	T	T	rs139546127	by1000genomes	TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70933755C>T	uc001swb.3	-	22	5018	c.4988G>A	c.(4987-4989)CGA>CAA	p.R1663Q	PTPRB_uc010sto.1_Missense_Mutation_p.R1573Q|PTPRB_uc010stp.1_Missense_Mutation_p.R1573Q|PTPRB_uc001swc.3_Missense_Mutation_p.R1881Q|PTPRB_uc001swa.3_Missense_Mutation_p.R1793Q	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1663	Cytoplasmic (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AGATAATGGTCGATCCCTACG	0.413													9	71	---	---	---	---	capture	Missense_Mutation	SNP	70933755	70933755	PTPRB	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12691	213
PTPRR	5801	broad.mit.edu	37	12	71286587	71286587	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:71286587G>A	uc001swi.1	-	2	645	c.229C>T	c.(229-231)CGC>TGC	p.R77C		NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	77	Extracellular (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		ATCTGGTGGCGTTTGCTTACT	0.448													36	286	---	---	---	---	capture	Missense_Mutation	SNP	71286587	71286587	PTPRR	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12705	213
C12orf63	374467	broad.mit.edu	37	12	97073486	97073486	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:97073486G>A	uc001tet.1	+	7	1025	c.947G>A	c.(946-948)CGA>CAA	p.R316Q		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	316										skin(6)|ovary(1)	7						AGATCAATCCGACACAGCAGA	0.453													35	272	---	---	---	---	capture	Missense_Mutation	SNP	97073486	97073486	C12orf63	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1692	213
OASL	8638	broad.mit.edu	37	12	121465457	121465457	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121465457C>G	uc001tzj.1	-	4	827	c.821G>C	c.(820-822)TGT>TCT	p.C274S	OASL_uc001tzk.1_Intron	NM_003733	NP_003724	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like isoform a	274					interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoplasm|nucleolus	ATP binding|DNA binding|double-stranded RNA binding|thyroid hormone receptor binding|transferase activity			skin(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCAGTAGATACAGATGACTTC	0.453													28	170	---	---	---	---	capture	Missense_Mutation	SNP	121465457	121465457	OASL	12	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	10707	213
EP400	57634	broad.mit.edu	37	12	132512816	132512816	+	Silent	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132512816G>A	uc001ujn.2	+	26	5399	c.5364G>A	c.(5362-5364)CTG>CTA	p.L1788L	EP400_uc001ujl.2_Silent_p.L1787L|EP400_uc001ujm.2_Silent_p.L1707L	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1824					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GAGAGTCTCTGCAGGATGTTA	0.557													51	294	---	---	---	---	capture	Silent	SNP	132512816	132512816	EP400	12	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	5104	213
KCNK10	54207	broad.mit.edu	37	14	88652226	88652226	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88652226G>A	uc001xwo.2	-	7	1727	c.1270C>T	c.(1270-1272)CGC>TGC	p.R424C	KCNK10_uc001xwm.2_Missense_Mutation_p.R429C|KCNK10_uc001xwn.2_Missense_Mutation_p.R429C	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	424	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						CCCTTCAGGCGCAGGTTGTTG	0.607													18	104	---	---	---	---	capture	Missense_Mutation	SNP	88652226	88652226	KCNK10	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7981	213
MTMR15	22909	broad.mit.edu	37	15	31197005	31197005	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:31197005T>C	uc001zff.2	+	2	430	c.139T>C	c.(139-141)TGC>CGC	p.C47R	MTMR15_uc001zfc.3_Missense_Mutation_p.C47R|MTMR15_uc010azw.2_Missense_Mutation_p.C47R|MTMR15_uc001zfd.3_Missense_Mutation_p.C47R|MTMR15_uc001zfe.2_5'UTR	NM_014967	NP_055782	Q9Y2M0	FAN1_HUMAN	myotubularin related protein 15 isoform a	47	UBZ-type.			C->A: Abolishes interaction with monoubiquitinated FANCD2; when associated with A-44.	double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)		CTGCCCCGTTTGCAGTAAAAT	0.403								Direct_reversal_of_damage|Editing_and_processing_nucleases					23	105	---	---	---	---	capture	Missense_Mutation	SNP	31197005	31197005	MTMR15	15	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	9853	213
AXIN1	8312	broad.mit.edu	37	16	339599	339599	+	Nonsense_Mutation	SNP	G	T	T	rs138816818		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:339599G>T	uc002cgp.1	-	10	2480	c.2303C>A	c.(2302-2304)TCG>TAG	p.S768*	AXIN1_uc002cgq.1_Nonsense_Mutation_p.S732*	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a	768	Interaction with PPP2CA.				activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CTTCCTCTGCGATCTTGTCCT	0.637													6	52	---	---	---	---	capture	Nonsense_Mutation	SNP	339599	339599	AXIN1	16	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	1226	213
ATF7IP2	80063	broad.mit.edu	37	16	10534246	10534246	+	Missense_Mutation	SNP	G	A	A	rs141687995		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10534246G>A	uc002czu.2	+	6	1348	c.1121G>A	c.(1120-1122)CGT>CAT	p.R374H	ATF7IP2_uc002czv.2_Missense_Mutation_p.R374H|ATF7IP2_uc010uyo.1_RNA|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Missense_Mutation_p.R374H|ATF7IP2_uc010uyq.1_RNA	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting	374	Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						CTTCAAAGACGTATTAAAACA	0.289													12	56	---	---	---	---	capture	Missense_Mutation	SNP	10534246	10534246	ATF7IP2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1079	213
ACSM5	54988	broad.mit.edu	37	16	20442617	20442617	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20442617C>T	uc002dhe.2	+	10	1429	c.1282C>T	c.(1282-1284)CCC>TCC	p.P428S		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	428					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						ACCCACTCGGCCCTTCTGTTT	0.413													17	165	---	---	---	---	capture	Missense_Mutation	SNP	20442617	20442617	ACSM5	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	187	213
ITGAM	3684	broad.mit.edu	37	16	31308873	31308873	+	Silent	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31308873C>T	uc002ebq.2	+	13	1493	c.1395C>T	c.(1393-1395)GAC>GAT	p.D465D	ITGAM_uc002ebr.2_Silent_p.D465D|ITGAM_uc010cam.1_Missense_Mutation_p.R69C|ITGAM_uc010can.2_Translation_Start_Site	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	465	FG-GAP 5.|Extracellular (Potential).|Potential.				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						GCTCCGTGGACGTGGACAGCA	0.627													36	190	---	---	---	---	capture	Silent	SNP	31308873	31308873	ITGAM	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7810	213
ZFHX3	463	broad.mit.edu	37	16	72821854	72821854	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72821854C>A	uc002fck.2	-	10	10994	c.10321G>T	c.(10321-10323)GAG>TAG	p.E3441*	ZFHX3_uc002fcl.2_Nonsense_Mutation_p.E2527*	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	3441					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GCTTCTGGCTCTTCAGGGAGT	0.557													36	239	---	---	---	---	capture	Nonsense_Mutation	SNP	72821854	72821854	ZFHX3	16	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	17514	213
MYH1	4619	broad.mit.edu	37	17	10399320	10399320	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10399320C>T	uc002gmo.2	-	35	5210	c.5116G>A	c.(5116-5118)GCA>ACA	p.A1706T	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1706	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TCCTGTTCTGCGATTTTCCTG	0.532													12	141	---	---	---	---	capture	Missense_Mutation	SNP	10399320	10399320	MYH1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9939	213
MYH2	4620	broad.mit.edu	37	17	10427956	10427956	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10427956G>A	uc010coi.2	-	35	5130	c.5002C>T	c.(5002-5004)CGG>TGG	p.R1668W	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1668W|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1668	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TCCTGGCTCCGGAGAGCATCA	0.572													16	105	---	---	---	---	capture	Missense_Mutation	SNP	10427956	10427956	MYH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	9945	213
ACACA	31	broad.mit.edu	37	17	35615262	35615262	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35615262C>G	uc002hnm.2	-	13	1614	c.1423G>C	c.(1423-1425)GAT>CAT	p.D475H	ACACA_uc002hnk.2_Missense_Mutation_p.D397H|ACACA_uc002hnl.2_Missense_Mutation_p.D417H|ACACA_uc002hnn.2_Missense_Mutation_p.D475H|ACACA_uc002hno.2_Missense_Mutation_p.D512H|ACACA_uc010cuz.2_Missense_Mutation_p.D475H	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	475	Biotin carboxylation.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	ATACGGATATCCTTGATTCTA	0.413													23	104	---	---	---	---	capture	Missense_Mutation	SNP	35615262	35615262	ACACA	17	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	106	213
MKS1	54903	broad.mit.edu	37	17	56294074	56294074	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56294074C>T	uc002ivr.1	-	3	289	c.214G>A	c.(214-216)GAA>AAA	p.E72K	MKS1_uc010wnq.1_5'UTR|MKS1_uc002ivs.1_Missense_Mutation_p.E72K	NM_017777	NP_060247	Q9NXB0	MKS1_HUMAN	Meckel syndrome type 1 protein isoform 1	72					cilium assembly	centrosome|cilium|microtubule basal body	protein binding			ovary(1)	1						TCCTCCTCTTCGTCTTCCTCT	0.483													13	98	---	---	---	---	capture	Missense_Mutation	SNP	56294074	56294074	MKS1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9521	213
CDR2L	30850	broad.mit.edu	37	17	73000053	73000053	+	Missense_Mutation	SNP	C	T	T	rs144796205	byFrequency	TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73000053C>T	uc002jml.3	+	5	1694	c.1282C>T	c.(1282-1284)CGG>TGG	p.R428W		NM_014603	NP_055418	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like	428											0	all_lung(278;0.226)					CGTGGACAAGCGGCTGGAACA	0.612													5	11	---	---	---	---	capture	Missense_Mutation	SNP	73000053	73000053	CDR2L	17	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3142	213
ITGB4	3691	broad.mit.edu	37	17	73725429	73725429	+	Missense_Mutation	SNP	G	A	A	rs144968507		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73725429G>A	uc002jpg.2	+	7	837	c.650G>A	c.(649-651)CGG>CAG	p.R217Q	ITGB4_uc002jph.2_Missense_Mutation_p.R217Q|ITGB4_uc010dgo.2_Missense_Mutation_p.R217Q|ITGB4_uc002jpi.3_Missense_Mutation_p.R217Q|ITGB4_uc010dgp.1_Missense_Mutation_p.R217Q|ITGB4_uc002jpj.2_Missense_Mutation_p.R217Q|ITGB4_uc010wsh.1_5'Flank	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	217	VWFA.|Extracellular (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GATGAGTTCCGGAATAAACTG	0.602													24	68	---	---	---	---	capture	Missense_Mutation	SNP	73725429	73725429	ITGB4	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7820	213
ROCK1	6093	broad.mit.edu	37	18	18547745	18547745	+	Nonsense_Mutation	SNP	T	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:18547745T>A	uc002kte.2	-	26	4101	c.3160A>T	c.(3160-3162)AAA>TAA	p.K1054*		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1054	Potential.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					TTCTGATGTTTCACTACCATC	0.353													43	381	---	---	---	---	capture	Nonsense_Mutation	SNP	18547745	18547745	ROCK1	18	T	A	A	A	1	0	0	0	0	0	1	0	0	806	62	5	4	13409	213
CTAGE1	64693	broad.mit.edu	37	18	19996798	19996798	+	Missense_Mutation	SNP	T	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19996798T>A	uc002ktv.1	-	1	1081	c.977A>T	c.(976-978)AAT>ATT	p.N326I		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	326	Potential.					integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					AGTCTGAAGATTTTTAATATG	0.308													16	124	---	---	---	---	capture	Missense_Mutation	SNP	19996798	19996798	CTAGE1	18	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	3957	213
DSC2	1824	broad.mit.edu	37	18	28673541	28673541	+	Silent	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28673541G>A	uc002kwl.3	-	2	589	c.135C>T	c.(133-135)GCC>GCT	p.A45A	DSC2_uc002kwk.3_Silent_p.A45A|DSC2_uc010xbo.1_Silent_p.A45A	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	45					homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			CAAGTTTCTCGGCATCTAGTT	0.259													23	198	---	---	---	---	capture	Silent	SNP	28673541	28673541	DSC2	18	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4721	213
SMAD4	4089	broad.mit.edu	37	18	48604808	48604808	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:48604808C>T	uc010xdp.1	+	12	2168	c.1630C>T	c.(1630-1632)CCG>TCG	p.P544S	SMAD4_uc002lfb.3_Missense_Mutation_p.P389S	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	544	MH2.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(2)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TCATACCATGCCGATTGCAGA	0.458									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				4	118	---	---	---	---	capture	Missense_Mutation	SNP	48604808	48604808	SMAD4	18	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14652	213
SERPINB4	6318	broad.mit.edu	37	18	61305084	61305084	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61305084C>T	uc002ljf.2	-	8	1128	c.1042G>A	c.(1042-1044)GCT>ACT	p.A348T	SERPINB4_uc002lje.2_Missense_Mutation_p.A327T|SERPINB4_uc002ljg.2_Missense_Mutation_p.A348T	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade	348					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						ACTACTACAGCGGTGGCAGCT	0.468													11	84	---	---	---	---	capture	Missense_Mutation	SNP	61305084	61305084	SERPINB4	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13996	213
FBN3	84467	broad.mit.edu	37	19	8190851	8190851	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8190851C>T	uc002mjf.2	-	21	2677	c.2656G>A	c.(2656-2658)GTC>ATC	p.V886I		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	886	EGF-like 11; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GCAGTGTTGACGCAACGCCCG	0.637													8	106	---	---	---	---	capture	Missense_Mutation	SNP	8190851	8190851	FBN3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5650	213
MUC16	94025	broad.mit.edu	37	19	9068764	9068764	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9068764G>T	uc002mkp.2	-	3	18886	c.18682C>A	c.(18682-18684)CTT>ATT	p.L6228I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6230	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTTGTCACAAGGAGAGGTGCC	0.478													19	172	---	---	---	---	capture	Missense_Mutation	SNP	9068764	9068764	MUC16	19	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	9883	213
RTBDN	83546	broad.mit.edu	37	19	12939705	12939705	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12939705G>A	uc002mvi.2	-	3	362	c.232C>T	c.(232-234)CGC>TGC	p.R78C	RTBDN_uc002mvh.1_Missense_Mutation_p.R110C|RTBDN_uc002mvj.2_Missense_Mutation_p.R110C	NM_001080997	NP_001074466	Q9BSG5	RTBDN_HUMAN	retbindin isoform 1	78						extracellular region					0						ACTCCACAGCGTTCTGGATGG	0.582													28	212	---	---	---	---	capture	Missense_Mutation	SNP	12939705	12939705	RTBDN	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13609	213
GTPBP3	84705	broad.mit.edu	37	19	17450006	17450006	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17450006C>A	uc010eas.2	+	6	804	c.739C>A	c.(739-741)CGC>AGC	p.R247S	GTPBP3_uc010xpo.1_Missense_Mutation_p.R269S|GTPBP3_uc010ear.1_RNA|GTPBP3_uc002ngh.3_Missense_Mutation_p.R247S|GTPBP3_uc002ngg.3_Missense_Mutation_p.R279S|GTPBP3_uc002ngi.3_5'UTR	NM_032620	NP_116009	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial) isoform V	247					tRNA modification	mitochondrion	GTP binding|GTPase activity			skin(1)	1						GCAGAGGCTCCGCTCAGGGGT	0.662													7	52	---	---	---	---	capture	Missense_Mutation	SNP	17450006	17450006	GTPBP3	19	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	6810	213
UBA52	7311	broad.mit.edu	37	19	18684123	18684123	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18684123G>C	uc002njr.2	+	2	127	c.13G>C	c.(13-15)GTG>CTG	p.V5L	UBA52_uc002njs.2_Missense_Mutation_p.V5L|UBA52_uc002njt.2_Missense_Mutation_p.V5L	NM_001033930	NP_001029102	P62987	RL40_HUMAN	ubiquitin and ribosomal protein L40 precursor	5	Ubiquitin-like.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endocrine pancreas development|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|translational elongation|translational termination|viral transcription	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane|ribosome	protein binding|structural constituent of ribosome				0						GCAGATCTTTGTGAAGACCCT	0.517													5	59	---	---	---	---	capture	Missense_Mutation	SNP	18684123	18684123	UBA52	19	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	16713	213
ZNF787	126208	broad.mit.edu	37	19	56614551	56614551	+	Silent	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56614551C>T	uc010eth.1	-	2	155	c.36G>A	c.(34-36)CCG>CCA	p.P12P	ZNF787_uc002qml.1_Silent_p.P12P	NM_001002836	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	12					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		CAGAATCCAGCGGCCCCGGAG	0.632													6	62	---	---	---	---	capture	Silent	SNP	56614551	56614551	ZNF787	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	18035	213
ZFP28	140612	broad.mit.edu	37	19	57060380	57060380	+	Missense_Mutation	SNP	G	A	A	rs142184982		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57060380G>A	uc002qnj.2	+	5	648	c.577G>A	c.(577-579)GAA>AAA	p.E193K	ZFP28_uc002qni.2_Missense_Mutation_p.E193K|uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	193					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GGACTTCTGCGAAGGAAAGCT	0.413													11	68	---	---	---	---	capture	Missense_Mutation	SNP	57060380	57060380	ZFP28	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17522	213
NRXN1	9378	broad.mit.edu	37	2	50765581	50765581	+	Silent	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:50765581G>A	uc010fbq.2	-	10	3550	c.2073C>T	c.(2071-2073)GGC>GGT	p.G691G	NRXN1_uc002rxb.3_Silent_p.G323G|NRXN1_uc002rxe.3_Silent_p.G651G|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTTTGCTTTGGCCATCGATGA	0.502													63	413	---	---	---	---	capture	Silent	SNP	50765581	50765581	NRXN1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	10572	213
PSD4	23550	broad.mit.edu	37	2	113940279	113940279	+	Silent	SNP	C	T	T	rs147089589		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113940279C>T	uc002tjc.2	+	2	429	c.246C>T	c.(244-246)GAC>GAT	p.D82D	PSD4_uc002tjd.2_Translation_Start_Site|PSD4_uc002tje.2_Silent_p.D81D|PSD4_uc002tjf.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	82					regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						TCCATCAGGACGGGCTGGAGC	0.622													8	57	---	---	---	---	capture	Silent	SNP	113940279	113940279	PSD4	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12544	213
SLC4A10	57282	broad.mit.edu	37	2	162815003	162815003	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:162815003C>T	uc002ubx.3	+	21	2984	c.2800C>T	c.(2800-2802)CCC>TCC	p.P934S	SLC4A10_uc002uby.3_Missense_Mutation_p.P904S|SLC4A10_uc010zcs.1_Missense_Mutation_p.P915S	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	934	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						ACAGTTTATTCCCATGCCAGT	0.343													7	61	---	---	---	---	capture	Missense_Mutation	SNP	162815003	162815003	SLC4A10	2	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	14543	213
TTN	7273	broad.mit.edu	37	2	179469893	179469893	+	Missense_Mutation	SNP	T	G	G			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179469893T>G	uc010zfg.1	-	229	46531	c.46307A>C	c.(46306-46308)GAA>GCA	p.E15436A	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E9131A|TTN_uc010zfi.1_Missense_Mutation_p.E9064A|TTN_uc010zfj.1_Missense_Mutation_p.E8939A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16363							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTACAGTTTCATTTTTGGA	0.468													28	101	---	---	---	---	capture	Missense_Mutation	SNP	179469893	179469893	TTN	2	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	16617	213
ZNF804A	91752	broad.mit.edu	37	2	185802437	185802437	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:185802437C>T	uc002uph.2	+	4	2908	c.2314C>T	c.(2314-2316)CGT>TGT	p.R772C		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	772						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						CTATCGAAAACGTAGACAACA	0.343													14	107	---	---	---	---	capture	Missense_Mutation	SNP	185802437	185802437	ZNF804A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	18046	213
NBEAL1	65065	broad.mit.edu	37	2	204000539	204000539	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:204000539T>C	uc002uzt.3	+	27	4199	c.3866T>C	c.(3865-3867)GTT>GCT	p.V1289A	NBEAL1_uc002uzs.3_5'UTR	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	1289							binding			ovary(1)|skin(1)	2						AGTAGAGCTGTTTTAATGAAA	0.343													5	37	---	---	---	---	capture	Missense_Mutation	SNP	204000539	204000539	NBEAL1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	10095	213
SNX21	90203	broad.mit.edu	37	20	44469563	44469563	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44469563C>T	uc002xpv.1	+	4	822	c.733C>T	c.(733-735)CGG>TGG	p.R245W	SNX21_uc002xps.1_Intron|SNX21_uc002xpt.1_3'UTR|SNX21_uc002xpu.1_3'UTR|SNX21_uc002xpw.1_Missense_Mutation_p.R56W|SNX21_uc002xpx.2_Missense_Mutation_p.R235W|SNX21_uc010zxd.1_3'UTR|SNX21_uc002xpy.1_Missense_Mutation_p.R56W|SNX21_uc002xpz.1_Missense_Mutation_p.R56W	NM_033421	NP_219489	Q969T3	SNX21_HUMAN	sorting nexin 21 isoform a	245	PX.				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding			breast(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)				GCCGGAGCTGCGGCGGGCACA	0.662													7	57	---	---	---	---	capture	Missense_Mutation	SNP	44469563	44469563	SNX21	20	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	14785	213
PREX1	57580	broad.mit.edu	37	20	47276521	47276521	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47276521C>T	uc002xtw.1	-	16	1840	c.1817G>A	c.(1816-1818)AGC>AAC	p.S606N		NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	606					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TTTGTTCTTGCTGCTGGTCCC	0.562													21	165	---	---	---	---	capture	Missense_Mutation	SNP	47276521	47276521	PREX1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	12372	213
TBC1D22A	25771	broad.mit.edu	37	22	47507479	47507479	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:47507479C>G	uc003bib.2	+	12	1540	c.1405C>G	c.(1405-1407)CTA>GTA	p.L469V	TBC1D22A_uc010haf.2_Missense_Mutation_p.L439V|TBC1D22A_uc003bic.2_Missense_Mutation_p.L410V|TBC1D22A_uc003bie.2_Missense_Mutation_p.L391V|TBC1D22A_uc003bid.2_RNA|TBC1D22A_uc010hag.2_RNA|TBC1D22A_uc003bif.2_Missense_Mutation_p.L422V	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	469						intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		GAAGGAAATACTAGAAGAAAA	0.368													3	103	---	---	---	---	capture	Missense_Mutation	SNP	47507479	47507479	TBC1D22A	22	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	15499	213
TRAK1	22906	broad.mit.edu	37	3	42242538	42242538	+	Silent	SNP	C	T	T	rs143049389	byFrequency	TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42242538C>T	uc003cky.2	+	12	1635	c.1419C>T	c.(1417-1419)GCC>GCT	p.A473A	TRAK1_uc011azh.1_Silent_p.A473A|TRAK1_uc011azi.1_Silent_p.A473A|TRAK1_uc003ckz.3_Silent_p.A399A|TRAK1_uc011azj.1_Silent_p.A399A|TRAK1_uc003cla.2_Silent_p.A415A	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN	OGT(O-Glc-NAc transferase)-interacting protein	473	Interaction with HGS.				endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1						CAGAGGCAGCCGACCTGGGGT	0.542													12	86	---	---	---	---	capture	Silent	SNP	42242538	42242538	TRAK1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16332	213
CADM2	253559	broad.mit.edu	37	3	85932587	85932587	+	Missense_Mutation	SNP	G	A	A	rs138383256		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:85932587G>A	uc003dqj.2	+	3	984	c.358G>A	c.(358-360)GTT>ATT	p.V120I	CADM2_uc003dqk.2_Missense_Mutation_p.V129I|CADM2_uc003dql.2_Missense_Mutation_p.V122I	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D	120	Extracellular (Potential).				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		ATATCTCACCGTTCTGGGTAA	0.358													4	92	---	---	---	---	capture	Missense_Mutation	SNP	85932587	85932587	CADM2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2543	213
MYLK	4638	broad.mit.edu	37	3	123333123	123333123	+	Silent	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123333123G>A	uc003ego.2	-	34	5856	c.5574C>T	c.(5572-5574)GAC>GAT	p.D1858D	uc003egk.2_Intron|MYLK_uc003egl.2_Silent_p.D98D|MYLK_uc003egm.2_Silent_p.D97D|MYLK_uc010hrr.2_Silent_p.D293D|MYLK_uc011bjv.1_Silent_p.D658D|MYLK_uc011bjw.1_Silent_p.D1857D|MYLK_uc003egp.2_Silent_p.D1789D|MYLK_uc003egq.2_Silent_p.D1807D|MYLK_uc003egr.2_Silent_p.D1738D|MYLK_uc003egs.2_Silent_p.D1682D	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1858	Ig-like C2-type 9.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CCTCATCGTAGTCTATCTGGA	0.502													30	165	---	---	---	---	capture	Silent	SNP	123333123	123333123	MYLK	3	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	9966	213
ZBBX	79740	broad.mit.edu	37	3	167035369	167035369	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:167035369G>C	uc003fep.2	-	13	1323	c.1000C>G	c.(1000-1002)CTT>GTT	p.L334V	ZBBX_uc011bpc.1_Missense_Mutation_p.L334V|ZBBX_uc003feq.2_Missense_Mutation_p.L305V	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	334						intracellular	zinc ion binding			ovary(2)	2						ATTTTAAAAAGTTGCTCTTGT	0.348													21	144	---	---	---	---	capture	Missense_Mutation	SNP	167035369	167035369	ZBBX	3	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	17397	213
ABCC5	10057	broad.mit.edu	37	3	183665139	183665139	+	Silent	SNP	C	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183665139C>A	uc003fmg.2	-	23	3552	c.3387G>T	c.(3385-3387)GCG>GCT	p.A1129A	ABCC5_uc011bqt.1_Silent_p.A657A|ABCC5_uc010hxl.2_Silent_p.A1086A	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	1129	ABC transmembrane type-1 2.|Helical; (Potential).					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TGGCGAGACCCGCATAGGCTG	0.567													7	29	---	---	---	---	capture	Silent	SNP	183665139	183665139	ABCC5	3	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	56	213
EIF4G1	1981	broad.mit.edu	37	3	184044341	184044341	+	Silent	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184044341G>A	uc003fnp.2	+	22	3447	c.3249G>A	c.(3247-3249)CAG>CAA	p.Q1083Q	EIF4G1_uc003fnt.2_Silent_p.Q794Q|EIF4G1_uc003fnq.2_Silent_p.Q996Q|EIF4G1_uc003fnr.2_Silent_p.Q919Q|EIF4G1_uc010hxx.2_Silent_p.Q1090Q|EIF4G1_uc003fns.2_Silent_p.Q1043Q|EIF4G1_uc010hxy.2_Silent_p.Q1090Q|EIF4G1_uc003fnv.3_Silent_p.Q1084Q|EIF4G1_uc003fnu.3_Silent_p.Q1083Q|EIF4G1_uc003fnw.2_Silent_p.Q1090Q|EIF4G1_uc003fnx.2_Silent_p.Q888Q|EIF4G1_uc003fny.3_Silent_p.Q887Q|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1083	eIF3/EIF4A-binding.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTAACAACCAGCTCTTTGCAC	0.587													25	132	---	---	---	---	capture	Silent	SNP	184044341	184044341	EIF4G1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	4991	213
CCDC96	257236	broad.mit.edu	37	4	7043696	7043696	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:7043696C>A	uc003gjv.2	-	1	1033	c.970G>T	c.(970-972)GAG>TAG	p.E324*	TADA2B_uc003gjw.3_5'Flank|TADA2B_uc010idi.2_5'Flank	NM_153376	NP_699207	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	324	Potential.										0						CACTCCTTCTCCACCCTGGTG	0.642													30	237	---	---	---	---	capture	Nonsense_Mutation	SNP	7043696	7043696	CCDC96	4	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	2847	213
FGFBP1	9982	broad.mit.edu	37	4	15937922	15937922	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15937922A>G	uc003gom.2	-	2	452	c.334T>C	c.(334-336)TAT>CAT	p.Y112H		NM_005130	NP_005121	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	112					cell-cell signaling|negative regulation of cell proliferation|signal transduction	extracellular space|plasma membrane	heparin binding				0						TGTTTCCAATAGACTCTCTCA	0.448													25	164	---	---	---	---	capture	Missense_Mutation	SNP	15937922	15937922	FGFBP1	4	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	5806	213
ARAP2	116984	broad.mit.edu	37	4	36168644	36168644	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:36168644G>C	uc003gsq.1	-	10	2221	c.1883C>G	c.(1882-1884)ACC>AGC	p.T628S	ARAP2_uc003gsr.1_Missense_Mutation_p.T628S	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	628	PH 2.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						AGGAATTATGGTAATACCAAG	0.294													21	100	---	---	---	---	capture	Missense_Mutation	SNP	36168644	36168644	ARAP2	4	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	832	213
RBM47	54502	broad.mit.edu	37	4	40440352	40440352	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440352C>T	uc003gvc.2	-	4	1269	c.559G>A	c.(559-561)GCG>ACG	p.A187T	RBM47_uc003gvd.2_Missense_Mutation_p.A187T|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.A149T|RBM47_uc003gvg.1_Missense_Mutation_p.A187T	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	187	RRM 2.					nucleus	nucleotide binding|RNA binding			breast(3)	3						TTGTCGGCCGCGCTGGCGTAG	0.637													8	103	---	---	---	---	capture	Missense_Mutation	SNP	40440352	40440352	RBM47	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13036	213
TMEM150C	441027	broad.mit.edu	37	4	83417295	83417295	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:83417295G>T	uc003hmy.1	-	6	367	c.289C>A	c.(289-291)CCG>ACG	p.P97T	TMEM150C_uc011ccj.1_Missense_Mutation_p.P127T	NM_001080506	NP_001073975	B9EJG8	T150C_HUMAN	transmembrane protein 150C	97						integral to membrane				ovary(1)	1						TTCAGCCACGGGTTTAAAACC	0.418													18	92	---	---	---	---	capture	Missense_Mutation	SNP	83417295	83417295	TMEM150C	4	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	15953	213
ENPEP	2028	broad.mit.edu	37	4	111430927	111430927	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:111430927G>T	uc003iab.3	+	5	1500	c.1158G>T	c.(1156-1158)AGG>AGT	p.R386S		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	386	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	ACCAACAGAGGGTGGCCACTG	0.453													14	118	---	---	---	---	capture	Missense_Mutation	SNP	111430927	111430927	ENPEP	4	G	T	T	T	1	0	0	0	0	1	0	0	0	555	43	4	4	5083	213
ALPK1	80216	broad.mit.edu	37	4	113353567	113353567	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113353567G>A	uc003iap.3	+	11	3143	c.2864G>A	c.(2863-2865)GGG>GAG	p.G955E	ALPK1_uc003ian.3_Missense_Mutation_p.G955E|ALPK1_uc011cfx.1_Missense_Mutation_p.G877E|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Missense_Mutation_p.G783E	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	955	Ser-rich.						ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		AATTCCAGTGGGAGTTCTTGG	0.512													13	113	---	---	---	---	capture	Missense_Mutation	SNP	113353567	113353567	ALPK1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	544	213
PPID	5481	broad.mit.edu	37	4	159638287	159638287	+	Missense_Mutation	SNP	A	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159638287A>C	uc003iqc.2	-	4	511	c.399T>G	c.(397-399)TTT>TTG	p.F133L		NM_005038	NP_005029	Q08752	PPID_HUMAN	peptidylprolyl isomerase D	133	PPIase cyclophilin-type.				protein folding	cytoplasm|intermediate filament cytoskeleton	cyclosporin A binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0159)		CTGTTGTGATAAAAAACTGAG	0.403													36	169	---	---	---	---	capture	Missense_Mutation	SNP	159638287	159638287	PPID	4	A	C	C	C	1	0	0	0	0	1	0	0	0	167	13	4	4	12222	213
TUBB4Q	56604	broad.mit.edu	37	4	190903815	190903815	+	Missense_Mutation	SNP	G	A	A	rs17799221		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:190903815G>A	uc011clg.1	-	4	1168	c.1165C>T	c.(1165-1167)CGC>TGC	p.R389C		NM_020040	NP_064424	Q99867	TBB4Q_HUMAN	tubulin, beta polypeptide 4, member Q	390					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)		AAGGCCTTGCGCCTGAACGTT	0.547													33	219	---	---	---	---	capture	Missense_Mutation	SNP	190903815	190903815	TUBB4Q	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16641	213
PIK3R1	5295	broad.mit.edu	37	5	67591085	67591085	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591085G>C	uc003jva.2	+	13	2238	c.1678G>C	c.(1678-1680)GAC>CAC	p.D560H	PIK3R1_uc003jvb.2_Missense_Mutation_p.D560H|PIK3R1_uc003jvc.2_Missense_Mutation_p.D260H|PIK3R1_uc003jvd.2_Missense_Mutation_p.D290H|PIK3R1_uc003jve.2_Missense_Mutation_p.D239H|PIK3R1_uc011crb.1_Missense_Mutation_p.D230H	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	560					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.D560_S565del(1)|p.R557_K561>Q(1)|p.D560Y(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TCGAGAAATTGACAAACGTAT	0.358			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			14	119	---	---	---	---	capture	Missense_Mutation	SNP	67591085	67591085	PIK3R1	5	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	11821	213
MCTP1	79772	broad.mit.edu	37	5	94288921	94288921	+	Splice_Site	SNP	A	G	G			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94288921A>G	uc003kkx.2	-	3	981	c.981_splice	c.e3+1	p.K327_splice	MCTP1_uc003kkv.2_Splice_Site_p.K106_splice|MCTP1_uc003kkw.2_Splice_Site_p.K106_splice|MCTP1_uc003kkz.2_Splice_Site	NM_024717	NP_078993	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		TAAATGGCTCACCTTTATATA	0.363													5	44	---	---	---	---	capture	Splice_Site	SNP	94288921	94288921	MCTP1	5	A	G	G	G	1	0	0	0	0	0	0	1	0	78	6	5	3	9313	213
YIPF5	81555	broad.mit.edu	37	5	143540055	143540055	+	Missense_Mutation	SNP	A	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:143540055A>C	uc003lnk.3	-	6	1121	c.680T>G	c.(679-681)TTT>TGT	p.F227C	YIPF5_uc003lnl.3_Missense_Mutation_p.F227C|YIPF5_uc010jgl.2_Missense_Mutation_p.F173C	NM_001024947	NP_001020118	Q969M3	YIPF5_HUMAN	Yip1 domain family, member 5	227	Cytoplasmic (Potential).				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle|Golgi cisterna membrane|integral to membrane				ovary(1)|skin(1)	2		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TGCAGAAATAAATATTTTGGA	0.388													15	64	---	---	---	---	capture	Missense_Mutation	SNP	143540055	143540055	YIPF5	5	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	17362	213
FAT2	2196	broad.mit.edu	37	5	150921921	150921921	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150921921C>T	uc003lue.3	-	9	8780	c.8767G>A	c.(8767-8769)GAA>AAA	p.E2923K	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2923	Extracellular (Potential).|Cadherin 26.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCACCAGTTCGCCAGGCTCA	0.512													73	273	---	---	---	---	capture	Missense_Mutation	SNP	150921921	150921921	FAT2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5636	213
BTN3A2	11118	broad.mit.edu	37	6	26373202	26373202	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26373202G>A	uc010jqh.1	+	6	1052	c.793G>A	c.(793-795)GGA>AGA	p.G265R	BTN3A2_uc003nho.1_Missense_Mutation_p.G263R|BTN3A2_uc003nhp.2_Missense_Mutation_p.G265R|BTN3A2_uc011dkd.1_Missense_Mutation_p.G223R|BTN3A2_uc011dke.1_Missense_Mutation_p.G242R|BTN3A2_uc010jqi.1_Missense_Mutation_p.G263R	NM_007047	NP_008978	P78410	BT3A2_HUMAN	butyrophilin, subfamily 3, member A2 precursor	265	Helical; (Potential).					integral to membrane					0						GCTTCTCGCCGGAGCCAGTTA	0.542													10	136	---	---	---	---	capture	Missense_Mutation	SNP	26373202	26373202	BTN3A2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1551	213
PRSS35	167681	broad.mit.edu	37	6	84234218	84234218	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84234218G>A	uc003pjz.2	+	2	1221	c.1058G>A	c.(1057-1059)CGT>CAT	p.R353H	PRSS35_uc010kbm.2_Missense_Mutation_p.R353H	NM_153362	NP_699193	Q8N3Z0	PRS35_HUMAN	protease, serine, 35 precursor	353	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		GTCTATCTGCGTCTGAAAGAT	0.512													19	126	---	---	---	---	capture	Missense_Mutation	SNP	84234218	84234218	PRSS35	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12519	213
OPRM1	4988	broad.mit.edu	37	6	154412222	154412222	+	Missense_Mutation	SNP	G	A	A	rs1799974		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:154412222G>A	uc003qpr.2	+	3	1016	c.779G>A	c.(778-780)CGC>CAC	p.R260H	OPRM1_uc011efc.1_Missense_Mutation_p.R179H|OPRM1_uc011efd.1_Missense_Mutation_p.R160H|OPRM1_uc011efe.1_Missense_Mutation_p.R353H|OPRM1_uc003qpn.2_Missense_Mutation_p.R260H|OPRM1_uc003qpo.1_Missense_Mutation_p.R260H|OPRM1_uc011eff.1_Missense_Mutation_p.R260H|OPRM1_uc011efg.1_Missense_Mutation_p.R260H|OPRM1_uc011efh.1_Missense_Mutation_p.R260H|OPRM1_uc003qpq.1_Missense_Mutation_p.R260H|OPRM1_uc003qpt.1_Missense_Mutation_p.R260H|OPRM1_uc011efi.1_Missense_Mutation_p.R260H|OPRM1_uc003qpp.2_RNA|OPRM1_uc003qps.2_RNA|OPRM1_uc010kjg.2_Missense_Mutation_p.R160H|OPRM1_uc003qpu.2_Missense_Mutation_p.R160H	NM_000914	NP_000905	P35372	OPRM_HUMAN	opioid receptor, mu 1 isoform MOR-1	260	Cytoplasmic (Potential).				behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)	ATGATCTTGCGCCTCAAGAGT	0.502													33	183	---	---	---	---	capture	Missense_Mutation	SNP	154412222	154412222	OPRM1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10791	213
RABGEF1	27342	broad.mit.edu	37	7	66240254	66240254	+	Missense_Mutation	SNP	A	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:66240254A>T	uc011kee.1	+	3	426	c.262A>T	c.(262-264)AGC>TGC	p.S88C	RABGEF1_uc003tvf.2_5'UTR|RABGEF1_uc003tvg.2_5'UTR|RABGEF1_uc010lag.2_Missense_Mutation_p.S74C|RABGEF1_uc003tvh.2_Missense_Mutation_p.S74C|RABGEF1_uc003tvi.2_5'UTR	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	252	Interaction with ubiquitinated proteins.				endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						CAGCAGTCAGAGCAGCCAAGG	0.473													14	103	---	---	---	---	capture	Missense_Mutation	SNP	66240254	66240254	RABGEF1	7	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	12861	213
PPP1R3A	5506	broad.mit.edu	37	7	113519322	113519322	+	Missense_Mutation	SNP	C	T	T	rs144397367		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113519322C>T	uc010ljy.1	-	4	1856	c.1825G>A	c.(1825-1827)GCT>ACT	p.A609T		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	609					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						CCTCCTAAAGCGCTGCCTTCA	0.403													40	284	---	---	---	---	capture	Missense_Mutation	SNP	113519322	113519322	PPP1R3A	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12272	213
ZNF786	136051	broad.mit.edu	37	7	148769373	148769373	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148769373C>T	uc003wfh.2	-	4	628	c.491G>A	c.(490-492)GGA>GAA	p.G164E	ZNF786_uc011kuk.1_Missense_Mutation_p.G127E|ZNF786_uc003wfi.2_Missense_Mutation_p.G78E	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	164					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			ACCTGGGATTCCTTCTTTTAG	0.617													5	43	---	---	---	---	capture	Missense_Mutation	SNP	148769373	148769373	ZNF786	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	18034	213
KRBA1	84626	broad.mit.edu	37	7	149427522	149427522	+	Silent	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149427522G>A	uc003wfz.2	+	16	2409	c.2010G>A	c.(2008-2010)AGG>AGA	p.R670R	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_Silent_p.R277R	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	670	Pro-rich.									ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGTTAGAGAGGGACCGCCTTC	0.642													7	7	---	---	---	---	capture	Silent	SNP	149427522	149427522	KRBA1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	555	43	2	2	8359	213
NSMAF	8439	broad.mit.edu	37	8	59512581	59512581	+	Splice_Site	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59512581C>T	uc003xtt.2	-	17	1495	c.1281_splice	c.e17-1	p.S427_splice	NSMAF_uc011lee.1_Splice_Site_p.S458_splice	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				TTCTGCAATACTACATATGAA	0.269													19	120	---	---	---	---	capture	Splice_Site	SNP	59512581	59512581	NSMAF	8	C	T	T	T	1	0	0	0	0	0	0	1	0	260	20	5	2	10581	213
PKHD1L1	93035	broad.mit.edu	37	8	110497284	110497284	+	Silent	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110497284G>A	uc003yne.2	+	58	9692	c.9588G>A	c.(9586-9588)GAG>GAA	p.E3196E		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	3196	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGGGAGAAGAGATTGTGATAA	0.284										HNSCC(38;0.096)			16	56	---	---	---	---	capture	Silent	SNP	110497284	110497284	PKHD1L1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	11875	213
TRPS1	7227	broad.mit.edu	37	8	116426785	116426785	+	Missense_Mutation	SNP	G	T	T	rs145393309		TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:116426785G>T	uc003ynz.2	-	6	3771	c.3312C>A	c.(3310-3312)TTC>TTA	p.F1104L	TRPS1_uc011lhy.1_Missense_Mutation_p.F1108L|TRPS1_uc003yny.2_Missense_Mutation_p.F1117L|TRPS1_uc010mcy.2_Missense_Mutation_p.F1104L	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	1104	Mediates interaction with RNF4 (By similarity).				negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.F1104F(1)		ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CTTCACTCTGGAAGTCATTAT	0.473									Langer-Giedion_syndrome				18	80	---	---	---	---	capture	Missense_Mutation	SNP	116426785	116426785	TRPS1	8	G	T	T	T	1	0	0	0	0	1	0	0	0	529	41	4	4	16476	213
COL14A1	7373	broad.mit.edu	37	8	121293282	121293282	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121293282G>A	uc003yox.2	+	31	4073	c.3808G>A	c.(3808-3810)GTT>ATT	p.V1270I	COL14A1_uc003yoz.2_Missense_Mutation_p.V235I	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	1270	Nonhelical region (NC4).|TSP N-terminal.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AGATGCCCTGGTTTCCCAGCC	0.378													30	131	---	---	---	---	capture	Missense_Mutation	SNP	121293282	121293282	COL14A1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	3636	213
POLA1	5422	broad.mit.edu	37	X	24766501	24766501	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:24766501G>A	uc004dbl.2	+	25	2770	c.2747G>A	c.(2746-2748)CGG>CAG	p.R916Q		NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	916					cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	AGAGAGATCCGGAAACTGGTA	0.284													11	91	---	---	---	---	capture	Missense_Mutation	SNP	24766501	24766501	POLA1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12090	213
MAGEB2	4113	broad.mit.edu	37	X	30236767	30236767	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30236767G>T	uc004dbz.2	+	2	173	c.70G>T	c.(70-72)GGT>TGT	p.G24C		NM_002364	NP_002355	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	24							protein binding			ovary(1)	1						TGAGACCCGGGGTCTCAATGT	0.577													8	46	---	---	---	---	capture	Missense_Mutation	SNP	30236767	30236767	MAGEB2	23	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	9090	213
MAGEB4	4115	broad.mit.edu	37	X	30260607	30260607	+	Missense_Mutation	SNP	T	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30260607T>A	uc004dcb.2	+	1	439	c.355T>A	c.(355-357)TTC>ATC	p.F119I	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	119	MAGE.									ovary(1)	1						GTTAGTGCAGTTCCTGCTGTA	0.443													8	49	---	---	---	---	capture	Missense_Mutation	SNP	30260607	30260607	MAGEB4	23	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	9092	213
DMD	1756	broad.mit.edu	37	X	32404521	32404521	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32404521C>T	uc004dda.1	-	33	4824	c.4580G>A	c.(4579-4581)CGT>CAT	p.R1527H	DMD_uc004dcw.2_Missense_Mutation_p.R183H|DMD_uc004dcx.2_Missense_Mutation_p.R186H|DMD_uc004dcz.2_Missense_Mutation_p.R1404H|DMD_uc004dcy.1_Missense_Mutation_p.R1523H|DMD_uc004ddb.1_Missense_Mutation_p.R1519H|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1527	Spectrin 10.|Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TACAATCTGACGTCCAGTCTT	0.353													24	225	---	---	---	---	capture	Missense_Mutation	SNP	32404521	32404521	DMD	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4538	213
OTC	5009	broad.mit.edu	37	X	38260580	38260580	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:38260580G>A	uc004def.3	+	5	653	c.439G>A	c.(439-441)GAT>AAT	p.D147N		NM_000531	NP_000522	P00480	OTC_HUMAN	ornithine carbamoyltransferase precursor	147					arginine biosynthetic process|urea cycle	mitochondrial matrix|ornithine carbamoyltransferase complex	ornithine carbamoyltransferase activity			ovary(1)|breast(1)	2					L-Citrulline(DB00155)|L-Ornithine(DB00129)	TAAACAATCAGATTTGGACAC	0.408													11	63	---	---	---	---	capture	Missense_Mutation	SNP	38260580	38260580	OTC	23	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	11205	213
MAGED1	9500	broad.mit.edu	37	X	51640084	51640084	+	Missense_Mutation	SNP	T	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:51640084T>A	uc004dpm.2	+	4	1428	c.1333T>A	c.(1333-1335)TCG>ACG	p.S445T	MAGED1_uc004dpn.2_Missense_Mutation_p.S501T|MAGED1_uc004dpo.2_Missense_Mutation_p.S445T	NM_001005332	NP_001005332	Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1 isoform b	445	Pro-rich.				apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding			ovary(3)	3	Ovarian(276;0.236)					CCTGCGCCCCTCGCCTAACCT	0.602										Multiple Myeloma(10;0.10)			4	37	---	---	---	---	capture	Missense_Mutation	SNP	51640084	51640084	MAGED1	23	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	9097	213
CDX4	1046	broad.mit.edu	37	X	72667161	72667161	+	Silent	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:72667161C>T	uc011mqk.1	+	1	72	c.72C>T	c.(70-72)GAC>GAT	p.D24D		NM_005193	NP_005184	O14627	CDX4_HUMAN	caudal type homeobox 4	24						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(35;0.156)					CTGGGGGCGACGGCACAGCTG	0.612													9	77	---	---	---	---	capture	Silent	SNP	72667161	72667161	CDX4	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3153	213
PCDH19	57526	broad.mit.edu	37	X	99662512	99662512	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99662512C>T	uc010nmz.2	-	1	2760	c.1084G>A	c.(1084-1086)GCC>ACC	p.A362T	PCDH19_uc004efw.3_Missense_Mutation_p.A362T|PCDH19_uc004efx.3_Missense_Mutation_p.A362T	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	362	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						CCCGGGGGGGCGCTCTCGCTG	0.607													13	128	---	---	---	---	capture	Missense_Mutation	SNP	99662512	99662512	PCDH19	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11417	213
DDX26B	203522	broad.mit.edu	37	X	134681139	134681139	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134681139G>A	uc004eyw.3	+	6	1054	c.691G>A	c.(691-693)GTA>ATA	p.V231I		NM_182540	NP_872346	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide	231											0	Acute lymphoblastic leukemia(192;6.56e-05)					TCAGAGTGGTGTAGTTATTAA	0.338													77	418	---	---	---	---	capture	Missense_Mutation	SNP	134681139	134681139	DDX26B	23	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4311	213
CSAG1	158511	broad.mit.edu	37	X	151908921	151908921	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151908921C>A	uc004fge.2	+	4	488	c.160C>A	c.(160-162)CCA>ACA	p.P54T	CSAG1_uc004fgf.2_Missense_Mutation_p.P54T|CSAG1_uc004fgd.2_RNA	NM_153478	NP_705611	Q6PB30	CSAG1_HUMAN	chondrosarcoma associated gene 1 precursor	54										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CCCATCAACACCAAAGAGGCG	0.557													33	310	---	---	---	---	capture	Missense_Mutation	SNP	151908921	151908921	CSAG1	23	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	3891	213
G6PD	2539	broad.mit.edu	37	X	153760436	153760436	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153760436T>C	uc004fly.1	-	12	1537	c.1424A>G	c.(1423-1425)GAG>GGG	p.E475G	G6PD_uc004flx.1_Missense_Mutation_p.E505G	NM_001042351	NP_001035810	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase isoform b	475					cellular response to oxidative stress|cholesterol biosynthetic process|cytokine production|erythrocyte maturation|glucose 6-phosphate metabolic process|glutathione metabolic process|negative regulation of protein glutathionylation|pentose-phosphate shunt, oxidative branch|ribose phosphate biosynthetic process	centrosome|cytosol|internal side of plasma membrane|intracellular membrane-bounded organelle	glucose binding|glucose-6-phosphate dehydrogenase activity|NADP binding|protein homodimerization activity			ovary(4)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTTGGGCTTCTCCAGCTCAAT	0.627													5	37	---	---	---	---	capture	Missense_Mutation	SNP	153760436	153760436	G6PD	23	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	6088	213
MRPS26	64949	broad.mit.edu	37	20	3027090	3027090	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3027090delC	uc002whs.2	+	2	324	c.284delC	c.(283-285)GCCfs	p.A95fs		NM_030811	NP_110438	Q9BYN8	RT26_HUMAN	mitochondrial ribosomal protein S26 precursor	95					DNA damage response, detection of DNA damage	mitochondrial small ribosomal subunit					0						GAGCGCAAGGCCCTGAAGGAC	0.627													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	3027090	3027090	MRPS26	20	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	9747	213
TIMD4	91937	broad.mit.edu	37	5	156378745	156378747	+	In_Frame_Del	DEL	TTG	-	-			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156378745_156378747delTTG	uc003lwh.2	-	3	512_514	c.455_457delCAA	c.(454-459)ACAAGC>AGC	p.T152del	TIMD4_uc010jii.2_In_Frame_Del_p.T152del	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	152	Extracellular (Potential).|Thr-rich.					integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTGGTGGGGCTTGTTGTTGTTGT	0.537													8	611	---	---	---	---	capture_indel	In_Frame_Del	DEL	156378745	156378747	TIMD4	5	TTG	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	15788	213
REPS1	85021	broad.mit.edu	37	6	139251126	139251126	+	Frame_Shift_Del	DEL	A	-	-			TCGA-28-2513-01	TCGA-28-2513-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:139251126delA	uc003qii.2	-	9	1824	c.1245delT	c.(1243-1245)AATfs	p.N415fs	REPS1_uc003qig.3_Frame_Shift_Del_p.N415fs|REPS1_uc011edr.1_Frame_Shift_Del_p.N415fs|REPS1_uc003qij.2_Frame_Shift_Del_p.N415fs|REPS1_uc003qik.2_Frame_Shift_Del_p.N48fs	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	415						coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		CACTGCTCTGATTCAGCTCAG	0.448													35	257	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	139251126	139251126	REPS1	6	A	-	-	-	1	0	1	0	1	0	0	0	0	154	12	5	5	13123	213
